CN1061374C - DNA series of coded sweet protein and production thereof - Google Patents

Abstract

The present invention provides a novel DNA coding sequence of artificially synthesized cygon sweet protein, which comprises a recombinant expression carrier of the DNA coding sequence, and a recombination somatic cell carrying the recombinant expression carrier. The DNA coding sequence basically comprises pronucleus organism preference codons and is particularly suitable for the cygon sweet protein expressed in a prokaryotic organism body. The present invention also provides a method for producing the cygon sweet protein, and the high expression efficiency can be obtained by cultivating the recombination somatic cell under the suitable condition of protein expression; the cygon sweet protein has the sweetness 3000 times larger than that of sucrose and is particularly used as a sweet food additive agent without heat quantity.

Description

The proteic synthetic DNA sequence of coded sweet and produce this method of protein

The present invention relates to produce monellin (monellin) with the DNA recombinant technology, the dna sequence dna that particularly relates to the coding monellin of synthetic, the recombinant vectors that contains this dna sequence dna carries the prokaryotic organism host cell of this recombinant vectors and uses said recombinant chou prokaryotic cell prokaryocyte to produce the method for monellin.

The used sugar sweetener of foodstuffs industry also is human body metabolism's a main energy sources material, and for various physiological activities provide energy, unnecessary saccharide compound then is transformed into depot fat in the metabolic process in vivo.This food nutrient structure development trend of high protein-lower fat has promoted not contain the research of the protein sweetening agent of saccharide compound.The sugariness of monellin is high, and the monellin of same molecular number is higher approximately 100,000 times than the sugariness of sucrose.Thereby its during as sweeting agent consumption extremely low.In addition, this material belongs to protein on chemical nature, does not generally contain any carbohydrate.Compare with sweeting agents such as sucrose glucose or fructose, therefore the heat that metabolism produces seldom is specially adapted to diabetes, obesity, childhood caries tooth disease and cardiovascular patient and eats.These characteristics make it have using value in industry such as the food in future, beverage, medicine, feed.Reported at present the sweet protein matter that many kinds are different, as thaumatin (thaumatin) (Wagner WJ., Sharp JA.Proc.Natl.Acad.Sci.USA 78 (3): 1441-1445 1981), monellin (monellin) (Ogata, C., Hatada.M., Nature 328:739-742,1987), Rhizoma Curculiginis sweet protein (cureulin) (Yamashita H., Theerasilp S., TheJournal of Biolo.Chem.265:(26) 15770-15775 1990), Miraculin (Theerasilp S., Kurihara Y., J.Biolo.chem.263:(23) 11536-11539 1988), mabinlin (mabinlin) (Hu Zhong and He Min, the research of mabinlin, Yunnan plant research 5:(2) 207-212,1983).

Monellin is a kind of powerful sweet protein matter in fruit (Serendipity Berries) juice that is present in a kind of West Africa plant (DioscoreophyllumComminisii).The sugariness of the monellin of equivalent weight approximately is 3000-4000 a times of sucrose.If with the mole number is that the basis compares, then its sugariness is about 100,000 times (Kim, S-H., deVos A.M., Trendsin Biochem.Sci.13:l3-15 1988) on the sugarcane pool.In recent years, monellin has been carried out a large amount of research, about the aminoacid sequence and the tertiary structure (Ogata, C., Hatada, M., Nature 328:739-742,1987) all fully aware of thereof of this prlmary structure of protein.

Natural monellin is that a kind of molecular weight is 10700 daltonian small proteins, and molecule by non covalent bond, mainly is hydrogen bonded by two peptide chains of A, B.The A chain has 44 amino acid, and the B chain has 50 amino acid, and intramolecularly does not have disulfide linkage.X-ray crystalline diffraction analysis revealed, this proteic molecular structure is tight relatively, and intramolecularly does not have big ring texture.βZhe Die sheet is made of the peptide chain of 5 β-conformations, and wherein 2 come from the B chain, and 3 come from the A chain.The peptide chain of each β-conformation has 10 amino acid approximately.An alpha-helix is positioned at the recess of beta-pleated sheet.Molecule is stablized its structure by means of hydrogen bond between two chains and hydrophobic bond.

As previously mentioned, monellin has very big industry using value, therefore, utilize molecular biology and DNA recombinant technology, the method that further investigation is produced this protein sweetening agent with high yield is for this novel protein sweeting agent of further development and use and realize that its suitability for industrialized production is significant.

Certainly directly from the fruit of its source plant (DioscoreophyllumCommini-sii), extract this protein.But, raw-material difficult acquisition is restricted owing to making its industrial application.Someone passes through the solid phase synthesis method of protein, directly synthesizes two peptide chains of A, B of monellin respectively, is organized into activated monellin (Japanese Patent JP 5070494) then.But the cost of this method is very high, also is difficult to carry out suitability for industrialized production.

Along with being gradually improved of development of molecular biology and experimental technique thereof, people begin to attempt clone and the expression by the monellin gene, obtain this protein.People such as Kim have designed one section and have connected dna sequence dna, the A of monellin, the dna encoding sequence of two chains of B are coupled together, made up a monellin gene that can give expression to a strand monellin, the stability of this improved monellin and renaturation ability all increase, and do not influence its sweet taste activity (Sung-HouKim, Chul-Hee Kang, Protein Engineering 2:571-5751989).People such as Myany also design and have synthesized the monellin gene, and make it to express in yeast, but the efficient of expressing not very good (international monopoly WO90/07580).

The intestinal bacteria reproduction speed is fast, is fit to be the acceptor host of gene cloning and expression.Yet resulting monellin gene is not high at expression in escherichia coli in the top related work.This is because in intestinal bacteria, the use of codon is not at random, but has very strong preferences.We know that most of amino acid are coded by more than one codon, promptly have the degeneracy of codon, so the use of these codons is not at random.Further analysis revealed, tRNA content (being the richness of tRNA) is proportionate in the frequency of utilization of codon and the cell, particularly for the high protein of those expression amounts, is partial to adopt the more codon of tRNA content corresponding in the cell in the gene.The leucic codon of for example encoding has 6, be UUA, UUG, CUU, CUC, CUA, CUG, yet 88.8% leucine is encoded by CUG in the encoding gene of the ribosomal protein that the expression in escherichia coli amount is very high, and the frequency of utilization of opposite CUA is 0%.The total frequency of utilization of UUA, UUG, CUU, four codons of CUC only has 11.2% (Sun Naisi etc., " molecular genetics " pp.251-253,1993).Resulting in the past monellin gene all is the characteristics synthetic according to plant gene, thereby the tRNA content of the codon that a lot of amino acid adopted correspondence in intestinal bacteria is relatively very low, causes this gene not efficiently express in intestinal bacteria.

