CN106139163A - A kind of microRNA suppressing osteoarthritis and application thereof - Google Patents

Abstract

The present invention relates to a kind of microRNA suppressing osteoarthritis and application thereof.Disclosing growth differentiation factor-5 (GDF-5) first and having regulating and controlling effect to miR-17, the rise of miR-17 has significant effect for alleviating or treating osteoarthritis.Therefore, miR-17 can be as the new therapy target of osteoarthritis.

Description

A kind of microRNA suppressing osteoarthritis and application thereof

Technical field

The present invention relates to biological technical field, more particularly it relates to an the microRNA of suppression osteoarthritis and application thereof.

Background technology

Osteoarthritis (osteoarthritis, OA) is a kind of common chronic joint diseases, and illness rate is high, involves the over-65s crowd exceeding half, row whole world disabling disease the 6th, has people more than 200,000,000 every year and seeks medical advice because of the symptom that causes of OA.OA major lesions is the retrogression of articular cartilage, and synovitis and Secondary cases spur are formed.Being apt to occur in the position such as finger-joint of bear a heavy burden big knee joint, ankle-joint, backbone and frequent activities, this walks upright with the mankind and finely finger movement has some relations frequently.OA causes articular cartilage damage, ossis fibrillatable and Subchondral bone sclerosis, causes patient articular's pain, moving obstacle and joint deformity, has had a strong impact on the quality of life of patient.The pathogenic factor of OA is not fully understood, and its development that occurs is a kind of long-term, chronic, progressive pathologic process, and age, obesity, mechanical damage and heredity are main hazards.As elderly population increase rapidly, socioeconomic impact will be more notable by osteoarthritis.Most treatment method such as pain relieving, physical treatment and joint cavity injection etc. can only alleviate the symptom of disease clinically at present, and the progress of cartilage destruction and spur can not be stoped to be formed.OA is developed to advanced joint cartilage and significantly strips off, and function of joint is lost and finally disables, and can only carry out prosthetic replacement.It is thus desirable to research and develop the critical stage that new treatment means are reinvented to intervene osteoarthritic joint and destroyed, stop the progress of disease, promote the recovery of function of joint.

Growth and differentiation factor 5 (Growth and Differentiation Factor 5, GDF-5) in BMP family participates in the formation in regulation and control joint.GDF-5 promotes the differentiation of cartilage cell, strengthens mescenchymal stem cell to cartilage differentiation ability.What is more important, Miyamoto etc. finds that the rs143383SNP and hip joint OA of GDF-5 promoter region have extremely strong correlation, also have correlation with Japanese and Chinese knee joint OA, and result in the downward that GDF-5 transcribes.Then, the functional variants of rs143383 is proved the knee joint OA with white man and there is also and associate.This is that a few can reach full-length genome correlation research (GWAS) statistical significance, and without heterogeneous hereditary variation result in difference research.The studies above height point out: GDF-5 plays an important role for the stable state of articular cartilage, the present inventor infer increase GDF-5 express or strengthen its downstream signal path may to prevention and treatment OA have positive effect.

But, can GDF-5 stop the degraded of cartilage matrix？What the mechanism of action of GDF-5 is？These problems are all urgently answered.

Content of the invention

It is an object of the invention to provide a kind of microRNA suppressing osteoarthritis and application thereof.

In a first aspect of the present invention, a kind of miR-17 is provided or adjusts in preparation prevention on it, alleviate or the purposes in the medicine for the treatment of osteoarthritis.

In a preference, adjustment on described miR-17 includes: miR-17 analogies (miR-17 mimic), miR-17 activator (Agomir-17).

In another preference, described miR-17 analogies forward sequence is as shown in SEQ ID NO:9, and reverse sequence is as shown in SEQ ID NO:10.

In another preference, the forward sequence of described miR-17 activator is as shown in SEQ ID NO:11, and reverse sequence is as shown in SEQ ID NO:12.

In another preference, described miR-17 activator is modified in its antisense strand: 3 ' end cholesterol are modified, and 3 ' four sulphur of end are for backbone modification, and 5 ' hold two sulphur for backbone modification, full chain methoxyl group is modified.

In another preference, described medicine is additionally operable to: the expression of suppression MMP3, MMP13, NOS2 or ADAMTS5.

In another aspect of this invention, the purposes of a kind of miR-17 is provided, for screening the medicine of alleviation, prevention or treatment osteoarthritis.

In another aspect of this invention, providing the medicine of a kind of prevention, alleviation or treatment osteoarthritis, described medicine is the upper adjustment of miR-17, is selected from:

MiR-17 analogies, its forward sequence is as shown in SEQ ID NO:9, and reverse sequence is as shown in SEQ ID NO:10；Or

MiR-17 activator, its forward sequence is as shown in SEQ ID NO:11, and reverse sequence is as shown in SEQ ID NO:12.

