CN106119182A - The solubility expression recombinant bacterium of a kind of K88 adhesin albumen FaeG and fermentation culture method thereof - Google Patents

Abstract

The invention discloses the solubility expression recombinant bacterium of a kind of enterotoxigenic escherichia coli K88 adhesin albumen FaeG, the recombiant plasmid pET28a FaeG of first construction expression enterotoxigenic escherichia coli K88 adhesin FaeG gene, then by recombiant plasmid pET28a FaeG and Chaperonin GroEL/GroES vector plasmid pGro7 cotransformation to e. coli bl21 (DE3) competence, obtain coexpression adhesin FaeG gene and the recombinant bacterium of Chaperonin GroEL/GroES gene, the invention also discloses the high density fermentation cultural method of this recombinant bacterium.Recombinant bacterium provided by the present invention has higher adhesin albumen FaeG Soluble expression levels, and inclusion body expression substantially reduces, it is possible to obtain the immunogen of higher degree, and the albumen obtained has higher concordance with theoretical protein.

Description

The solubility expression recombinant bacterium of a kind of K88 adhesin albumen FaeG and fermentation culture thereof Method

Technical field

The invention belongs to technical field of molecular biology, be specifically related to enterotoxigenic escherichia coli K88 adhesin albumen A kind of solubility expression recombinant bacterium of FaeG, the invention still further relates to the high density fermentation cultural method of a kind of described recombinant bacterium.

Technical background

Enterotoxigenic escherichia coli (Enterotoxigenic E.coli, ETEC) can cause piglet pujos blancos, yellow scours and The edema disease of pig, infects ETEC and causes piglet diarrhea to account for the 30%-50% of piglet diarrhea rate, is a kind of weight causing piglet to fall ill Want enteric pathogenic bacteria, and K88 is one of topmost ETEC pathogenic bacterium causing piglet diarrhea (Do et al 2005).

The field planting of ETEC is decided by the specificity pili that its phage surface is had, referred to as adhesin or colonizing factor (colonization factor antigens, CFAs).Pili adhesin is made up of albumen, has the strongest immunogen Property, utilize adhesin immunity to produce antibody to suppress colibacillary causing a disease to have been received by good effect (Runnels et al 1987；Douehet-suchaux et al1988；Ofek et al 2003).FaeG subunit in K88 pili is that K88 sticks Attached element major structural protein, plays key effect (Broeck et al 2000) in escherichia coli field planting.Melkebeek Deng (2013) by continuous to piglet 2 days oral FaeG pilins, mesenteric lymph cell produces K88 pili specificity and resists Body, 16d booster immunization, can be fully against oral ETEC bacterium.

Immunogenic existence form, has significantly impact (Kim et al 1996 to immune effect；Li Xiaoyu etc., 2006).The impact of diarrhea of weaned piglets is ground by the yolk antibody that king (2007) utilizes the FaeG of multi-form to prepare for antigen Studying carefully discovery, the pilin utilizing the mode of thermal cutting to obtain is immunogen group, and diarrhea rate and the Scours index of piglet are obvious Less than inclusion body group and the inclusion body deformed renaturation group of escherichia coli expression, it is exempted to illustrate to be closer to its native state by albumen Epidemic focus is the best, but tradition pilin extracted amount is few, purity is low, and complex process.

Utilize engineered method to obtain rare albumen of originating and become a kind of important means, escherichia coli expression System because of its genetic background understand, optional plasmid vector and host strain variation, the breeding cycle is short, production cost is low, raw Produce efficiency height, expression product is prone to the advantages such as purification, is widely used in engineered protein and expresses, is the most frequently used expression system System, but the albumen of heterogenous expression is easily formed the inclusion body of inactive gathering.The albumen of solubility can fold through correct and divide Secrete in kytoplasm, form the state the most close with albumen native state.The mode utilizing fusion tag can be effectively improved egg White Soluble expression levels, but to obtain the destination protein of maturation, the excision of subsequent tag, the recovery of albumen and spy need to be considered The problems such as opposite sex nickase.Molecular chaperones can assist in the folding of nascent polypeptide chain, and auxiliary new polypeptide chain is assembled into stable having Bioactive structure, and molecular chaperones do not constitutes the structure (Liberek et al 2008) of folded protein, is effectively prevented from The step of label excision.Escherichia coli are primarily present three macromole companion's systems, Trigger factor, DnaK/DnaJ/ GrpE, GroEL/GroES (Xiao et al 2012), the most most widely used general, studying the most deep partner system is GroEL And auxilin GroES (xiao et al 2012).Utilize the complicated albumen that TF and DnaK system the most normally folds, turned Move to GroEL/GroES system further folded.

Protein expression is also had a major impact by the environmental factors residing for condition of culture and thalline.Therefore grasp recombinant bacterium sending out Influence factor crucial during ferment, provides suitable environmental condition for recombinant bacterium, could more effectively play its productive potentialities.

Based on above research background, the present invention with enterotoxigenic escherichia coli K88 pili adhesin albumen FaeG as antigen, The coexpression utilizing engineered technology clone to build pili adhesin albumen FaeG and Chaperonin GroEL/GroES carries Body, and the water of the solubility expression of FaeG albumen is significantly improved by the optimization of a series of fermentation conditions and high density fermentation Flat, and pass through rabbit immunization, it is thus achieved that specific efficient valency serum antibody, provide new for efficiently obtaining strongly immunogenic adhesin Thinking, provide material base for prevention of diarrhea in piglets novel therapeutic mode.

Summary of the invention

Present invention aim at providing the solubility expression weight of a kind of enterotoxigenic escherichia coli K88 adhesin albumen FaeG Group bacterium, it is a further object to provide the high density fermentation cultural method of described recombinant bacterium.