The inventor adopts the codon of bacterium preference first fully, and considers that stability and sugariness etc. are all multifactor, has finished the design and the complete sequence synthetic of monellin gene order.GC content is 48.02% in the gene.And be built into recombinant expression vector, and importing among the prokaryotic organism host, this gene especially can obtain high relatively expression in intestinal bacteria in prokaryotic organism.Wherein the active protein productive rate accounts for 20% of total protein of cell.Thereby the present invention especially is fit to utilize the method for fermentation to come the industrialized mass monellin.

The invention provides and be suitable in the prokaryotic cell prokaryocyte host, efficiently expressing coding to have a sweet taste active, heat stable dna encoding sequence that should the fruit monellin.It is characterized in that this sequence is that a length is the dna fragmentation of 294 base pairs, and have as shown in Figure 1 nucleotide sequence or its function equivalent.This dna sequence dna is under aminoacid sequence that does not change natural monellin A, two peptide chains of B and the active prerequisite of sweet taste thereof, select the prokaryotic organism body for use, the preference codon that is suitable for of intestinal bacteria particularly, the last synthetic by means of the aided design of computer.

The codon service condition of monellin DNA sequences encoding of the present invention is shown in nextpage subordinate list 1:

The codon service condition of coded amino acid in table 1 monellin

Amino acid	Codon	M	A	M/A(％)	Amino acid	Codon	M	A	M/A(％)
										Methionine(Met)	AUG	2	2	100	The network propylhomoserin	UAC UAU	7 0	7	100 0
Different bright ammonia ester	AUC AUU AUA	8 0 0	8	100 0 0
					Histidine	CAC CAU	0 0	0	0 0
										Xie Ansuan	GUU GUG GUC GUA	4 0 0 0	4	100 0 0 0	Glutamine	CAA CAG	0 3	3	0 100
L-asparagine	AAC AAU	5 0	5	100 0
					Phenylalanine	UUC UUU	5 0	5	100 0
										Methionin	AAG AAA	1 8	9	11.1 88.9
Leucine	UUG CUC CUU CUG CUA UUA	0 0 0 6 0 0	6	0 0 0 100 0 0
					Aspartic acid	GAC GAU	5 0	5	100 0
										L-glutamic acid	GAG GAA	0 9	9	0 100
					Serine	UCC AGC UCU AGU UCA UCG	2 0 0 0 0 0	2	100 0 0 0 0 0						Halfcystine	UGC UGU	1 0	1	100 0
Tryptophane	UGG	1	1	100
										Proline(Pro)	CCA CUU CCC CCG	0 0 0 6	6	0 0 0 100
					Arginine	AGA AGG CGU CGC CGA CGG	0 0 7 0 0 0	7	0 0 100 0 0 0
Threonine	ACC ACU ACA ACG	4 0 0 0	4	100 0 0 0
										L-Ala	GCU GCC GCA GCG	3 0 0 0	3	100 0 0 0	Glycine	GGA GGU GGG GGC	0 6 0 1	7	0 85.7 0 14.3

Annotate: M is the number of this codon; A is this amino acid whose sum

The monellin gene of synthetic of the present invention can pass through the DNA recombinant technology, is connected in the suitable prokaryotic expression carrier, to make up recombinant expression vector of the present invention.

Can be used for the prokaryotic expression carrier that is connected with the monellin gene recombination of said synthetic of the present invention and generally have following feature: the one, have the stronger promotor of ability to express in prokaryotic organism, and have good regulation and control system.Usually the prokaryotic promoter of using comprises lambda particles phage P at present _LPromotor, T ₇Phage promoter, the LacZ promotor of intestinal bacteria lactose operon, the Trp promotor of tryptophan operon, the tac promotor of Trp-LacZ heterozygosis and the β-Nei Xiananmei promotor of PBR322 plasmid etc.The 2nd, have a replicon that strong replication is arranged, as PMBl replicon, ColEl replicon, P15A replicon etc.It can make this plasmid keep higher copy number in its host bacterium, and this also is the condition that foreign gene can be able to high expression level.The 3rd, have selective marker, can guarantee that the recombinant vectors in the host cell can not lost by applying selective pressure.

The present invention further provides the recombinant expression vector of the monellin dna encoding sequence that in open reading frame, carries synthetic of the present invention.Except the dna encoding sequence that carries said monellin, also have lambda particles phage P in this recombinant expression vector _R, P _LTandem promoter, clts857 gene, rrnB rrna transcription termination signal, PMBl replicator, ampicillin resistance gene etc. are the required various controlling elements of its high expression level.

Can use any known method for transformation that recombinant expression vector of the present invention is transformed in the prokaryotic organism host cell, to express required monellin.Alternative host cell comprises intestinal bacteria, subtilis, bacillus megaterium, and false monospore genus bacillus, milk-acid bacteria etc. do not contain the prokaryotic host cell of the endogenous proteinase of the monellin of degrading in cell.But preferred host is a Bacillus coli cells.

The present invention further provides have above-mentioned recombinant expression vector recombinant cell in a preferred embodiment of the invention, the coli strain that carries above-mentioned recombinant expression vector, particularly e. coli bl21-pGESP9 are provided.This bacterial strain according to the regulation of budapest treaty, is deposited in China Committee for Culture Collection of Microorganisms common micro-organisms preservation center (CGMCC) December 11 nineteen ninety-five, and preservation registration number is CGMCC No._.

The present invention further provides the method for producing monellin with the DNA recombinant technology, this method may further comprise the steps:

1. based on the aminoacid sequence of monellin, the dna encoding sequence of the synthetic monellin of forming by the prokaryotic cell prokaryocyte preference codon;

2. the dna encoding sequence described in the step (1) is connected with appropriate carriers, obtains carrying the recombinant expression vector of the dna sequence dna of coding monellin;

3. the recombinant expression vector that obtains in the step (2) is transformed among the prokaryotic cell prokaryocyte host, obtains recombinant cell;

4. be suitable for expressing under the condition of required monellin the recombinant cell that obtains in the culturing step (3);

5. from substratum, reclaim said recombinant cell, and separation and the required monellin of purifying;

According to the preferred embodiments of the invention, said dna sequence dna is made up of the nucleotide sequence shown in the accompanying drawing 1 or its function equivalent in the aforesaid method step (1).

According to the preferred embodiments of the invention, said carrier is plasmid pBV220 in the aforesaid method step (2).

According to the preferred embodiments of the invention, said recombinant cell is the Bacillus coli cells that carries recombinant vectors of the present invention in the aforesaid method step (3).

In a word, the present invention uses DNA weight technology, aminoacid sequence according to known monellin, select prokaryotic organism for use, the codon of intestinal bacteria preferences particularly, synthetic the monellin gene, and be built into recombinant expression vector, import among the prokaryotic organism host, obtained the high relatively expression of monellin, for the suitability for industrialized production of this monellin provides a feasible way.