In another aspect of this invention, providing a kind of method of potential material screening prevention, alleviation or treatment osteoarthritis, described method includes:

(1) system of expression miR-17 is processed by candidate substances；With

(2) expression of miR-17 in described system is detected；

Wherein, if described candidate substances can improve miR-17 and (preferably significantly improve, as improved more than 20%, preferably improve more than 50%；More preferably improve more than 80%) expression, then show this candidate substances be prevention, alleviate or treatment osteoarthritis potential material.

In a preference, step (1) includes: in test group, joins candidate substances in the system expressing miR-17；And/or

Step (2) includes: the expression of miR-17 in the system of detection test group, and compares with control group, and wherein said control group is the system of the expression miR-17 without described candidate substances；

It (is preferably significantly higher than if the expression of miR-17 is higher than statistically in test group, such as improved more than 20%, preferably improves more than 50%；More preferably improve more than 80%) control group, indicate that this material standed for is prevention or the potential material for the treatment of osteoarthritis.

In another preference, described candidate substances may is that based on miR-17 or regulates and controls its gene expressed or albumen and the big molecule (such as peptide, over-express vector) that designs or little molecule (such as compound).

In another preference, described system is selected from: cell system (or cell culture system), subcellular fraction system, solution system, organizational framework, organ systems or animal system.

In another preference, described method also includes: carry out further cell experiment and/or animal experiment to the potential material obtaining, to select further from candidate substances and to determine the material useful for prevention or treatment bone metabolic disease.

The other side of the present invention, due to this disclosure, is apparent to those skilled in the art.

Brief description

Fig. 1, (left) do inner incision along ligamentum patellae and open mouse knee joint cavity, then blunt separation fat pad expose medial meniscus and medial meniscus shin bone ligament (MMTL)；After (right) cuts off MMTL, the inside lateral dislocation of meniscus.F=fibula；T=shin bone；ACL=ACL.

The cartilage of osteoarthritis that Fig. 2, intraarticular injection GDF-5 can stop DMM to cause destroys (observation of sagittal plain Histological section).

Safranin O dyeing display sham-operation (A) or DMM (B, C, D) the articular cartilage damage situation of postoperative 8 weeks.Within postoperative 4th week, rise, intraarticular injection PBS (A, B) or GDF-5 (20=20ng, 100=100ng) (C, D), 1 times a week.E, F, G, H are the partial enlarged drawings of A, B, C, D.Scale is 150 μm.

The cartilage of osteoarthritis that Fig. 3, intraarticular injection GDF-5 can stop DMM to cause destroys (observation of Coronal Histological section).

Safranin O dyeing display sham-operation or the DMM articular cartilage damage situation of postoperative 8 weeks.Within postoperative 4th week, rise, intraarticular injection PBS or GDF-5 (20=20ng, 100=100ng every needle injection amount), 1 times a week.Scale is 150 μm.

The maturation of Fig. 4, GDF-5 suppression postoperative spur of DMM.

Safranin O dyeing display sham-operation (A) or DMM (B, C, D) the spur formational situation of postoperative 8 weeks.Within postoperative 4th week, rise, intraarticular injection PBS (A, B) or GDF-5 (20=20ng, 100=100ng) (C, D), 1 times a week.Scale is 100 μm.

The cartilage of osteoarthritis that Fig. 5, intraarticular injection GDF-5 can delay DMM to cause destroys and spur is ripe (histological score).

Mankin scoring (n=18) (A) of sham-operation or the DMM articular cartilage of postoperative 8 weeks and spur maturity scoring (n=9) (B).Within postoperative 4th week, rise, intraarticular injection PBS or GDF-5 (20=20ng, 100=100ng), 1 times a week.Compare with sham-operation group, * P < 0.05, * * P < 0.01 (Mann-Whitney U test).

Fig. 6, GDF-5 regulation and control to chondrocyte phenotype.

(A, B) mouse primary articular chondrocytes IL-1 β (5ng/ml) or IL-1 β and variable concentrations GDF-5 (100=100ng/ml, mixed liquor 300=300ng/ml) stimulates, and the expression (n=5) of gene (A) and synthetic gene (B) is decomposed in qRT-PCR detection；(C, D) cartilage cell stimulates with IL-1 β (5ng/ml) and/or GDF-5 (300ng/ml), the expression (n=4) of Western blot detection decomposition of protein (C) and synthetic proteins (D).Compare with control group, * P < 0.01, * * P < 0.001 (student ' s t test).

Fig. 7, in cartilage cell, the regulating and controlling effect to miR-17 for the GDF-5.

A () GDF-5 (300ng/ml) acts on cartilage cell 24 hours after, the situation of change of miRNA expression.B () qRT-PCR detection GDF-5 and/or IL-1 β acts on Mouse cartilage cell 24 hours after, the expression change of miR-17.

The inhibitory action of the decomposition phenotype that IL-1 β is caused by Fig. 8, miR-17.

(a, after b) cartilage cell transfects miR inhibitor NC (100nM) or miR-17 inhibitor 24h, acts on the expression of cartilage cell 36h, qPCR and Western blot detection each decomposition gene with IL-1 β and/or GDF-5.