The present invention is achieved by the following technical solutions:

One, adhesin FaeG and the structure of Chaperonin GroEL/GroES coexpression Host Strains:

The gene order total length searching serial number M29375, FaeG in NCBI is 786bp.Enterotoxin large intestine is produced with pig source Bacillus K88 reference culture C83715 is test material, designs primer.Purpose fragment after being expanded by PCR is ultimately connected to express Carrier pET-28a.Recombiant plasmid pET28a FaeG and the Chaperonin GroEL/GroES vector plasmid pGro7 that will successfully construct Cotransformation, in e. coli bl21 (DE3) competence, is shown by SDS-PAGE and Western blotting result of the test, Achieve adhesin albumen FaeG and molecular chaperone protein GroEL/GroES heterogenous expression in E.coli, it is named BL21(FaeG)。

Two, expression and purification and the one-level secondary structure of adhesin albumen FaeG is identified

The recombinant bacterium successfully constructed, 37 DEG C of shaking tables are cultivated to OD₆₀₀Reach 0.6-0.8, with inducer isopropyl-β-d-sulfur For galactoside (I sopropyl-β-d-Thiogalactoside, IPTG) induction expression protein.After induction, recombinant bacterium is through super It is centrifuged after sonication, respectively obtains supernatant and precipitation, supernatant is carried out nickel affinity chromatography.Purifying protein carries out MALDI- TOF-MS mass spectral analysis primary structure, its secondary structure of C.D analysis.

Three, the high density fermentation cultural method of recombinant bacterium

1) inoculation: the recombinant bacterium bacterium solution that kind of age is 5～15h being inoculated in basal medium, the volume of described bacterium solution accounts for The 5～15% of basal medium volume, and add the L-arabinose of final concentration of 0.5-1.5g/L；

2) fermentation: fermentation Airflow amount is 2-4vvm, and in tank, temperature is 27～32 DEG C, along with in fermentation liquid, dissolved oxygen amount delays Slow decline, by by rotating speed and dissolved oxygen coupling, control oxygen dissolving value is 25～35%, and the pH with ammonia control fermentation liquid is 6.8 ～7.2；

3) protein induced expression: as the OD of zymocyte liquid₆₀₀When value reaches 9～11, temperature is reduced to 15～20 DEG C, and adds Add the isopropylthiogalactoside of final concentration of 0.1～1mmol/L, carry out protein induced expression；

4) feed supplement: by add supplemented medium add glucose, set feed regimes as: 9-12h adds 0.6g/L Portugal Grape sugar, 12-15h adds 1.1g/L glucose, and 15-21h adds 1.4g/L glucose, and 21-48h adds 1.1g/L glucose；

5) fermentation terminates: after 48h, terminates fermentation.

Preferably, described basal medium contains following component: glucose 10g/L；Yeast powder 18g/L；Peptone 9g/L； KH₂PO₄17mmol/L；K₂HPO₄72mmol/L；MgSO₄1.2g/L；(NH₄)₂SO₄5g/L；EDTA 8.4mg/L；CaCl₂ 1.5g/L；CuCl₂1.5g/L；CoCl₂2.5g/L；FeCl₃27g/L；ZnCl₂5.25g/L；H₃BO₃3g/L；Na₂MoO₄ 2.5g/L；MnCl₂1.5g/L；FeSO₄2.8g/L；Thiamine 4.5g/L.

Preferably, described supplemented medium contains following component: glucose 100g/L；Peptone 15g/L；Yeast powder 30g/ L；MgSO₄ 10g/L。

Preferably, kind age of described recombinant bacterium is 10h.

Preferably, the volume of described bacterium solution accounts for the 10% of basal medium volume.

Preferably, step 1) in, the final concentration of 0.8g/L of described L-arabinose.

Preferably, step 3) in, as the OD of zymocyte liquid₆₀₀When value reaches 10, temperature is reduced to 18 DEG C, and add the denseest Degree is the isopropylthiogalactoside of 0.3mmol/L, carries out protein induced expression.

Four, adhesin albumen FaeG immunity new zealand male rabbit prepares serum antibody

Being mixed with equal-volume complete Freund's adjuvant by the adhesin albumen FaeG of purification in supernatant, sonicator is abundant Emulsifying, in New Zealand white rabbit dorsal sc multi-point injection, dosage is about 500 μ g immunogens/only.About 2 weeks, carry out second time and exempt from Epidemic disease, mixes immunogen with equal-volume Freund's incomplete adjuvant, fully emulsified, in New Zealand white rabbit dorsal sc multi-point injection, carries out Booster immunization once, the later stage week about after booster immunization (2 times).After immunity third time, carry out venous blood collection (blood sample to be measured), Whether ELISA detection serum titer has significant change.After 4th immunity two weeks, Culling heart blood collects serum.To-20 DEG C of preservations Standby.ELISA is used to detect serum titer, the specificity of Western blotting detection antibody.

The invention has the beneficial effects as follows:

1) recombinant bacterium provided by the present invention has higher adhesin albumen FaeG Soluble expression levels, forgives body surface The amount of reaching substantially reduces, and is obtained in that the immunogen of higher degree by purification, and the albumen obtained has relatively with theoretical protein High concordance, it is possible to form certain protein steric conformation, provides material base for obtaining the adhesin albumen of high immunogenicity Plinth.

2) fermentation culture method provided by the present invention can significantly improve the solubility expression amount of adhesin albumen FaeG, tool There is fermentation period short, product purity and activity advantages of higher.

Accompanying drawing explanation

Fig. 1 is the agarose gel electrophoresis figure of PCR amplification adhesin FaeG conservative region product.In figure, 1-7 swimming lane is for producing Thing adhesin FaeG, molecular size range is 786bp；M is DNA molecular standard 2000bp.

Fig. 2 is that the double digestion of recombinant expression plasmid pET-FaeG identifies electrophoretogram.In figure, M is respectively DNA molecular amount standard 2000bp and 10000bp；Double digestion fragment pET28a be 5708bp, FaeG be 786bp.

Fig. 3 is the SDS-PAGE electrophoresis detection figure that IPTG induced protein is expressed.In figure 1: be not connected with the restructuring of FaeG gene After bacterial strain inducing；After 2: recombinant bacterial strain BL21 (FaeG) induction；FaeG molecular weight of albumen be 33KD, M be protein molecular weight mark Accurate.

Fig. 4 identifies for recombiant protein Western bloting after induction.In figure 1: be not connected with the recombinant bacterial strain of FaeG gene Supernatant after abduction delivering；Supernatant after 2: recombinant bacterial strain BL21 (FaeG) abduction delivering, M is protein molecular weight standard.