Figure 1 shows that the dna sequence dna that can give expression to the strand monellin that manually designs and synthesizes.

Figure 2 shows that the aminoacid sequence of the monellin that the dna sequence dna of figure one can give expression to.

What Fig. 3 represented is seven positions of gene fragment in gene of the monellin gene of synthetic.

Fig. 4 is the PCR building-up process synoptic diagram of monellin gene.

Fig. 5 is the structure synoptic diagram that has the sequencing vector pGSP9-of the artificial synthetic monellin of the present invention gene.

Fig. 6 is the structure synoptic diagram that has the artificial synthetic monellin of the present invention expression of gene type recombinant vectors pGESP9.

Term ＇ codon ＇ used herein refers to three nucleotide sequences determining each amino acid residue of its institute's synthetic protein in the gene, i.e. so-called triplet codon. Because four kinds of bases are arranged, so codon has 64,61 20 seed amino acids that coding is conventional wherein, 3 codons any amino acid of not encoding is called terminator codon, or claims nonsense codon.

Term ＇ preference codon ＇ used herein refers to for different types of organism, because the amino acid whose tRNA abundance with different anticodons of its intracellular transport same is different, and causes this biology to have selectively for the same amino acid whose different codons of coding in its gene. Thereby in specific organism, if tRNA content height corresponding to the codon in a certain gene, then the protein of this coded by said gene is easy to be translated, and the expression of gene is higher. Otherwise the expression of gene is lower. Thus, different biologies has different preference codons.

Term ＇ recombinant vector ＇ used herein refers to the DNA cut-grafting technology of utilizing, and the foreign DNA coded sequence is connected to the new recombinant DNA molecules with the foreign DNA coded sequence that obtains on the suitable carrier DNA.

Term ＇ recombinant bacterial strain ＇ used herein refers to various suitable methods and recombinant vector is transferred in the suitable Host Strains recombinant bacterial strain that can express said foreign DNA coded sequence that obtains.

Term ＇ used herein expresses ＇ and refers in vivo gene through transcribing and synthetic its corresponding protein of process such as translation.

For the dna sequence dna that can in Escherichia coli, express monellin with high yield synthetic of the present invention, we are according to the A of natural monellin, the amino acid sequence of two peptide chains of B has been considered the usage of 61 codons except TAA, TAG, three terminator codons of TGA in 64 total codons; Altogether in 20 amino acid, except the methionine and tryptophan that only have a codon coding, the usage of each codon of other 18 seed amino acids. The monellin coded sequence of design includes the codon that is more suitable at prokaryotes body, particularly expression in escherichia coli. In addition, in order more to be conducive to keeping of monellin activity, we have designed the section of DNA joint sequence, couple together with the coded sequence with A, two peptide chains of B. Said gene order as shown in Figure 1. The monellin amino acid sequence of this coded by said gene as shown in Figure 2.

Use CYCLONE^TMDna sequence dna synthesizer (Biosearch company) has synthesized that numbering is respectively 63,64,65,59,61,62 single stranded DNA fragment and as No. 66 and No. 67 oligonucleotide fragments (seeing embodiment 1 for details) of primer. The synthetic position of each fragment in gene as shown in Figure 3.

Then by the program shown in embodiment 1 hereinafter and the accompanying drawing 4, first through two groups of PCR reactions, respectively synthetic two dna fragmentations that length is 170bp and 178 bp. These two fragments have the duplicate block of 50 base-pairs. Then take these two dna fragmentations as template, as primer, be the monellin gene of 294bp through PCR reaction synthetic total length again with 66, No. 67 synthetic oligonucleotide fragments.

By the program shown in embodiment 3 hereinafter and the accompanying drawing 5, the genetic fragment behind the end-filling by ligase, is connected on the plasmid vector pUC19 that cuts with restriction enzyme Hinc II the recombinant plasmid called after pGSP that obtains. And carry out the sequence analysis of DNA by the program of embodiment 4 hereinafter. The purpose of sequence analysis be further confirm resulting recombinant vector with artificial synthetic monellin gene in full accord with design. The used primer that checks order has two kinds, and forward primer and reverse primer can carry out sequence analysis from positive and negative both direction respectively. By the sequence analysis to pGSP, obtained with design sweet protein gene on all four recombinant plasmid, i.e. pGSP9.

The plasmid vector at the prokaryotes expression in vivo of available use has a lot, and these plasmid vectors namely contain a promoter and a terminator all with complete reading frame, or other expression regulation element with other. One section MCS is arranged between promoter and terminator. These MCSs include respectively some single restriction enzyme sites. Select suitable restriction enzyme that carrier is cut into linearity, and with dna ligase the monellin gene is linked on the selected carrier, thereby be built into a recombinant vector that between promoter and terminator, contains the monellin gene. In addition, carrier DNA is also had two requirements, the one, have selected marker, such as antibiotics resistance gene. Like this, when carrier is transferred in the bacterium together with foreign gene, and carry out bulk fermentation when cultivating, can in culture medium, add antibiotic, apply and select to press, the growth that makes miscellaneous bacteria and do not change the empty Host Strains of foreign gene over to is suppressed, thereby guarantees the selection amplification of thalline in the sweat, to improve the yield rate of albumen. The 2nd, on the carrier replicon must be arranged, it can copy along with the division of Host Strains, thereby can not lose, and keep higher copy number after making carrier with sweet protein gene enter Host Strains.

The present invention uses with bacteriophage lambda P_LPromoter, rrnB ribosomes transcription stop signals, the PMB1 replicator, the prokaryotic expression carrier pBV220 of ampicillin resistance gene as the cloning vector of synthetic sweet protein gene. This carrier is also with the clts857 gene. The expression product of this gene is a kind of aporepressor, can suppress P_LThe activity of promoter. Under 42 ℃ of inductive conditions, the aporepressor inactivation makes P_LThe startup ability of promoter is able to normal performance.

The prokaryotic expression carrier pGESP9 that pressed the program construction shown in embodiment 5 and the accompanying drawing 6. The clone adopts Nco I and Pst I double digestion that the sweet protein gene orientation on the pGSP9 is connected on the pBV220. The Nco I site that wherein utilizes is positioned at the 5 ＇ end of the monellin gene that is synthesized. Yet, according to the result to the pGSP9 sequence analysis, owing to the reason of direction can't directly be downcut the monellin gene from pGSP9 with these two enzymes, so need a subclone, namely first the sweet protein gene on the pGSP9 is downcut, reconnect after filling, screening direction and originally opposite recombinant vector, and this carrier named be pGSP9^- With Nco I and Pst I double digestion this recombinant vector is identified.