(c, after d) cartilage cell transfects miR mimic NC (50nM) or miR-17 mimic 24h, acts on the expression of cartilage cell 36h, qPCR and Western blot detection each decomposition gene with IL-1 β and/or GDF-5.Experiment every time is repeated 4 times.*P<0.01(ANOVA).

3 ' the UTR luciferase assay of Fig. 9, MMP3, MMP13, NOS2, ADAMTS5.

Figure 10, the result for the treatment of to osteoarthritis for the intraarticular injection Agomir-17.

(left) Safranin O dyeing display DMM Coronal articular cartilage damage situation of postoperative 8 weeks.Within postoperative 4th week, rise, intraarticular injection Agomir-NC (1.5nmol) or Agomir-17 (1.5nmol), 1 times a week.(right) Mankin marks.N=9, * * P < 0.01 (Mann-Whitney U test).

Detailed description of the invention

The present inventor is through in-depth study, discovery growth differentiation factor-5 (Growth and Differentiation Factor-5, GDF-5) having regulating and controlling effect to miR-17, the rise of miR-17 has significant effect for alleviating or treating osteoarthritis.Complete the present invention on this basis.

MiR-17 and therapeutical uses thereof

In the present invention, described miR-17 is the micro ribonucleic acid with nucleotide sequence shown in SEQ ID NO:1:

5’-CAAAGUGCUUACAGUGCAGGUAG-3’(SEQ ID NO:1)。

Described miR-17 can be isolatable from cell, or can obtain by way of Prof. Du Yucang.After knowing the sequence of miR-17 or its precursor, those skilled in the art can prepare miR-17 or its precursor easily.

Based on the elaboration of the present invention, miR-17 is the drug target that new and osteoarthritis is closely related.Various treatment means for miR-17 can be as the novelty of the osteoarthritis of preventing and treating animal (particularly people) and effective means.

Further, miR-17 can be used for the target spot as drug screening, and screening is by improving expressing or active and alleviation or treatment osteoarthritis medicine of miR-17.

The therapeutical uses of the upper adjustment of miR-17

Based on the new discovery of the present inventor, the upper adjustment of described miR-17 can be used for the composition that preparation is alleviated or treated osteoarthritis, particularly pharmaceutical composition.

The upper adjustment of described miR-17 refers to any activity improving miR-17 or its precursor, the stability improving miR-17 or its precursor, the expression raising miR-17 or its precursor, the material increasing miR-17 or its precursor effective acting time, these materials are used equally to the present invention, as the material useful for raising miR-17, thus can be used for alleviating or treat osteoarthritis.

As the preferred embodiment of the present invention, adjustment on described miR-17 is analogies (mimics) or the activator (Agomir) of miR-17, and it has the effect identical with described miR-17, or can improve expression or the activity of miR-17.

The upper adjustment of described miR-17 can be modified upper adjustment, and described modification includes: methoxylation modification, thio-modification, cholesterol modification, alkyl modified, the GEM 132 that lock nucleic acid is modified, peptide nucleic acid is modified and/or phosphate backbones is replaced by phosphatide connection；It is preferred that described modification includes: 3 ' ends carry out cholesterol modification, 5 ' two sulphur of end are for backbone modification, and 3 ' four sulphur of end are for backbone modification, and full chain methoxyl group is modified.

Pharmaceutical composition

Present invention also offers a kind of composition, it contains effective dose (such as 0.000001-50wt%；Preferably 0.00001-20wt%；More preferably, 0.0001-10wt%) described miR-17 or its on adjust (including analogies or activator), and pharmaceutically acceptable carrier.Described composition can be used for alleviating or treats osteoarthritis.

As used herein, amount that is described " effective dose " that refer to can to produce people and/or animal function or activity and that can be accepted by people and/or animal.Described " pharmaceutically acceptable carrier " refers to the carrier for Therapeutic Administration, including various excipient and diluent.This term refers to some medicament carriers such: themselves be not have undue toxicity after necessary active component, and administration.Suitable carrier is well known to those of ordinary skill in the art.Pharmaceutically acceptable carrier can contain liquid in the composition, such as water, salt solution, buffer solution.In addition, these carriers there is likely to be complementary material, such as filler, lubricant, glidant, wetting agent or emulsifying agent, pH buffer substance etc..Described carrier can also contain lipofectamine.

Know described miR-17 or on it adjust purposes after, can use multiple method well known in the art by described miR-17 or it on adjustment or their pharmaceutical composition deliver medicine to mammal.Including but not limited to: hypodermic injection, intramuscular injection, percutaneously give, administer locally to, implant, be sustained and give.