Fig. 5 is FaeG under coexpression vector Host Strains and the single carrier Host Strains same culture conditions being not added with molecular chaperones Solubility expression of protein amount compares.In figure 1: supernatant after coexpression Host Strains abduction delivering；2: coexpression Host Strains abduction delivering Rear inclusion body；3: supernatant after single carrier Host Strains abduction delivering；4: inclusion body after single carrier Host Strains abduction delivering；M is albumen Matter molecular weight standard.

Fig. 6 is the qualification figure of nickel affinity chromatography purification FaeG albumen.1: recombinant bacterial strain BL21 (FaeG) abduction delivering in figure Rear supernatant；2: nickel affinity chromatography FaeG albumen after purification；M is protein molecular weight standard.

Fig. 7 is the comparison of different inducing temperature FaeG solubility expression of protein amount.

Fig. 8 is the comparison of different IPTG induced concentration FaeG solubility expression of protein amount.

Fig. 9 is the comparison of different L-arabinose induced concentration FaeG solubility expression of protein amount.

Figure 10 be before expression condition optimization with optimize after the comparison of FaeG solubility expression of protein amount.

Figure 11 is biomass and the comparison of FaeG solubility expression of protein amount under the conditions of recombinant bacterium different carbon source.

Figure 12 is recombinant bacterium different carbon source concentration conditions hypothallus amount and the comparison of FaeG solubility expression of protein amount.

Figure 13 is biomass and the comparison of FaeG solubility expression of protein amount under the conditions of recombinant bacterium different nitrogen sources.

Figure 14 is recombinant bacterium different nitrogen sources concentration conditions hypothallus amount and the comparison of FaeG solubility expression of protein amount.

Figure 15 is recombinant bacterium different phosphate hydrochlorate concentration conditions hypothallus amount and the comparison of FaeG solubility expression of protein amount.

Figure 16 be before medium component condition optimizing with optimize after the comparison of FaeG solubility expression of protein amount.

Figure 17 is recombinant bacterium high density fermentation protein expression SDS-PAGE qualification figure.

Figure 18 is high density fermentation biomass, FaeG protein concentration, the detection of fermentation liquid remaining sugar concentration.

Figure 19 is that Western blotting detects serum antibody specificity.

Detailed description of the invention

Without the method illustrated all with reference to beautiful J. Pehanorm Brooker and D.W. Russell (J. in specific examples below Pehanorm Brooker and D.W. Russell write, and yellow training hall etc. is translated.Molecular Cloning: A Laboratory guide (third edition), Beijing: Science Press, 2002).

Embodiment 1: adhesin albumen FaeG and the structure of Chaperonin GroEL/GroES coexpression recombinant bacterium

1. the present embodiment uses bacterial strain and plasmid vector see table 1.

Table 1 bacterial strain and plasmid

2. main agents and test kit

PCR related reagent: Taq archaeal dna polymerase, dNTP (2.5mM), 10 × Taq buffer, DNA marker (2kb and 10kb): Beijing Quanshijin Biotechnology Co., Ltd；

Restricted enzyme: Dalian treasured biological engineering company limited；

Agarose: Biowest Agarose subpackage；

Tryptone, yeast extract: Britain OXOID；

DNA gel reclaims test kit: OMEGA；

Plasmid extraction kit: OMEGA.

3. solution preparation

3.1 DNA of bacteria extract related solution

PBS (0.012M): weigh NaCl 8g, KCl 0.2g, Na₂HPO₄·12H₂O 3.58g, KH₂PO₄0.27g, adds ddH₂O is settled to 1L, 121 DEG C of sterilizing 30min of subpackage.

Chloroform/isoamyl alcohol: chloroform 480ml, isoamyl alcohol 20mL, mixing moves into 4 DEG C of preservations in Brown Glass Brown glass bottles and jars only.

E.C. 3.4.21.64 (20mg/mL): weigh powder 20mg and be dissolved in ddH₂O 1mL, mixes-20 DEG C of preservations.

3.2 yeast culture related solution

(1) LB culture medium: tryptone 1g, yeast extract 0.5g, NaCl 1g adds ddH₂O is dissolved to 100mL, stirring Uniformly, 121 DEG C of high pressure steam sterilization 30min.

(2) LB plating medium: tryptone 1g, yeast extract 0.5g, NaCl 1g, agar powder 1.5g, add ddH₂O It is dissolved to 100mL, stirs, 121 DEG C of high pressure steam sterilization 30min.

(3) ampicillin liquid storage (100mg/mL): 1g powder is added 10mL ddH at aseptic operating platform₂O dissolves, nothing Bacterium filter filters, and subpackage to 1.5mL EP is managed ,-20 DEG C of preservations.

(4) kanamycin liquid storage (50mg/mL): 1g powder is added 20mL ddH at aseptic operating platform₂O dissolves, aseptic Filter filters, and subpackage to 1.5mL EP is managed ,-20 DEG C of preservations.

(5) chloromycetin liquid storage (20mg/mL): 1g powder is added 50mL anhydrous alcohol solution at aseptic operating platform, aseptic Filter filters, and subpackage to 1.5mL EP is managed ,-20 DEG C of preservations.

(6) IPTG liquid storage (1mol/L): the powder of 1g is added 4.2mL sterilizing ddH at aseptic operating platform₂O, sterile filters Subpackage after filtration.

3.3DNA gel electrophoresis related solution

50 × TAE:Tris 242g, EDTA 37.2g, glacial acetic acid 57.1mL, add ddH₂O is dissolved to 900mL, and regulation pH is extremely 8.0, it is settled to 1L, during use, is diluted to 1 × TAE.

3.4SDS-PAGE electrophoresis related solution

(1) 5 × albumen sample solution: Tris-HCl (2M, pH 6.8) 12.5mL, SDS 10g, bromophenol blue 500mg, glycerol 30mL, adds ddH₂O is settled to 100mL, adds 5% beta-mercaptoethanol (now with the current) during use.

(2) 5 × electrophoretic buffers: Tris 15.10g, Gly 72.06g, SDS 5g, add ddH₂O is settled to 1L.During use Dilute 5 times.