Monellin gene of the present invention is by with after suitable expression vector is connected, can in any prokaryotes, obtain the expression of greater efficiency, these prokaryotes bodies comprise Escherichia coli, bacillus subtilis, bacillus megaterium, false monospore bacillus and lactic acid bacteria etc. Recombinant expression carrier pGESP9 provided by the present invention is particularly suitable at expression in escherichia coli, so the present invention preferentially uses Escherichia coli, particularly e. coli strain bl21 as the acceptor host cell of expression vector pGESP9. Be used for that the present invention's e. coli strain bl21 is well known to those skilled in the art.

Can use any suitable method, will invent the recombinant vector of mentioning such as Calcium Chloride Method, electroporation, PEG mediated method etc. and change in the host cell, obtain recombinant host cell. The inventor has changed recombinant expression carrier pGESP9 in the e. coli strain bl21 over to Calcium Chloride Method, then uses antibiotic-screening, has obtained the recombinant bacterial strain.

The recombinant cell that application the present invention obtains can carry out the industrialized mass of monellin. In being arranged, cultivates the fluid nutrient medium of selection pressure recombinant cell to exponential phase, then by proper method collection, cracking thalline, and the expressed monellin of purifying recombinant cell. The present invention adopts ultrasonic wave facture cracking thalline, then through ammonium sulfate precipitation, dialysis, CM Sephadex C-25 column chromatography, again dialysis, vacuum is drained or the step such as freeze-drying, has obtained the crystalline solid monellin.

Inventing resulting thaumatin T can be added in as sweetener in the beverages such as coffee, milk, tealeaves or the supping. In addition, as food additives, can also use it and produce some new-type diet products, such as the sweet drink of carbon compound not, sweet sour milk, various cake, dessert, candy, chewing gum etc.

The following examples are the present invention for durther example details, but can not be considered to limitation of the present invention.Following many experimental techniques and step can replace with other some ordinary methods, and change and change that such replacement and those skilled in the art are familiar with should fall in the claim scope of the present invention.

Embodiment 1: the PCR of monellin gene is synthetic

Use the CYCLONE dna sequence dna synthesizer of Biosearch company, synthesized that numbering is respectively 63,64,65,59,61,62 single stranded DNA fragment and as No. 66 and No. 67 oligonucleotide fragments of primer.Each segmental base sequence of synthetic is as follows: 635 ＇-GATCCCATGGAATGGGAAATCATCGACATCGGTCCGTTCACTCA

GAACCTGGGCAAATTCGCTGTTGACGAAGAAAACAAAATCGGTC

AGTACGGTCGTCTGACCTTCAACAAAGTTATC-3＇(120b)64 5＇-CGTCCGTGCATGAAGAAAACTATCTACGAAAACGAACGTGAAAT

CAAAGGTTACGAATACCAGCTGTACGTTTACGCTTCCAACAAAC

TGTTCCGTGCTGACATCTCCGAAGACTACAAA-3＇(120b)65 5＇-ACTCGTGGTCGCAAACTGCTGCGTTTCAACGGTCCGGTTCCGCC

GCCGTAATAGGTAC-3＇(58b)59 5＇-CTATTACGGCGGCGGAACCGGACCGTTGAAACGCAGCAGTTTGC

GACCACGAGTTTTGTAGTCTTCGGAGATGTCAGCACGGAACAGT

TT-3＇(90b)60 5＇-GTCGGAAGCG-3＇(10b)61 5＇-TAAACGTACAGCTGGTATTCGTAACCTTTGATTTCACGTGCGTT

TTCGTAGATAGTTTTCTTCATGCACGGACGGATAACTTTGTTGA

AGGTCAGACGACCGTACTGACCGATTTTGTTT-3＇(120b)62 5＇-TCTTCGTCAACAGCGAATTTGCCCAGGTTCTGAGTGAACGGACC

GATGTCGATGATTTCCCATTCCATGG-3＇(70b)66 5＇-GATCCCATGGAATGGG-3＇(16b)67 5＇-CTATTACGGCGGCGGAACCGG-3＇(21b)

After dna fragmentation is synthetic, with the required fragment of high pressure liquid chromatography (HPLC) method purifying.And utilize the DU70 ultraviolet spectrophotometer to measure the concentration of DNA.

By following program, the synthetic and amplification monellin gene with round pcr.Two groups of PCR reactions, two fragments of synthetic this gene respectively at first in the Eppendoff of two 0.5ml pipe, have been carried out.A group PCR reaction system comprises dna fragmentation 63 and dna fragmentation 61 each 1 μ l, 10 * PCR damping fluid, 2 μ l (500mM KCl, 100mMTris-HCl pH8.3,15mM MgCl ₂, 0.1% gelatin), dNTP 1 μ l (contain four kinds of deoxyribonucleotides, concentration respectively is 2.5mM), Taq archaeal dna polymerase (Promeg company) 0.5 μ l (containing 1.5 units), adding redistilled water to cumulative volume is 20 μ l; B group PCR reaction comprises dna fragmentation 59 and dna fragmentation 64 each 1 μ l, 10 * PCR damping fluid, 2 μ l, and dNTP (dATP, dTTP, dGTP, dCT P) 1 μ l, Taq archaeal dna polymerase 0.5 μ l, adding redistilled water to cumulative volume is 20 μ l.Used dna segment concentration is 20pmol/ul.Adopt GeneAmp PCR System 9600 type PCR instrument (PERKIN ELMER company), carry out PCR:93 ℃ of sex change 45 seconds by following response procedures, annealed 45 seconds for 55 ℃, 72 ℃ were extended 1 minute, and carried out 5 circulations altogether.Merge two pipes then, add following composition: 2 μ l, 10 * PCR damping fluid, 3 μ l dNTP, primer 66 and primer 67 each 4 μ l (10pmol/ μ l), 7 μ l redistilled waters, 0.5 μ l Taq enzyme, carry out PCR reaction once more by following response procedures: 93 ℃ of sex change 45 seconds, annealed 45 seconds for 55 ℃, 72 ℃ were extended 1 minute, and carried out 20 circulations altogether.Get 2 μ lPCR reaction solutions afterwards, carry out electrophoretic analysis, check the having or not of PCR product of about 300bp with 2.0% sepharose.