MiR-17 of the present invention or the effective dose adjusted on it can change with the order of severity etc. of the pattern being administered and disease to be treated.The selection of preferred effective dose can be determined (for example passing through clinical testing) by those of ordinary skill in the art according to various factors.Described factor includes but is not limited to: described miR-17 or the pharmacokinetic parameter such as bioavailability adjusted on it, metabolism, half-life etc.；The order of severity of patient's disease to be treated, the body weight of patient, the immune state of patient, the approach etc. of administration.Generally, when the miR-17 of the present invention or on it adjust every day give with the dosage of about 0.00001mg-50mg/kg the weight of animals (preferably 0.0001mg-10mg/kg the weight of animals), gratifying effect can be obtained.For example, an urgent demand by treatment situation, can give dosage several times separately every day, or reduce dosage pari passu.

MiR-17 is as the mark of osteoarthritis prognosis

According to the achievement in research of the present inventor, miR-17 is the closely related target spot of new and osteoarthritis a prognosis.Various detection reagent for miR-17 may be used for the prognosis of osteoarthritis, the curative effect of earlier evaluations osteoarthritis treatment medicine, optimizing therapeutic regimen.Patient can be passed judgment on by height before and after medication for the miR-17 expression after the treatment the need of long-term prescription.

Various techniques known in the art can be used to detect the presence or absence of intracellular miR-17 and expression, and these technology are included in the present invention.For example can be with existing technology such as hybridization in situ, polymerase chain reaction technology (PCR), Southern blotting, DNA sequence analysis etc., these methods may be used in combination.

Present invention also offers the reagent of the presence or absence for detection miR-17 in analyte and expression.As a kind of preferred embodiment, the primer of specific amplification miR-17 can be used；Or the probe of specific recognition miR-17 determines the presence or absence of miR-17.

As the preferred embodiment of the present invention, described reagent is primer, and it can go out miR-17 by specific amplification.It is furthermore preferred that described primer includes: the reverse transcription primer shown in SEQ ID NO:3.

Design for the specific probe of miR-17 is technology well known in the art, for example, a kind of probe of preparation, it can occur specific binding with specific site on miR-17, and other gene specifics beyond miR-17 are not combined, and described probe is with detectable signal.

Drug screening

After knowing the Close relation with osteoarthritis for the miR-17, the material of the expression (and upper adjustment of miR-17) improving miR-17 can be screened based on this feature.The medicine actually useful for prevention or treatment osteoarthritis can be found from described material.

Therefore, the present invention provides a kind of method of potential material screening and alleviating or treat osteoarthritis, and described method includes: process the system expressing miR-17 by candidate substances；With the expression detecting miR-17 in described system；If described candidate substances can improve the expression of miR-17, then show that this candidate substances is to alleviate or treat the potential material of osteoarthritis.The system of described expression miR-17 can be for example cell (or cell culture) system, and described cell can be the cell of endogenous expression miR-17；It can be or the cell of recombinant expressed miR-17.The system of described expression miR-17 can also is that subcellular fraction system, solution system, organizational framework, organ systems or animal system (animal model of such as animal model, preferably non-human mammal, such as mouse, rabbit, sheep, monkey etc.) etc..

In a preferred embodiment of the present invention, when entering row filter, in order to be more easily observable the change of the expression of miR-17, also can arrange control group, described control group can be the system of the expression miR-17 without described candidate substances.

As the preferred embodiment of the present invention, described method also includes: carry out further cell experiment and/or animal experiment to the potential material obtaining, to select further and to determine for the material alleviated or treatment osteoarthritis is actually useful.

The present invention has no particular limits for the expression of miR-17, activity, the detection method of amount.Gene quantification or the half-quantitative detection technology of routine can be used, such as (but not limited to): polymerase chain reaction technology (PCR), Southern blotting etc..

On the other hand, present invention also offers the potential material alleviating or treating osteoarthritis using described screening technique to obtain.The material that these Preliminary screening go out may make up a screening storehouse, in order to people may finally therefrom filter out for the expression improving miR-17 and activity, and then can be alleviated or treat the useful material of osteoarthritis.

Below in conjunction with specific embodiment, the present invention is expanded on further.Should be understood that these embodiments are merely to illustrate the present invention rather than limit the scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, generally writes according to normal condition such as J. Pehanorm Brooker etc., Molecular Cloning: A Laboratory guide, the third edition, Science Press, the condition described in 2002, or according to the condition proposed by manufacturer.

The preparation of mouse knee joint osteoarthritis model

Male C57BL/6 mouse is bought from Shanghai Slac Experimental Animal Co., Ltd., raises to 10 week old, and zoopery method of operating is by the examination and approval of Ethics Committee of medical college of Tongji University.Preparation process is as follows:

(1) after mouse anesthesia, inside knee joint, do longitudinal cut, inside ligamentum patellae, open articular cavity.

(2) fat pad of blunt separation intercondylar area, finds and connects the meniscus shin bone ligament of medial meniscus cross-section, such as Fig. 1.

(3) otch is closed after hemostasis by compression.

(4) anaesthetized in postoperative 8 weeks and put to death mouse, isolating knee joint and do histology.