(3) separation gel buffer: Tris 18.17g, adds ddH₂O 90mL, dense HCl regulate pH to 8.8, are settled to 100mL, 4 DEG C of preservations.

(4) concentrate glue buffer: Tris 12.11g, add ddH₂O 90mL, dense HCl regulate pH to 6.8, are settled to 100mL, 4 DEG C of preservations.

(5) 10%SDS: weigh sodium lauryl sulphate 10g, add ddH₂O is settled to 100mL, and room temperature preserves.

(6) 10% Ammonium persulfate .s: weigh in Ammonium persulfate. 0.1g to EP pipe, add 1mLddH₂O, 4 DEG C of preservations, in two weeks Use.

(7) coomassie brilliant blue staining liquid: coomassie brilliant blue R_250 1.25g, methanol 450mL, glacial acetic acid 50mL, add ddH₂O 450mL。

(8) destaining solution: methanol 450mL, glacial acetic acid 100mL, add ddH₂O 450mL mixes.

3.5Western Blot related solution

(1) electricity turns buffer: weighs 2.9g glycine, 5.8g Tris, 0.37g SDS, adds 200mL methanol, last constant volume To 1000mL.

(2) 5*Tris buffer: 15.1Tris, 72.06g glycine, 5g SDS constant volume is to 1L water.

(3) TBST: the TBS containing 0.05%Tween-20.

(4) confining liquid: containing the TBST of 1% bovine serum albumin (Bovine serum albium, BSA).

(5) nitrite ion: A liquid, B liquid are mixed with the ratio of 1:1, now with the current.

4. adhesin albumen FaeG and the structure of Chaperonin GroEL/GroES coexpression recombinant bacterium

The extraction of 4.1 DNA of bacteria

1) in aseptic operating platform, from slant medium picking ETEC K88ac bacterium solution be coated with TSB flat board, next day picking list Bacterium colony in 5mL TSB culture medium, 37 DEG C of incubated overnight.

2) 10000rpm next day is centrifugal collects thalline, and PBS washs 2 times and resuspended thalline is to 500 μ L.

3) 100 μ L 10%SDS are added, 10 μ L 20mg/mL E.C. 3.4.21.64s, hatch 3h or 37 DEG C overnight for 50 DEG C.

4) adding equal-volume phenol in supernatant: chloroform: isoamyl alcohol (25:24:1), reverse mixing 5min, 10000rpm are centrifugal 5min, shifts supernatant.It is repeated once.

5) adding equal-volume chloroform/isoamyl alcohol, reverse mixing 5min, 10000rpm are centrifuged 5min, shift supernatant.

6) 0.6 (V/V) isopropanol is added, reverse mixing, stand 5min, 10000rpm and be centrifuged 5min, the precipitation warp of collection 75% ethanol wash of pre-cooling, is dissolved in 100 μ L ddH after drying₂In O ,-20 DEG C of preservations.

4.2 design of primers

Genes of interest sequential design synthetic primer according to having reported in Genebank is shown in Table 2, and Genebank accession number is divided Not Wei M29375 (FaeG), the forward primer and downstream primer of FaeG introduce NdeI enzyme action with atg start codon respectively Site and XhoI restriction enzyme site.

Table 2 pcr amplification primer thing

Primer	Primer sequence	Restriction enzyme site
			FaeG-F	GAAATTCATATGTGGATGACTGGTGATTTC	NdeI
FaeG-R	GAAATTCTCGAGTCAGTAATAAGTAATTGCGAAA	XhoI

4.3PCR amplifying target genes

Add ddH₂Primer is first diluted to 10 μMs by O, and genomic DNA is diluted to 0.05mg/mL.With 25 μ L reaction systems it is Example:

Response parameter is: 94 DEG C of denaturations 3min, enters and circulates: 94 DEG C of degeneration 30s；Annealing (annealing temperature is shown in primer list) 30s, 72 DEG C extend 1kb/min, totally 35 circulations；Last 72 DEG C extend 10min.

4.4PCR product and the detection of digestion products

Prepare 1.0% agarose gel (adding nucleic acid dye by 0.01%), take 10 μ L sample and a small amount of loading buffer Liquid mixes, point sample, and with DNA Marker DL2000 as molecular weight standard, 150V voltage stabilizing electrophoresis about 20min, in uviol lamp Lower observation is taken pictures.

4.5PCR product and the recovery of digestion products and purification

Prepare 1.0% agarose gel, use wide comb, 150V voltage stabilizing electrophoresis 20-30min.Then fast under uviol lamp Speed cuts the gel at purpose fragment place, puts in 1.5mL centrifuge tube.The operation of test kit is reclaimed according to OMEGA pillar DNA glue Illustrate to carry out the recovery purification of PCR primer, the DNA fragmentation of recovery, deposit standby for-20 DEG C.

4.6DNA fragment is connected with pMD18-T carrier

(1) connect: 5 μ L linked systems are as follows, and 4 DEG C overnight.

PCR primer 2 μ L

PMD18-T 0.5μL

Solution I 2.5μL

(2) convert

A. take 10 μ L to connect in the DH5 α competence that product addition has just been thawed, beat mixing gently, place on ice 30min。

B.42 DEG C water-bath thermal shock 30s, quickly places 2-3min on ice.

C. adding LB culture medium 400 μ L, 1h is cultivated in 37 DEG C of concussions.

D. centrifugal (5000r/min, the 5min) bacterium solution that concentrates is to 100 μ L, and is applied on the LB flat board of Amp resistance, 37 DEG C of incubated overnight of constant incubator.

E. picking next day list bacterium colony, bacterium solution PCR detects the presence of positive colony.

The structure of 4.7 recombiant plasmid pET28a-FaeG

(1) it is enlarged positive colony cultivating, carries out plasmid extraction according to the explanation of plasmid Mini Kit, and By FaeG positive colony plasmid and expression vector pET-28a with identical restricted enzyme (NdeI, XhoI) carry out enzyme action and Reclaim, do double digestion by following 20 μ L systems.

Enzyme action system:

Prepare enzyme action system, gentle centrifugation, after being placed in optimal endonuclease reaction temperature 4-5h, carry out agarose gel electrophoresis inspection Survey, reclaim the purpose fragment with cohesive end and expression vector fragment.