Embodiment 2: the preparation of cloning vector

Be used for cloning vector of the present invention by following program preparation: at first (every liter contains 10 gram NaCl at 100ml LB substratum, 5 gram yeast extracts, 10 gram Tryptoness, transfer pH to 7.4) inoculate the e.colistraindh5 (preserve in this laboratory) that carries plasmid pUC19, put 37 ℃ of shaking culture about 12 hours.Change over to after the cultivation in the 250ml centrifuge tube, at 4 ℃, centrifugal 5 minutes of 5000rpm collects bacterial sediment.Use then STE solution (contain 0.1NNaCl, 10mM Tris, 1mM EDTA, pH8.0) washing once, recentrifuge is collected bacterial sediment.Extract plasmid DNA with alkaline denaturation (J.sambrook etal., Molecular Cloning, A Laboratory Manual, 2nd ed, Cold Spring Harbor Laboratory Press 1989).(50mM sucrose, 25mM Tris 10mMEDTA pH8.0), vibrate with vortex mixer, so that bacterial sediment suspends fully to add 5ml solution I in bacterial sediment.The solution II that adds the new preparation of 10ml then in cell suspension (contains 0.2N NaOH, 1%SDS), builds and turn upside down gently several times after centrifuge tube covers, placed on ice at once 10 minutes.In pipe, add again the 7.5ml precooling the solution III (3MKAc, pH4.8), mixing several up and down gently, and placed 15 minutes on ice.4 ℃ then, 10, centrifugal 15 minutes of 000rpm collects supernatant liquor.The Virahol that adds 0.6 times of volume in supernatant liquor, mixing was also at room temperature placed 10 minutes.At room temperature with 10, centrifugal 10 minutes of 000rpm washes 2 times with 70% ethanol with resulting precipitation, and recentrifuge, removes ethanol.Vacuum is drained the DNA precipitation, and is dissolved in the 1ml TE damping fluid (10mM Tris, 1mM EDTA).In gained solution, add RNA enzyme A (Promeg company) to concentration be 200 μ g/ml, and in 37 ℃ of insulations 0.5 hour.The dna solution of gained is sub-packed in several Eppendoff pipes, uses phenol, phenol respectively: chloroform (1: 1), chloroform: primary isoamyl alcohol (24: 1) extracting.Behind each adding extract, shake up 1 minute, then with 12, centrifugal 10 minutes of 000rpm carefully sucks back the upper strata water.At last add the 3M NaAc (pH4.8) of 1/10 volume and the dehydrated alcohol of 2 times of volumes again, staticly settled 10 minutes on ice behind the mixing.At 4 ℃, 12, centrifugal 10 minutes of 000rpm removes supernatant, washes DNA precipitation and vacuum is drained with 70% ethanol, is dissolved in again then in the 200 μ lTE damping fluids.Get 1 μ l sample and on 0.8% sepharose, carry out electrophoresis, with the rough concentration of determining the PUC19 plasmid DNA.

In 1.5ml Eppendoff pipe, add the pUC19 plasmid DNA that 5 μ l (about 10 μ g) are extracted as stated above, 4 μ l Hinc II enzymes, 10 * enzyme cutting buffering liquid, 2 μ l restriction enzyme Hinc II. (5U/ μ l) (Promeg company) adds redistilled water to 40 μ l cumulative volume.The endonuclease reaction mixture is incubated 1.5 hours in 37 ℃ of water-baths.Then in 65 ℃ of insulations 20 minutes, with the used restriction enzyme of inactivation.Get 2 μ l samples afterwards and carry out electrophoresis with 0.8% sepharose.Electrophoresis result confirms fully supercoiled pUC19 to be cut into the linear DNA of 2.7kb.The wire pUC19DNA that is obtained promptly can be used as the carrier that the clone connects institute's synthetic monellin gene.

Embodiment 3: the clone of synthetic monellin gene

By following program with the gene clone of the coding monellin that obtains through PCR among the embodiment 1 to carrier pUC19.

Get said PCR product among the 16 μ l embodiment 1 (containing 1.2 μ g monellin coding DNAs approximately), add 0.5 μ l (3U/ μ l) T ₄Archaeal dna polymerase (Promega company) in 37 ℃ of insulations 10 minutes, uses T behind the mixing ₄Archaeal dna polymerase is accomplished tack with the end of said PCR product.Then the DNA that adds into tack is carried out 1.5% agarose gel electrophoresis, after about 40 minutes, observe the position of DNA band with long-wave ultra violet lamp (365nm) irradiation.Cutting-out contains the blob of viscose of the dna fragmentation of the 300bp that has an appointment.Reclaim this dna fragmentation with freeze-thaw method, promptly add 200 μ l phenol earlier, liquid nitrogen freezing 4 minutes, taking-up is dissolved, and uses liquid nitrogen freezing behind the mixing again.Quadruplication like this.With 12, centrifugal 10 minutes of 000rpm draws the upper strata water and uses the chloroform extracting once more once then.Add 20 μ l3M NaAc (pH4.8) and 400 μ l dehydrated alcohols in the about 200 μ l supernatants that reclaimed ,-20 ℃ of precipitations are spent the night.12, centrifugal 10 minutes of 000rpm, and wash gained DNA precipitation with 70% ethanol, and again with 12, centrifugal 5 minutes of 000rpm.Remove ethanol, vacuum is drained and with the DNA of 20 μ l redistilled water dissolution precipitations.Get the DNA that 1 μ l is reclaimed, survey the 260nm photoabsorption with DO70 ultraviolet spectrophotometer (Beckman company).As calculated, the DNA concentration of recovery is 70ng/ μ l.The monellin coding DNA that will so obtain then is connected with carrier DNA.0, carry out following ligation in the 5ml Eppendoff pipe.Reaction mixture comprises 10 μ l H ₂O, 2 μ l ligase enzymes, 10 * damping fluid, the DNA (about 350ng) that 5 μ l are reclaimed as stated above, 2 μ l are cut into linear pUC19 carrier DNA (100ng) with Hinc II enzyme, and 1 μ l (3U/ μ l) ligase enzyme (Promega company).Ligation was carried out 6～8 hours in 22 ℃ of water-baths.With resulting connection mixture (comprising the recombinant vectors that reverts to complete pUC19 and be connected into the monellin gene) transformed into escherichia coli.

Prepare the bacillus coli DH 5 alpha competent cell as follows.Spend the night earlier with the single bacterium colony of 2ml LB culture medium inoculated DH5 α, and 37 ℃ of shaking culture.Then DH5 α somatic cells is changed in the 200ml LB substratum over to 37 ℃ of shaking culture 2～3 hours, to OD ₆₀₀Be about 0.6.The taking-up culturing bottle was also put 30 minutes on ice.Under aseptic condition, thallus suspension liquid is transferred in the centrifuge tube then, 4 ℃, 5, the centrifugal collection somatic cells of 000rpm.The 0.1MCaCl that adds the 40ml precooling then ₂, recentrifuge is removed supernatant liquor.Add 8ml 0.1M CaCl ₂Again the suspension cell precipitation adds 1.2 milliliters of glycerine again, is sub-packed in the 1.5ml Eppendoff pipe by every pipe 200 μ l behind the mixing, and it is standby to place-70 ℃ of refrigerators to preserve.