(5) mouse random side knee joint is DMM, and opposite side is comparison joint.Joint for comparison includes do not perform the operation joint and sham-operation (expose but do not cut off ligament).

Intraarticular injection GDF-5 treats OA

The intervention effect to DMM for the GDF-5: DMM art, after 4 weeks, carries out GDF-5 (being purchased from peprotech company Catalog Number:315-24) injection, 1 times a week, totally 4 times, draws materials for i.e. postoperative 8 weeks.Dosage is divided into 20ng, 100ng two groups, with PBS for comparison.Carry out histological stain, cartilage destruction degree is marked.

Sarranine (Safranin-O)/fast green (fast green) dyeing and histological score

The destructiveness of articular cartilage is observed by Safranin-O/fast green staining conditions, by Mankin scoring (table 1) and spur maturity classification (0=without, 1=is mainly chondroid tissue, 2=endochondral ossification, 3=is mainly bone tissue) carry out quantitative assessment, scoring is independently carried out by two personnel being unaware of experiment packet.

Safranin-O/fast green dyes:

1st, paraffin section de-waxing is to water.

2nd, Safranin-O dye 20min.

3rd, 1% acetic acid rinses 1 time.

4th, fast green dyeing 3min.

5th, gradient alcohol dehydration after washing, dimethylbenzene is transparent and mounting.

Histological tissue pathological score system such as table 1.Mankin scoring is four score sums.

Table 1

The cultivation of mouse primary cartilage cell and induction

Mouse cartilage takes from C57BL/6 mouse knee joint in 7 day age.Under sterile working, cut the articular cartilage tissue including before and after's limb, and with the neutral collagenase digesting 8 hours of 0.2%, centrifugal obtain cell precipitation after with improvement Eagle culture medium (DMEM) the nutrient solution re-suspended cell containing 10%FBS and be inoculated in culture dish.β containing IL-1 is or/and the induction liquid of GDF-5 is prepared by serum-free DMEM nutrient solution.The induction liquid of β containing IL-1 and GDF-5 is being mixed by 1:1 by IL-1 β and GDF-5 of 2 times of concentration before use.

Ripe miRNA quantitative analysis

1. the stem ring primer according to ripe miRNA sequence design reverse transcription, and quantification PCR primer (table 3).

2. stem ring primer is diluted with water to final concentration 1 μM.

3. reverse transcription reaction:

4.PCR, U6 are internal reference.

Table the 3rd, RT primer and Real-time PCR primer sequence

Cell transfecting

1. day before transfection, cell culture fluid changes the nutrient solution of antibiotic-free into, as a example by 24 orifice plates, every hole 400ul.

2. the siRNA (or miR-17 inhibitor of miR-17 mimic or 50pmol of 25pmol) of 25pmol is mixed with 50ul serum-free medium.MiR mimics is double-stranded RNA, and miRinhibitors is single stranded RNA, and universal NC is the sequence of cel-miR-67, and confirms the similitude with people, the miRNA sequence of mouse with minimum.

3. being dissolved in 1ul lipofectamine 2000 in 50ul serum-free medium, being gently mixed uniformly, room temperature places 5min.

4. mixing two pipe liquid, room temperature places 25min.

5. add aforesaid liquid in cell culture fluid, and mix.

Change serum-free medium after 6.7h into, overnight use different cytokines process afterwards.

MiRNA analogies, activator and mortifier

MiRNA analogies micrON^TMMiRNA mimic and micrON^TMMiRNA agomir is purchased from Guangzhou Ribo Bio Co., Ltd..

MiRNA mimic, for ripe miRNA sequence particular design, the miRNA analogies prepared by chemical synthesis process, can significantly improve the expression of ripe miRNA.

MiRNA agomir specifically for ripe miRNA sequence, is prepared by chemical synthesis process, and the ripe miRNA double-stranded RNA that the stability using sharp rich biology special is modified, stability is higher, cell infiltration rate can be dramatically increased, improve its anti-RNase activity, be appropriate to miRNA zoopery.

micrON^TMMiRNA mimic Negative Control and micrON^TMThat miRNA agomir Negative Control selects is two miRNA of C.elegans, show itself and people, mouse, the genome of rat through bioinformatic analysis, it and all miRNA have the homology of minimum in miRBase database, is suitable as the miRNA experiment negative control of people, mouse, rat.

micrON^TMMiRNA mimic (miR-17 mimic): forward CAAAGUGCUUACAGUGCAGGUAG (SEQ ID NO:8)；Reverse ACCUGCACUGUAAGCACUUUGUU (SEQ ID NO:9).

micrON^TMMiRNA agomir (Agomir-17): forward CAAAGUGCUUACAGUGCAGGUAG (SEQ ID NO:10)；Reverse ACCUGCACUGUAAGCACUUUGUU (SEQ ID NO:11).Modifying at its antisense strand, 3 ' end cholesterol are modified, and full methoxy is modified, 3 ' two thio-modifications of end, 5 ' 4 thio-modifications of end.

micrON^TMMiRNA mimic Negative Control: forward UUCUCCGAACGUGUCACGUdTdT (SEQ ID NO:12)；Reverse ACGUGACACGUUCGGAGAAdTdT (SEQ ID NO:13).

micrON^TMMiRNA agomir Negative Control: forward UUCUCCGAACGUGUCACGUdTdT (SEQ ID NO:14)；Reverse ACGUGACACGUUCGGAGAAdTdT (SEQ ID NO:15).