(2) be attached by following 20 μ L systems, wherein in linked system the ratio of DNA and carrier with mole ratio 1: Between 1-5:1.

Linked system:

(3) conversion connection product is to DH5 α, as above 2.5.5 (3) operation.

(4) the clone amplification culture positive to detection, extracts plasmid ,-20 DEG C of preservations.

(5) recombiant plasmid double digestion is identified

Use restricted enzyme (NdeI, XhoI) that the recombinant expression plasmid (pET-28a-FaeG) extracted carries out double enzyme Cut qualification.

Enzyme action system:

(6) enzyme action being identified successful plasmid, order-checking company of Song Qing section checks order.

4.8 with BL21 (DE3) competent preparation-(the CaCl2 method) of pGro7 plasmid

(1) BL21 (DE3) strain is inoculated in amplification culture in triangular flask (37 DEG C, 3-4h) with the inoculum concentration of 1%, time concrete Between be mist with bacterium solution till.

(2) transfer bacterium solution, in the centrifuge tube of pre-cooling, continues to place 30min on ice in aseptic operating platform.Then 4 DEG C are centrifuged Collect thalline (4000r/min, 10min).

(3) abandon most supernatant, add the 0.1mol/L CaCl of 10mL pre-cooling₂Resuspended thalline, places 25-30min on ice.

(4) more than, two steps are repeated 2 times.

(5) the 0.1mol/L CaCl of 2mL pre-cooling₂Resuspended thalline, addition sterile glycerol is to final concentration 15-20%, with 100 μ L/ pipe subpackage.

(6) pGro7 plasmid converts in the way of 4.5 (2) to BL21 (DE3) competence, builds containing pGro7 plasmid BL21 (DE3) bacterial strain, repeats above-mentioned competence preparation method, and preparation contains BL21 (DE3) competent cell of pGro7 plasmid ,- 80 DEG C save backup.

The structure of 4.9 coexpression Host Strains

By checking order, correct recombiant plasmid pET28a-FaeG plasmid converts to pGro7 plasmid in the way of 4.5 (2) BL21 (DE3) competence in, picking list bacterium colony for protein induced express checking, by its named BL21 (FaeG).

The abduction delivering of 4.10 adhesin albumen FaeG

The picking successful E. coli expression strains BL21 (DE3) of conversion is in LB culture medium, and 37 DEG C, 200r/min is overnight Cultivate.Then bacterium solution is inoculated in the LB culture medium containing corresponding resistant by the inoculum concentration of 1%, cultivates 3-4h for 37 DEG C, until OD₆₀₀When 0.6-0.8, add the IPTG of suitable concentration, continue to cultivate 4h.

The SDS-PAGE detection of 4.11 adhesin albumen FaeG

Taking the bacterium solution after 1ml abduction delivering, 10000r/min is centrifuged 3min and collects thalline, uses ddH₂O washing thalline three times, Add 80 μ L ddH₂O and 20uL 5 × sample solution, after mixing, boiling water boiling 10min, 13000g are centrifuged 5min, take 15 μ L of supernatant and enter Row SDS-PAGE detects.

5. result of the test

The FaeG genetic fragment that the present invention expands through PCR as it is shown in figure 1, there is specific band in 786bp, the expression of structure Plasmid pET18a-FaeG after double digestion after agarose gel electrophoresis, result such as Fig. 2, occur respectively at 5708bp and 786bp Band, size is in the same size with expection.Company of bacterium solution Song Qing section being checked order, sequencing result and NCBI comparison, sequence is consistent.Table altogether Reaching recombinant bacterium BL21 (FaeG) SDS-PAGE detection (see Fig. 3) after abduction delivering, there is obvious mesh at about 33kD in albumen Band, size with all with prediction consistent.Identify (see Fig. 4) through Western blotting, at 33KD, specific band occur, And specific band does not all occur in its negative control group, show FaeG albumen successful expression.To molecular chaperones coexpression bacterial strain with Single carrier bacterial strain carries out FaeG solubility expression of protein and compares discovery (see Fig. 5), and coexpression bacterial strain is in the position of 57KD and 11KD Have expressed Chaperonin GroEL and GroES albumen (shown in block arrow) respectively, and two eggs does not occurs in single carrier bacterial strain relevant position In vain, improve 18% through quantity one software analysis FaeG solubility expression of protein level, inclusion body expression decreases 44%.

The nucleotide sequence such as SEQ ID NO.1, aminoacid sequence such as SEQ of the adhesin albumen FaeG that the present invention builds Shown in ID NO.2.

Embodiment 2: the expression and purification of adhesin albumen FaeG and one-level secondary structure are identified

1, solution preparation

Protein purification related reagent

(1) Buffer A:25mmol/L Tris 3.0285g, 500mmol/L NaCl 29.25g, adds ddH₂O constant volume To 1L, preserve with 0.45um membrane filtration.

(2) Buffer B:25mmol/L Tris 3.0285g, 500mmol/L NaCl 29.25g, 500mmol/L imidazoles 34.04g, add ddH₂O is settled to 1L, preserves with 0.45um membrane filtration.

(3) Wash Buffer:20% ethanol, 100mL dehydrated alcohol is dissolved in 400mL ddH₂O, mixing, filter with 0.45um Membrane filtration preserves.

2, nickel affinity chromatography protein purification

(1) collection bacterium, by the thalline 4 DEG C of abduction delivering, 10000g, 5min are centrifugal collects thalline.

(2) thalline washing, washs three times thalline with PBS, with the resuspended thalline of PBS of 10% bacterium solution volume.

(3) pressure breaking thalline, opens machine main frame and compressor pre-cooling, treats that machine temperature drops to 4 DEG C, regulates machine pressure Power is about 1000bar, with syringe from injection port sample introduction, collects broken bacterium solution from outlet, is crushed to bacterium solution and becomes clarification Till (about 4 times), the bacterium solution of collection 4 DEG C, 12000r/min are centrifuged 15min, collect supernatant, and carry out with the filter of 0.45 μm Filter (note: sample must be clarified, without particulate matter).