During conversion, take out three pipe competent cells, after dissolving on ice, a pipe adds the above-mentioned connection product of 10 μ l; One pipe adds 2 μ l used PUC19 carrier DNA (negative control) of cutting through the Hinc II when connecting; One pipe adds the pUC19 carrier DNA (positive control) that l μ l does not cut.Placed about 30 minutes on ice behind the mixing.Went in 42 ℃ of water-baths heat shock then 90 seconds.In each pipe, add 700 μ l liquid LB substratum again, 37 ℃ of shaking culture 45 minutes, then respectively just thallus suspension liquid shop apply having added on the solid LBX-gal flat board of 100ug/ml penbritin and (contain 800 μ gIPTG600 μ g X-gal), insulation is about 18 hours in 37 ℃ of incubators.After the insulation, take out the dull and stereotyped conversion results of observing, finding does not almost have bacterium colony on the negative control flat board, occurs the bacterium colony of intensive growth on the positive control flat board.The white alternate bacterium colony of many indigo plants is arranged on the flat board that the DNA through connecting transforms.Choose white colony from flat board, be inoculated in the liquid LB substratum, extract plasmid DNA then in a small amount and carry out the double digestion evaluation with restriction enzyme Hind III and EcoR I in 37 ℃ of shaking culture 12～18 hours.Select to downcut about 300bp Hind III-segmental clone of EcoR I, so obtain naming recombinant plasmid into pGSP.The building process of this plasmid as shown in Figure 3.

Embodiment 4: the sequencing of the monellin gene of being cloned

The recombinant cell that will contain recombinant plasmid pGSP is rule being added with on the LB solid plate of penbritin 100ug/ml.Put 37 ℃ and cultivate after 12～18 hours, choose single bacterium colony and be seeded in the liquid LB substratum that 5ml is added with penbritin 100ug/ml, put 37 ℃ of shaking culture after 12～18 hours, a part is standby 4 ℃ of preservations as bacterial classification.Get about 1.2ml thallus suspension liquid and in 1.5ml Eppendoff pipe, extract plasmid DNA (method is identical with the method for extraction plasmid pUC19 among the embodiment 2) in a small amount.And with the plasmid DNA of phenol and chloroform extracting and purifying gained.Behind the ethanol sedimentation, DNA is dissolved in the 20 μ l redistilled waters, as the template DNA of order-checking.

As follows template DNA is carried out denaturing treatment.Get about 2 μ g plasmid DNA to be checked order and add H ₂O to 32 μ l adds 8 μ l 2M NaOH again, and mixing after (25 ℃) under the room temperature place 10 minutes, adds 7 μ l 3M NaAc (pH4.8) more gently., 4 μ l H ₂O and 120 μ l dehydrated alcohols, mixing was also placed 10 minutes on ice.With 12, centrifugal 10 minutes of 000rpm removes supernatant at last, and with the throw out washed twice, vacuum is drained with 70% ethanol, and residue is dissolved in the 10 μ l redistilled waters again.Add 2 μ l sequencing primers then, 2 μ l annealing buffer (200mM TrisHCl PH7.5,100mM MgCl ₂, 250mM NaCl), mixing gently, and instantaneous centrifugal, insulation after 5 minutes in 65 ℃ of water-baths went in 37 ℃ of water-baths insulation rapidly 10 minutes, placed at least 5 minutes in room temperature at last, and is instantaneous once more centrifugal, finishes the annealing of template DNA and primer.

Finish sequencing reaction by following program then.The termination reaction liquid (80uM dGTP, 80uM dCTP, the 80nM dATP that in four Eppendoff pipes of mark A, C, G, T respectively, add four kinds of two deoxidations of 2.5 μ l respectively, 80nM dTTP, 8uM dd (A) is (G) (T) TP (C), 50mM NaCl), be put in preheating in 37 ℃ of water-baths.Draw 2 μ l enzyme dilution buffer liquid, be added to the Eppendoff pipe that places on ice, add 0.5 μ l order-checking archaeal dna polymerase (structure is from Promega company) in each pipe, mixing is standby.Carry out radioisotopic labeled reactant at once, obtain in the above annealed after the pipe that contains sex change template and primer in (volume is 14 μ l) add 3 μ l mark mixed solutions (180uM dGTP, dCTP, dATP, dTTP, 50mM NaCl), 1 μ l α- ³²The dATP of P mark (10 μ Ci), and the order-checking T after the 2 μ l dilution ₇Archaeal dna polymerase, behind the mixing, room temperature was placed 5 minutes gently.Add 4.5 μ l labeled reactant liquid respectively rapidly in four pipes that indicate A, C, G, T of preheating in 37 ℃ of water-baths, mixing, instantaneous centrifugal was placed 5 minutes in 37 ℃.In each pipe, add 5 μ l stop buffers (95% methane amide, 20mM EDTA, 0.05% tetrabromophenol sulfonphthalein and 0.05% toluylene blue) then respectively, centrifugal mixing, and in 37 ℃ of placements 2 minutes, to finish sequencing reaction.

Use the polyacrylamide gel of dna sequencing device (Bio-rad company) preparation order-checking usefulness, and with the polyacrylamide gel electrophoresis mensuration that checks order.Get 50ml glue (every 500ml contains methylene diacrylamide 1.5g, acrylamide 28.5g, urea 240g, 10 * tbe buffer liquid 50ml), add 180 μ l ammonium persulphates and 30 μ l TEMED (Sigma company), preparation vertical panel polyacrylamide gel.(0.09MTris-boric acid, 100mMEDTA), prerunning 1 hour is so that the order-checking plate temperature reaches about 50 ℃ as electrophoretic buffer to add 1 * TBE in the groove up and down of electrophoresis apparatus.Place 80～90 ℃ of water-bath sex change after 2～3 minutes the testing sample for preparing above, the order of sample by C, A, T, G joined respectively in the adjacent last sample hole of gel, add 2～3 μ l on each in the sample hole.After about 2 hours of electrophoresis, tetrabromophenol sulfonphthalein were gone to the plate bottom, sample on the secondary continued electrophoresis then, so that read more sequence.When the tetrabromophenol sulfonphthalein for the treatment of sample on the secondary is gone to the plate bottom once more, finish electrophoresis.Then, with the radioautograph 12～24 hours in-70 ℃ of refrigerators of X-mating plate.Sequencing result shows the monellin encoding sequence that contains correct insertion in No. 9 samples, and the nucleotide sequence of the coding monellin of its nucleotide sequence and original design is identical.The gained plasmid named be pGSP9.

Embodiment 5: the structure of monellin expression vector

Make up the expression vector that in prokaryotic organism, to express monellin as follows.

With the method for extracting plasmid pUC19 among the embodiment 2, from the bacillus coli DH 5 alpha thalline that carries plasmid pBV220 (Zhang Zhiqing etc., viral journal 6 (2): 111-116,1990), extract plasmid pBV220.In following reaction system, carry out the double digestion of Nco I and Pst I: 4 μ l (about 3 μ g) plasmid pBV220DNA, 3 μ l use endonuclease reaction damping fluid (Multi Coreb buffer) (Promega company) more, each 6 unit of restriction enzyme Nco I and Pst I add redistilled water to cumulative volume 30 μ l.About 2 hours of 37 ℃ of endonuclease reactions.The method of pressing the described recovery of embodiment 3 DNA then reclaims the big fragment (about 3.66kb) of pBV220 from gel, with the removal enzyme cut exist in the afterreaction liquid by the Nco I-Pst I oligonucleotide fragment of Nco I and the cutting-out of Pst I.The DNA4 ℃ of preservation of reclaiming is standby.