MiR-17 inhibitor: forward CUACCUGCACUGUAAGCACUUUG (SEQ ID NO:16).

MiR inhibitor NC:UCUACUCUUUCUAGGAGGUUGUGA (SEQ ID NO:17).

3 ' UTR reporter gene detecting systems

Reporter gene detecting system is specifically used to whether detection miRNA there may be regulating and controlling effect with target gene, this report System Reports fluorescence (hRluc), construct target gene 3 ' UTR region downstream, by the monitoring to this fluorescence, i.e. can verify that whether miRNA has regulating and controlling effect to this target；Separately there is a correction fluorescence (hluc) as stablizing internal reference, be used for monitoring plasmid expression efficiency.

The structure of reporter gene plasmid vector: utilize PCR method, according to Adamts5 (mouse) NM_0117823 ' its amplimer of UTR sequence information design, the fragment of 3 ' UTR sequence 31-2515bp with 3T3 cell genomic dna for template PCR amplifications Adamts5 gene.3 ' the UTR sequence of MMP3, MMP13, NOS2 are carried out full genome synthesis by Shanghai Sheng Gong company.These 3 ' UTR sequence are cloned into pmiR-RB-REPORT respectively^TMIn Dual-Luciferase report carrier (Guangzhou Ribo Bio Co., Ltd.), the reporter fluorescence of used carrier is hRluc, and correction fluorescence is hluc (doing internal reference correction).

Reporter gene plasmid vector can form the special mRNA that firefly luciferase combines with target gene 3 ' UTR region after transcribing, if miRNA mimic can complementary with the mRNA comprising target gene 3 ' UTR combine, then the expression activity of luciferase is also significantly regulated and controled, therefore can the mRNA regulating effect to target gene for the quantitative analysis miRNA by the fluorescence intensity detecting luciferase.

3 ' UTR mutant primers

Primer for carrying out 3 ' UTR sudden changes is as follows:

MMP13: forward: 5 '-TCAGATTTACATCCAGAAATATACAACCAATAAA-3 ' (SEQ ID NO:18)

Reverse: 5 '-TTTATTGGTTGTATATTTCTGGATGTAAATCTGA-3 ' (SEQ ID NO:19)

MMP3: forward: 5 '-AAGGATGTTCAGAAGAGTCGTGTAGCTTACACTG-3 ' (SEQ ID NO:20)

Reverse: 5 '-CAGTGTAAGCTACACGACTCTTCTGAACATCCTT-3 ' (SEQ ID NO:21)

NOS2: forward: 5 '-CTCCTGACTGAAGCAAGGCGGGTGACCACCAGGA-3 ' (SEQ ID NO:22)

Reverse: 5 '-TCCTGGTGGTCACCCGCCTTGCTTCAGTCAGGAG-3 ' (SEQ ID NO:23) ADAMTS5: forward: 5 '-GCCCTTAGTATGTCAGAGCATAAACTTGGTCCTA-3 ' (SEQ ID NO:24)

Reverse: 5 '-TAGGACCAAGTTTATGCTCTGACATACTAAGGGC-3 ' (SEQ ID NO:25)

Embodiment the 1st, intraarticular injection GDF-5 delays the progress of OA cartilage destruction

Study the therapeutic action to mouse OA for the GDF-5 by intraarticular injection GDF-5.The Safranin O dyeing of knee joint sagittal plain Histological section confirms that GDF-5 can stop the arthritic progress of DMM Postoperative Bone.Injecting two joint face and meniscus Stability Analysis of Structures in PBS group after sham-operation, articular surface is smooth, and Safranin O dyeing is normal, does not has OA pathological characters (Fig. 2 A, E)；In DMM postoperative injection PBS group, tibial plateau front middle part cartilage destruction, it is deep to calcification district, in femur, condyle cartilage top layer is stripped off, and Safranin O dyeing significantly shoals (Fig. 2 B, F)；DMM postoperative injection GDF-5, dosage is in each 20ng group, and tibial plateau and femur show that Safranin O dyes the region that shoals, but do not cause cartilage structure to destroy (Fig. 2 C, G), illustrate that the GDF-5 of this dosage has certain protective effect to cartilage；DMM postoperative injection GDF-5; dosage is in each 100ng group; in femur, condyle cartilage surface is smooth, and Safranin O dyeing is deep, tibial plateau structural integrity; middle part has the Safranin O of little area to dye region (Fig. 2 D that shoals; H), illustrate that this dosage GDF-5 protection Chondrogenesis is higher, not only prevent the progress of OA; due to the rush synthesis of GDF-5, also certain reverse effect is had to the state of an illness having occurred.