(4) nickel column equilibration, drains water inlet and the outlet air at nickel post two ends, with BufferA with 1.5mL/min's Speed washes pillar 20min.

(5) cross post, the target protein supernatant (containing His label) through membrane filtration is loaded in post, adjust flow velocity For 1.5mL/min.

(6) purification, uses BIO-RAD purification system to carry out the eluting of nickel post albumen, and setting program is as follows: BufferA washes Pillar 10mL, 4%BufferB wash pillar 20mL, and the BufferB of 4%-30% washes pillar 40mL, the BufferB of 100% and washes post Sub-40mL, collection eluent is in 2mL centrifuge tube, by absworption peak figure, selects peak and neighbouring liquid line thereof, for SDS-PAGE Detection.

(7) after eluting terminates, by 20% ethanol purge whole system, whole circulating line is made to be full of 20% ethanol, so After pull down nickel post, connect machine pipes, close instrument, purification terminates.

3, MALDI-TOF-MS mass spectral analysis primary structure

First the fusion protein expressed is carried out SDS-PAGE electrophoresis, at purpose band, be then cut into the glue of about 1mm Block, is placed in-20 DEG C of preservations in 1.5mL centrifuge tube, send Hua Da genome company to carry out Mass Spectrometric Identification.

4, C.D analysis secondary structure

The destination protein of nickel affinity chromatography purification measures its concentration through BCA, then dilute with 0.01mol/L PBS (pH 7.4) Release to 0.4mg/mL.Take sample 1mL, send Hua Da genome company to carry out justifying two liquid-phase chromatographic analysis.

5, result of the test

Nickel affinity chromatography result such as 6, Quantity one analyzes SDS-PAGE, and its purity reaches about 90%, through BCA egg White concentration measures, and the eluting concentration of adhesin albumen FaeG is 4.42mg/mL, for structural characterization and the Activity determination of following protein Create condition.

The aminoacid sequence of all peptide fragments of MALDI-TOF-MS Mass Spectrometer Method FaeG albumen, identifies above-mentioned peptide fragment in list The amino acid alignment of peptide fragment and native protein, result shows: coupling peptide fragment has 19, and coverage rate reaches 72.5%, with Theoretical protein has higher concordance.Protein secondary structure ratio, adhesin albumen is obtained by circle two liquid-phase chromatographic analysis The alpha-helix ratio of FaeG is 42.1%, beta sheet 20.2%, β-corner 23.7%, random curve percentage composition 14%, knot Fruit shows, the albumen of expression defines certain protein steric conformation.

To sum up result explanation, we are obtained in that the immunogen of higher degree, and the albumen obtained has with theoretical protein There is higher concordance, it is possible to form certain protein steric conformation, provide thing for obtaining the adhesin albumen of high immunogenicity Matter basis.

Embodiment 3: recombination engineering shaking flask horizontal top fermentation condition optimizing

1, reagent

(1) LB culture medium, Kan, Amp, Cm, IPTG prepare reference example 1.

(2) SDS-PAGE electrophoresis related solution reference example 1 (.

(3) TB culture medium (L): glycerol 5g；Yeast powder 24g；Peptone 12g；KH₂PO₄17mmol；K HPO₄72mmol。

(4) PBS (50mmol/L): weigh NaCl 8g；KCl 0.2g；Na₂HPO₄·12H₂O 17.9g；KH₂PO₄ 1.35g, adds ddH₂O is settled to 1L, 121 DEG C of sterilizing 30min.

2, SDS-PAGE detects expression product

Shake flask fermentation, takes 9mL fermentation liquid, 4 DEG C, 10000r/min is centrifuged 10min and collects thalline, ddH₂O washs thalline 3 Time, the resuspended thalline of 900mL 50mmol/L PBS (protein concentration ten times), (sample is fixed on frozen water to 125w ultrasonic disruption 3min In mixture).Disrupted sample 4 DEG C, 13000g are centrifuged 30min, cleer and peaceful inclusion body in separation, carry out SDS-PAGE detection.Highly dense Degree fermentation takes 1mL fermentation liquid, centrifugal collects thalline, with the resuspended thalline of 1mL 50mmol/L PBS (albumen is the most concentrated), as above Detect.

3, FaeG expressing quantity is relatively

Using Quantity one4.6.2 software scans SDS-PAGE, analysis purpose albumen gray value, to difference The expression of process group recombiant protein is carried out relatively.Test data uses SAS (8.1) software to carry out ANOVA single factor test side Difference analysis, and carry out Duncan multiple comparisons on the basis of one factor analysis of variance, lowercase alphabet show significant difference (P < 0.05), capitalization represents that difference is extremely notable (P < 0.01).

4, the mensuration of FaeG expressing quantity

(1) (detailed step is said with reference to green skies BCA test kit to use BCA method to measure broken bacterium solution supernatant total protein content Bright book)；

(2) analyze FaeG albumen by Qantity one4.6.2 and account for the ratio of supernatant total protein；

(3) FaeG expressing quantity=supernatant total protein concentration * ratio.

5, shaking flask optimization fermentation

Based on LB culture medium, single factor test is separately optimized kind of an age, inducing temperature (18 DEG C, 25 DEG C, 30 DEG C, 37 DEG C), lures Lead the time (18h, 24h, 30h, 36h), IPTG induced concentration (0mmol/L, 0.05mmol/L, 0.1mmol/L, 0.3mmol/L, 0.6mmol/L, 1.0mmol/L), L-arabinose (0g/L, 0.2g/L, 0.5g/L, 0.8g/L, 1.0g/L, 1.5g/L), obtain Optimum optimizing condition, to before optimizing with optimize after destination protein carry out the comparison of solubility expression amount.