Downcut the monellin gene that pGSP9 goes up the clone for using Nco I and Pst I, carry out the subclone of pGSP9 by following program: earlier with BamH I and the above-mentioned plasmid pGSP9 of Pst I double digestion, the reaction system that enzyme is cut comprises 5 μ l (about 5 μ g) plasmid pGSP9DNA, 4 μ l use the endonuclease reaction damping fluid more, restriction enzyme BamH I, each 15 unit of Pst I add redistilled water to cumulative volume 40 μ l.37 ℃ of enzymes were cut 2 hours, carried out 2.0% agarose gel electrophoresis then, and pressed the monellin coding DNA that the freeze-thaw method described in the embodiment 3 reclaims the about 300bp of length.

Utilize the end of the monellin gene after Semen Phaseoli radiati Germinatus nuclease (Promega company) will reclaim to cut flat.The reaction system that is adopted includes the monellin coding DNA of about 300bp that 10 μ l (about 1 μ g DNA) reclaim, 5 μ l Semen Phaseoli radiati Germinatus nuclease damping fluids, 0.5 μ l (90U/ μ l) Semen Phaseoli radiati Germinatus nuclease, 35.5 μ l redistilled waters from pGSP9.Above-mentioned composition is added in mixing in the 1.5ml Eppendoff pipe, in 37 ℃ of insulations 10 minutes.Again two ends that obtain after modifying with phenol and chloroform extracting are the monellin coding DNA of flush end.

Next the monellin coding DNA that will obtain above is connected to being cut on the linear plasmid vector pUC19 with Hinc II (otch is for flat terminal) of preparing among the embodiment 2.Ligation system in 1.5ml Eppendoff pipe comprises the pUC19 plasmid DNA that 0.5 μ l (about 100ng) cuts with the Hinc II, the flush end monellin coding DNA above the 2.5 μ l (about 50ng) behind the purifying, 1 μ l ligase enzyme damping fluid, 1 μ l (3U/ μ l) T ₄Dna ligase (Promega company), 5 μ l redistilled waters.Ligation was carried out in 22 ℃ of water-baths about 4 hours.Connect the back and press the method for transformation described in the embodiment 3, the DNA after connecting is joined in the 200 μ lDH5 α competent cell suspensions.This mixture was placed on ice 30 minutes, 42 ℃ of heat shocks 90 seconds, 37 ℃ of shaking culture 45 minutes, the shop was applied on the X-gal flat board then, in about 15 hours of 37 ℃ of insulations.Select white colony and extract plasmid DNA, by selecting the clone who has been connected required dna fragmentation with correct direction with Pst I double digestion with the Nco I.This recombinant plasmid named be PGSP9 ^-Be used for enzyme and cut the reaction system of evaluation and comprise 2 μ l (about 1 μ g) recombinant plasmid dna to be identified, 2 μ l use the endonuclease reaction damping fluid more, and each 5 unit of Nco I and Pst I add redistilled water to cumulative volume 20 μ l.37 ℃ of insulations are after 1 hour, by having or not of the about 300bp Nco I of 1.5% agarose gel electrophoresis inspection-Pst I dna segment.Select needed pGSP9 ￣ plasmid.

Use Nco I and Pst I double digestion pGSP9 then ^-Plasmid DNA, and electrophoresis reclaims the monellin coding DNA that downcuts.Endonuclease reaction system in 1.5ml Eppendoff pipe comprises 5 μ l (about 4 μ g) plasmid pGSP9-DNA, and 3 μ l use the endonuclease reaction damping fluid more, and each 12 unit of restriction enzyme Nco I and Pst I add redistilled water to total reaction volume 40 μ l.Endonuclease reaction carried out under 37 ℃ about 2 hours.Can be directly used in following ligation after the DNA that reclaims is purified.Linked system in 0.5ml eppcndoff pipe comprises following composition: 2 μ l (about 100ng) press the plasmid expression vector pBV220 DNA with Nco I and Pst I double digestion and electrophoresis recovery of method for preparing in the present embodiment, resulting pGSP9 above the 2 μ l (about 100ng) ^-300bpNco I-Pst I fragment, 2 μ l T ₄The dna ligase reaction buffer, 0.5 μ l (about 3U/ μ l)) T ₄Dna ligase (Promega company) adds redistilled water to cumulative volume 20 μ l.16 ℃ of connections are spent the night.

According to the embodiment 3 described methods that prepare the bacillus coli DH 5 alpha competent cell, the competent cell of preparation e. coli bl21.Get the DNA transformed into escherichia coli BL21 competent cell of the above-mentioned connection of 10 μ l, the shop is applied on the LB solid plate that has added penbritin (100 μ g/ml), cultivates about 15 hours for 37 ℃.After bacterium colony grew, 24 single bacterium colonies of picking extracted plasmid and analyze by 0.8% agarose gel electrophoresis in 5ml liquid LB substratum, select the bigger clone of plasmid, further carry out enzyme and cut evaluation.The reaction system that enzyme is cut evaluation comprises the about 1 μ g of 2 μ l plasmid DNA to be identified, and 2 μ l use the endonuclease reaction damping fluid more, each 5 unit (Promega company) of restriction enzyme BamH I and Pst I.37 ℃ of insulations 2 hours are checked by 1.5% agarose gel electrophoresis again, select to downcut the segmental clone of about 300bp monellin coding DNA, and the plasmid that is obtained named are pGESP9.

Embodiment 6: the evaluation of monellin genetic expression in the intestinal bacteria recombinant cell

Earlier a small amount of fox extracting thallus protein detects the expression whether foreign protein is arranged.The single bacterium colony that carries recombinant expression plasmid PGESP9 that picking obtains above, be inoculated in the test tube that 5ml liquid LB substratum (being added with penbritin 100 μ g/ml) is housed, inoculate e. coli bl21 host cell of measuring equally that does not carry any plasmid (use and do not add any antibiotic substratum) and the e. coli bl21 cell that carries plasmid pBV220 simultaneously respectively in contrast.In 37 ℃ of vibrations (250rpm) overnight incubation.Then by 1% inoculum size subculture 2 pipes (volume is 5ml) respectively separately again, a pipe is in about 9 hours of 30 ℃ of shaking culture, and another pipe is 30 ℃ of shaking culture after about 3 hours, changes over to carry out heat shock in 42 ℃ of shaking tables and cultivated 6 hours.