The Safranin O dyeing same explanation GDF-5 of joint Coronal Histological section can stop the arthritic progress of DMM Postoperative Bone, and per injection dosage is the better of 100ng.In figure visible, in DMM postoperative injection PBS group, medial tibial plateau cartilage destruction is thinning, and condyle cartilage top layer out-of-flatness in femur, cartilage cell are loose, and Safranin O dyeing significantly shoals, and cell arrangement is disorderly (Fig. 3)；DMM postoperative injection GDF-5, dosage is in each 20ng group, and tibial plateau and femur top layer show that Safranin O dyes the region that shoals, and cartilage thickness has to a certain degree thinning (Fig. 3)；DMM postoperative injection GDF-5, dosage is in each 100ng group, tibial plateau structural integrity, and cartilage thickness is not thinning, and Safranin O dyeing is deep, and in femur, condyle cartilage surface is smooth, but cartilage Safranin O dyeing in part top layer shoals (Fig. 3).

Observing the spur formational situation in section, discovery GDF-5 can delay established spur to ossify speed.Postoperative 8 weeks of sham-operation, forms (Fig. 4 A) without spur.Postoperative 8 weeks of DMM, spur major part occurs ossified, ossis forms (Fig. 4 B), the spur ossification intensity that GDF-5 (20ng) organizes weakens, the ossis less (Fig. 4 C) being formed, the spur that GDF-5 (100ng) organizes is mainly chondroid tissue, ossified by obvious suppression (Fig. 4 D).

The joint Coronal and sagittal plain of GDF-5 treatment group and PBS group is cut into slices and carried out comprehensive grading, and the maturity of medial tibial plateau spur is marked, result shows, GDF-5 significantly reduces Mankin scoring, GDF-5 can suppress spur ripe, and the effect that GDF-5 (100ng) organizes is higher (Fig. 5).

The decomposition phenotype of embodiment the 2nd, GDF-5 suppression cartilage cell, strengthens synthesis phenotype

In order to study the impact on Mouse cartilage cell phenotype for the GDF-5, the present inventor detects the decomposition phenotype that can GDF-5 suppress IL-1 β to cause.With IL-1 β (5ng/ml) or/and GDF-5 (100ng/ml or 300ng/ml) Induction of chondrocytes 36h, decompose phenotype and synthesis phenotype with qRT-PCR and Western-blot detection.

After adding the GDF-5 of 300ng/ml, the decomposition phenotype that IL-1 β raises is obviously enhanced (Fig. 6 B, D) by obvious suppression (Fig. 6 A, C), synthesis phenotype, and the GDF-5 action effect of 100ng/ml is more weak.

Western-blot result also finds, the enhanced DeGrain of synthesis phenotype to normal chondrocyte for the GDF-5, but can significantly raise the synthesis phenotype (Fig. 6 D) of cell after IL-1 β is processed.

The expression of embodiment the 3rd, GDF-5 regulation and control microRNA-17 (miR-17)

The present inventor for the of a relatively high miRNA of expression in mouse articular cartilage, have detected their expressions in the cartilage cell before and after GDF-5 effect 24 hours, and discovery miR-17 changes the most notable (Fig. 7) after GDF-5 stimulation.The present inventor uses miRNA microRNA target prediction software Targetscan, miRanda to be analyzed, and discovery degradation factor MMP3, MMP13, NOS2 and ADAMTS5 are the possible target genes of miR-17.

MiR-17 by miR-17-92 bunch of coding, the structure of miR-17-92 and sequence high conservative and have 2 homologous genes in mammal in vertebrate.

The protelytic expression such as embodiment the 4th, miR-17 suppression MMP3, MMP13, NOS2 and ADAMTS5

In order to study miRNA at GDF-5 to the function in chondrocyte phenotype regulation and control, suppressed by the antisensenucleic acids chain (inhibitor) or analogies (mimic) of cell transfecting miRNA or strengthen the expression of miRNA.After transfection 24h, with IL-1 β or/and GDF-5 Induction of chondrocytes 36h.

According to the regulating and controlling effect to cartilage cell miRNA for the GDF-5, with the expression of miR-17 inhibitor suppression miR-17, then use IL-1 β and GDF-5 Induction of chondrocytes 36h.With qPCR and Western blot detection various protelytic expression discovery, GDF-5 to the inhibitory action of MMP3, MMP13, NOS2 and ADAMTS5 by partial impairment, and the inhibitory action that GDF-5 is to MMP12 be not affected (Fig. 8 a, b).The result prompting inhibitory action to MMP3, MMP13, NOS2 and ADAMTS5 for the GDF-5 has part to be completed by raising miR-17, and GDF-5 also has other action pathway simultaneously, and the inhibitory action to MMP12 for the GDF-5 does not then rely on miR-17.