Based on TB culture medium, it is first determined induction time (6h, 12h, 18h, 24h, 30h, 36h), then according to contain The principle that carbon mass fraction is equal, in TB culture medium, glycerol is as reference, optimizes carbon source kind (sucrose, fructose, maltose, shallow lake Powder, glycerol, glucose), optimize carbon source concentration (0g/L, 10g/L, 20g/L, 30g/L, 40g/L), take identical nitrogen element content Calculating, in the peptone in TB and yeast extract, nitrogen content is as reference, optimize nitrogen source (yeast powder, peptone, Carnis Bovis seu Bubali cream, Semen Maydis powder, peptone and the combination of the combination of yeast powder, Semen Maydis powder and the combination of yeast powder, Carnis Bovis seu Bubali cream and yeast powder) to optimization The combination of the peptone obtained and yeast powder carry out concentration optimization (12/6g, 18/9g, 24/12g, 30/15g, 36/18g), this Based on the potassium dihydrogen phosphate/dipotassium hydrogen phosphate concentration of TB culture medium 17/72mmol/L, optimize phosphate concn (0/ 0mmol/L, 8.5/36mmol/L, 17/72mmol/L, 34/144mmol/L, 51/216mmol/L), obtain optimum optimizing condition, To the comparison before optimizing and carrying out solubility expression of target protein amount after optimization.

6, result of the test

Based on LB culture medium, determining and most preferably plant age, when being in logarithmic growth middle and late stage, bacterial activity is good, can shorten and send out Ferment lag phase, keeps thalline high activity, final kind to select 10h age.Single factor test optimizes inducing temperature, and Quantity one analyzes SDS-PAGE glue, carries out destination protein relative expression quantity under different inducing temperature and compares such as Fig. 7, and 18 DEG C of solubility expression amounts are High.IPTG induced concentration optimizes, and Quantity one analyzes SDS-PAGE glue, carries out destination protein under different IPTG induced concentration Relative expression quantity compares such as Fig. 8, and when IPTG induced concentration is 0.3mmol/L, solubility expression of protein amount is the highest.L-arabinose Induced concentration optimizes, and Quantity one analyzes SDS-PAGE glue, carries out destination protein under different L-arabinose induced concentration Relative expression quantity compares such as Fig. 9, and when L-arabinose induced concentration is 0.8g/L, solubility expression of protein amount is the highest.Obtain optimal Optimal conditions, to before optimizing with optimize after destination protein carry out comparison such as Figure 10 of solubility expression amount, through Quantity one Before analysis optimization, destination protein accounts for supernatant total protein ratio is 1.19%, and concentration is 4.4mg/L, and after optimization, destination protein accounts for supernatant Total protein ratio is 7.69%, and concentration reaches 37.3mg/L.Solubility expression amount improves 8 times.

Based on TB culture medium, carbon source kind optimization, under the conditions of different carbon source, biomass change and destination protein are relative Expression such as Figure 11, when glucose is carbon source, thalli growth is the most vigorous, and FaeG solubility expression of protein level is the highest.Optimize carbon source Concentration, biomass change and destination protein relative expression quantity such as Figure 12, the suitableeest concentration of glucose under the conditions of different concentration of glucose For 10g/L.Nitrogen source category optimizes, the change of different nitrogen sources combination condition hypothallus amount and destination protein relative expression quantity such as Figure 13, The suitableeest nitrogen source is the combination of yeast powder and peptone.It is excellent that the peptone obtaining optimization and the combination of yeast powder carry out concentration Changing, the change of different nitrogen sources concentration conditions hypothallus amount and destination protein relative expression quantity such as Figure 14, the suitableeest nitrogen concentration is yeast Powder 18g/L, peptone 9g/L.This is based on the potassium dihydrogen phosphate and dipotassium hydrogen phosphate concentration of TB culture medium, optimizes phosphate Concentration, biomass change and destination protein relative expression quantity such as Figure 15, the suitableeest phosphate concn under the conditions of variable concentrations phosphate For potassium dihydrogen phosphate 17mmol/L dipotassium hydrogen phosphate 72mmol/L.Obtain optimum optimizing condition, carry out with after optimizing before optimizing The comparison of solubility expression of target protein amount such as Figure 16, before Quantity one analyzes FaeG albumen optimization, destination protein accounts for Clear total protein ratio reaches 4.86%, expression 41.26mg/L, and after optimization, destination protein accounts for supernatant total protein ratio and reaches 7.16%, Expression reaches 60.36mg/L, and solubility expression amount improves 1.46 times than before optimizing.

Embodiment 4: recombination engineering 5L fermentation tank in batches-fed-batch fermentation

1, reagent

(1) basal fermentation medium: glucose 10g/L；Yeast powder 18g/L；Peptone 9g/L；KH₂PO₄17mmol/L； K₂HPO₄72mmol/L；MgSO₄·7H₂O 1.2g/L；(NH₄)₂SO₄5g/L；EDTA 8.4mg/L；CaCl₂1.5g/L； CuCl₂1.5g/L；CoCl₂2.5g/L；FeCl₃27g/L；ZnCl₂5.25g/L；H₃BO₃3g/L；Na₂MoO₄2.5g/L； MnCl₂1.5g/L；FeSO₄2.8g/L；Thiamine 4.5g/L；Remaining is water.

(2) supplemented medium: glucose 100g/L；Peptone 15g/L；Yeast powder 30g/L；MgSO₄10g/L；Remaining be Water.

2, SDS-PAGE detection expression product, destination protein expression relatively, the mensuration of destination protein expression With reference to embodiment 3.

3, fermentation liquid residual sugar detection

Every 3h takes fermentation liquid, 4 DEG C, 10000r/min be centrifuged 3min, take supernatant, sample dilutes through certain multiple, uses Portugal Glucoseoxidase method measures kit measurement fermentation liquid remaining sugar concentration.(detailed step carrys out gene limited Fructus Vitis viniferae glycosyloxy with reference to Puli Chemical-enzyme method measures test kit E1010 description)

4, high density fermentation speed change feed supplement process

5L automatic fermenter fills l.5L fermentation medium, cultivates based on shaking flask level optimization condition.Strain Kind of age is 10h, inoculum concentration 10%, adds the L-arabinose of 0.8g/L.Early stage cultivates 30 DEG C, and dissolved oxygen passes through control after slowly declining Speed of agitator processed and ventilation and dissolved oxygen coupling, maintain DO value about 30%, and the ammonia control constant pH utilizing 50% is 7. Induction period temperature reduces to 18 DEG C, works as OD₆₀₀Reaching 10, the IPTG adding 0.3mmol/L carries out protein induced expression, cultivates to the In 9h culture medium, glucose runs out substantially, starts flow feeding.Different employing speed change feed supplements according to the thalli growth stage Mode, the speed change feed rate set as: 9-12h adds 0.6g/L glucose, and 12-15h adds 1.1g/L glucose, 15-21h Adding 1.4g/L glucose, 21-48h adds 1.1g/L glucose.The pH of whole sweat, dissolved oxygen, rotating speed, feed supplement and temperature Degree, is carried out On-line Control and data acquisition by fermentation tank Control System Software.