To carry out a small amount of of tropina as follows extract: will cultivate carrying plasmid pGESP9, pBV220 respectively and not carrying any plasmid of obtaining as stated above, through or do not change over to respectively in the 1.5ml centrifuge tube through six parts of e. coli bl21 cell suspending liquids of 42 ℃ of abduction deliverings, 4 ℃ following 5, centrifugal 5 minutes of 000rpm removes supernatant and collects bacterial cell.Cell is washed once with STE (0.1M NaCl, 10mMTirs, 1mM EDTA pH8.0), added 20 μ l redistilled waters, add 20 μ l protein denaturation damping fluid (50mM Tirs PH6.8,100mM DTT, 2%SDS again, 0.1% tetrabromophenol sulfonphthalein, 10% glycerine), in 100 ℃ of water-baths, boiled 5 minutes.At 4 ℃ down 12, centrifugal 5 minutes of 000rpm respectively gets 10 μ l supernatant liquors to analyze through 16% polyacrylamide gel electrophoresis then, carry the pGESP9 plasmid and through 42 ℃ of inductive samples in detect treaty 11KD band.Thereby proved at the external source monellin gene that is under the condition of 42 ℃ of abduction deliverings under the control of PL promotor and obtained expression.

Embodiment 7: the extraction of monellin, purifying and activity identification

Be added with in the liquid LB substratum of the penbritin that contains 50 μ g/ml at 15ml, the e. coli bl21 cell of plasmid pGESP9 is carried in inoculation, in 30 ℃ of vibrations (250rpm) overnight incubation.All change over to then in the liquid LB substratum that 1500ml is added with penbritin 50 μ g/ml.Place 42 ℃, continue shaking culture after 6 hours with 250rpm, bacterial suspension is descended 5 at 4 ℃, centrifugal 8 minutes of 000rpm collects bacterial cell.With 40ml phosphoric acid buffer A (0.05M Na ₂HPO ₄And 0.05MKH ₂PO ₄, pH 7.2) suspend again after, change in the little plastic cup, in ice bath, use the ultrasonic disruption cell, each 30 seconds, interval repetitive operation after about 30 seconds, limpid until thallus suspension liquid.With 40, centrifugal 30 minutes of 000rpm collects supernatant under 15 ℃, changes over to (cumulative volume is 37ml altogether) in the little triangular flask.Add 28.38g ammonium sulfate (to saturation concentration), 4 ℃ of precipitations of spending the night.Then under 4 ℃ with 10, centrifugal 10 minutes of 000rpm collects albumen precipitation and also is dissolved among the 20ml phosphoric acid buffer A.Aforesaid liquid is packed in the big dialysis tubing, under 4 ℃ to phosphate buffered saline buffer A dialysed overnight, and with the further chromatography purification of having crossed of CM Sephadex C-25 post with phosphoric acid buffer A balance.With phosphate buffered saline buffer B (0.05M Na ₂HPO ₄, 0.05M KH ₂PO ₄, 0.1MNaCl pH7.2) and wash-out.The eluate that contains monellin with albumen Ultraviolet Detector (HD-93-1 type, Shanghai International Automobile City Tourist Festival Kang Hua biochemical instrument manufactory) monitoring and collection.Dialysis desalting once more.Obtain required xln monellin after the vacuum lyophilization.

With redistilled water diluted protein matter product, detect its sugariness with the trial test method.The result shows, we as stated above the sugariness of resulting monellin be about with more than 3000 times of weight sucrose sweetness.

Claims (15)

1. be suitable for the monellin dna encoding sequence and the function equivalent thereof that in the prokaryotic cell prokaryocyte host, efficiently express, it is characterized in that this sequence has nucleotide sequence as follows:

GAT CCC ATG GAA TGG GAA ATC ATC GAC

ATC GGT CCG TTC ACC CAG AAC CTG GGC

AAA TTC GCT GTT GAC GAA GAA AAC AAA

ATC GGT CAG TAC GGT CGT CTG ACC TTC

AAC AAA GTT ATC CGT CCG TGC ATG AAG

AAA ACC ATT TAC GAA AAC GAA CGT GAA

ATC AAA GGT TAC GAA TAC CAG CTG TAC

GTT TAC GCT TCC GAC AAA CTG TTC CGT

GCT GAC ATC TCC GAA GAC TAC AAA ACC

CGT GGT CGT AAA CTG CTG CGT TTC AAC

GGT CCG GTT CCG CCG CCG TAA TAG

2. according to the dna encoding sequence and the function equivalent thereof of claim 1, it is made up of prokaryotic organism body preference codon basically.

3. according to the dna encoding sequence and the function equivalent thereof of claim 2, wherein said prokaryotic organism body is selected from intestinal bacteria, subtilis, bacillus megaterium, false monospore genus bacillus and milk-acid bacteria.

4. according to the dna encoding sequence and the function equivalent thereof of claim 3, wherein said prokaryotic organism body is intestinal bacteria.

5. comprise recombinant expression vector according to each dna encoding sequence in the claim 1 to 3.

6. according to the recombinant expression vector of claim 5, this carrier also comprises and is suitable at the required controlling element of prokaryotic organism expression in vivo monellin except that the dna sequence dna that comprises the monellin of encoding.

7. according to the recombinant expression vector of claim 6, wherein said controlling element comprises the thermal induction promotor that is connected in series.

8. by the recombinant cell that transforms according to the recombinant expression vector of claim 6 or 7.

9. recombinant cell according to Claim 8, it is the recombinant chou prokaryotic cell prokaryocyte.

10. according to the recombinant cell of claim 9, it is the recombinant chou intestinal bacteria.

11. according to the recombinant cell of claim 10, it has the China Committee for Culture Collection of Microorganisms of being preserved in common micro-organisms preservation center, preservation registration number is the feature of the Bacillus coli cells of CGMCC No.0246.

12. produce the method for monellin, this method may further comprise the steps:

(1) based on the synthetic monellin dna encoding sequence of forming by the prokaryotic cell prokaryocyte preference codon as shown in Figure 1 of the aminoacid sequence of monellin;

(2) dna sequence dna described in the step (1) is connected the recombinant expression vector that obtains carrying monellin dna encoding sequence with appropriate carriers;

(3) recombinant expression vector that obtains in the step (2) is transformed among the suitable prokaryotic cell prokaryocyte host, obtains recombinant cell;

(4) be suitable for expressing under the condition of required monellin culturing step

(3) recombinant cell that obtains in;

(5) separate the also required monellin of purifying.

13. according to the method for claim 12, wherein said monellin dna encoding sequence is made up of prokaryotic organism body preference codon basically.

14. according to the method for claim 12, wherein said recombinant cell is the recombinant chou intestinal bacteria.

15. according to the method for claim 12, wherein said recombinant cell is intestinal bacteria CGMCC No.0246.

Images