After miR-17 mimic process LAN miR-17, with IL-1 β and/or GDF-5 Induction of chondrocytes 36h, qRT-PCR and Western blot detection factoring expresses discovery, MMP3, MMP13, NOS2 and ADAMTS5 that IL-1 β is raised by miR-17 play inhibitory action, and to MMP12 unrestraint effect (Fig. 8 c, d).MiR-17 and GDF-5 use in conjunction can strengthen inhibition.Process LAN miR-138 as comparison then without affect (Fig. 8 d).

Embodiment the 5th, miR-17 directly acts on the 3 ' UTR of MMP3, MMP13, NOS2, ADAMTS5

In order to whether clear and definite miR-17 suppresses their translation by being attached to the 3 ' UTR of MMP3, MMP13, NOS2, ADAMTS5 mRNA, the present inventor have found action site possible in above-mentioned mRNA by bioinformatics software.Luciferase assay confirms that miR-17 can be incorporated into their 3 ' UTR region, after 3 ' UTR specific sites sudden change (mut UTR), and miR-17 event resolves (Fig. 9).

Embodiment the 6th, intraarticular injection miR-17 delays Mouse Bone Arthritis development

For verifying whether miR-17 can suppress the catabolism of cartilaginous tissue in articular cavity, the present inventor uses the Agomir-17 that intraarticular injection cholesterol modifies (1 times a week, each 1.5nmol) observe it impact is had or not on DMM Postoperative Bone arthritis, observe from Histological section, Agomir-17 alleviates the destructiveness (Figure 10 is left) of articular cartilage, and Mankin scoring to significantly reduce on (Figure 10 right side) than injection Agomir-NC's.

Embodiment the 7th, drug screening

Taking Mouse cartilage cell, this cell can endogenous expression miR-17.This kind of cell is alleviated or the cell model of medicine for the treatment of osteoarthritis as being used for screening.

Test group: with the culture of the above-mentioned cell that candidate substances is processed；

Control group: without the culture of the above-mentioned cell that candidate substances is processed.

Appropriate time after treatment, measures the expression of the miR-17 of described cell.If compared with control group, the expression of the miR-17 in test group significantly rises more than 3 times, then illustrate that this candidate substances is the potential material alleviating or treating osteoarthritis.

Using Agomir-17, miR-17 mimic and miR-17 inhibitor as candidate substances, transfect above-mentioned cell.It is found that Agomir-17 can make the expression of the miR-17 in test group significantly rise more than 5 times.Therefore, Agomir-17 is a kind of useful drug candidate.

The all documents mentioned in the present invention are incorporated as reference all in this application, are individually recited as with reference to like that just as each document.In addition, it is to be understood that after the above-mentioned instruction content having read the present invention, the present invention can be made various changes or modifications by those skilled in the art, these equivalent form of values fall within the application appended claims limited range equally.

Claims (9)

1. a miR-17 or on it adjust preparation prevention, alleviate or treatment osteoarthritis medicine in Purposes.

2. purposes as claimed in claim 1, it is characterised in that adjustment on described miR-17 includes: MiR-17 analogies, miR-17 activator.

3. purposes as claimed in claim 2, it is characterised in that described miR-17 analogies forward sequence Row are as shown in SEQ ID NO:8, and reverse sequence is as shown in SEQ ID NO:9.

4. purposes as claimed in claim 2, it is characterised in that the forward of described miR-17 activator Sequence is as shown in SEQ ID NO:10, and reverse sequence is as shown in SEQ ID NO:11.

5. purposes as claimed in claim 1, it is characterised in that described medicine is additionally operable to: suppression The expression of MMP3, MMP13, NOS2 or ADAMTS5.

6. the purposes of a miR-17, it is characterised in that be used for screening alleviation, prevention or treatment Bones and joints Scorching medicine.

7. a prevention, the medicine alleviating or treating osteoarthritis, it is characterised in that described medicine is The upper adjustment of miR-17, is selected from:

MiR-17 analogies, its forward sequence as shown in SEQ ID NO:8, reverse sequence such as SEQ ID NO: Shown in 9；Or

MiR-17 activator, its forward sequence as shown in SEQ ID NO:10, reverse sequence such as SEQ ID NO: Shown in 11.

8. the method screening the potential material of prevention, alleviation or treatment osteoarthritis, described method includes:

(1) system of expression miR-17 is processed by candidate substances；With

(2) expression of miR-17 in described system is detected；

Wherein, if described candidate substances can improve the expression of miR-17, then show this candidate substances be prevention, Alleviate or treat the potential material of osteoarthritis.

9. method as claimed in claim 8, it is characterised in that step (1) includes: in test group, Candidate substances is joined in the system expressing miR-17；And/or

Step (2) includes: the expression of miR-17 in the system of detection test group, and compares with control group, its Described in control group be the system of the expression miR-17 without described candidate substances；

If the expression of miR-17 is higher than control group statistically in test group, indicate that this material standed for is Prevention or the potential material for the treatment of osteoarthritis.