5, result of the test

High density fermentation FaeG protein expression SDS-PAGE detection such as Figure 17, with longer fermentation times, FaeG albumen summary table A large amount of and solubility expression amount all increases.Utilize analysis such as Figure 18 that SDS-PAGE glue is carried out by Quantity one, thalline OD₆₀₀Reaching 46 during value 48h, FaeG albumen supernatant expression is up to 536mg/L at 48h, improves 9 times than shaking flask level. And it is effectively controlled residual sugar in culture medium by speed change feed supplement and maintains low-level state (＜ 3g/L), it is therefore prevented that glucose Add excess and cause the accumulation of metabolite.

Embodiment 5: adhesin albumen FaeG immunity new zealand male rabbit prepares serum antibody

1, reagent

Freund's complete adjuvant (CFA) and incomplete Freund's adjuvant (IFA) (Sigma, the U.S.)；Horseradish peroxidase-labeled Goat anti-rabbit igg (SBA, Germany).

2, solution preparation

2.1 Western blotting related reagent reference examples 1

2.2 ELISA related reagents

(1) PBS (0.012M): see chapter 2.

(2) liquid (0.05M carbonate buffer solution): NaHCO it is coated₃2.93g, Na₂CO₃1.59g, adds ddH₂O 900mL Regulation pH to 9.6 after dissolving completely, is settled to 1L, and room temperature is placed.

(3) cleaning mixture: add the tween 20 of final concentration of 0.05% in PBS.

(4) confining liquid: the bovine serum albumin (BSA) of 3% is dissolved in cleaning mixture.

(5) stop buffer (2M H₂SO₄): concentrated sulphuric acid 22.2mL, distilled water 182mL, acid is slowly added in water along wall of cup, and Do not stop to stir evenly.

3, laboratory animal

4 about 1.5kg Japan new zealand male rabbits, purchased from veterinary hospital of Hua Zhong Agriculture University.

4, the immunity of rabbit

Blood sampling before 4.1 immunity

New Zealand white rabbit being put on blood-taking rack, head is fixed.Pressing rabbit auricular vein is to the obvious projection of blood vessel, then It is inserted in parallel into auricular vein with leather point pin, slowly collects blood 1-2mL.After terminating to collect, exit syringe needle and press with alcohol swab Stop blooding in injury.Get the blood of collection and in 37 DEG C of calorstats, place 30min to prevent activating complement system, then by test tube at 4 DEG C Stand overnight and make blood coagulation.4 DEG C, 5000r/min is centrifuged 10min, collects supernatant at-20 DEG C of preservation (negative control blood Sample).

4.2 FaeG protein immunizations prepare polyclonal antibody

Dorsal sc multi-point injection, more than best 5 points, interval will the most between points, it is impossible to the nearest.2 Taking a blood sample after week and carry out second time immunity, the later stage was every two weeks booster immunizations (2 times).After immunity the 4th time, carry out venous blood collection, ELISA detects antiserum titre.If titer reaches more than 1:10000, it is possible at latter 10 days of the 4th immunity, Culling heart blood Collect serum.Save backup to-20 DEG C.

5, ELISA detects serum antibody titer

Antigen is done doubling dilution with being coated liquid respectively, and every hole 100 μ L is coated polystyrene reactant plate, each dilution factor two Individual parallel hole, 4 DEG C overnight.When measuring sample, sample doubling dilution on demand, enzyme mark goat anti-rabbit igg PBST are made 1:15000 Dilution, carries out ELISA detection, and concrete sample determination step is as follows:

(1) by every hole 100 μ L, antigen being coated polystyrene reactant plate, 4 DEG C overnight；

(2) discarding liquid, PBST washing pats dry for 3 times, adds confining liquid every hole 100 μ L, hatches 2h for 37 DEG C；

(3) as above wash, add test antibodies every hole 100 μ L (diluting with PBST), hatch 1h for 37 DEG C；

(4) as above wash, add the every hole 100 μ L of ELIAS secondary antibody (PBST dilution), hatch 1h for 37 DEG C；

(5) as above washing, add TMB nitrite ion 100 μ L, 37 DEG C of lucifuges hatch 15min；

(6) every hole adds stop buffer 50 μ L, measures the OD value in each hole under 450nm wavelength, returns to zero with blank well.Test antibodies OD value more than 1 and with the ratio of negative control more than 2.1 time be judged to the positive, it is the highest that antibody titer is when there is positive reaction Dilution factor.

6, Western blot detects serum antibody effect

With the albumen of purification as antigen, the serum after immunity is one to resist, and the goat anti-rabbit igg of horseradish peroxidase-labeled is Two anti-carry out antibody test according to the method for chapter 2 Western blotting.

7, result of the test

Rear serum antibody titer is exempted from, with P/N ＞ 2.1 and OD with conventional indirect ELISA method detection four₄₅₀Value is more than 1.0 Time be judged to the positive, testing result is as shown in table 3, and 2 Serum Antibodies of Rabbits titers of FaeG protein immunization all reach 1: More than 320000, the study show that the polyclonal antibody of acquisition is respectively provided with the highest antibody titer.

Table 3 FaeG immunity rabbit anteserum antibody titer

It is one anti-(1:1000 dilution) with the rabbit anteserum of preparation, with the goat anti-rabbit igg of horseradish peroxidase-labeled for two Anti-(1:15000 dilution), carries out Western blotting analysis to the albumen of escherichia coli expression.Result as shown in figure 19 with Post-immunisation serum is an anti-detection, forms obvious band (haircut indication) at destination protein, and with the moon of preimmune serum Property comparison purpose band does not occurs, it was demonstrated that this polyclonal antibody has good specificity.

Claims (8)

1. the solubility expression recombinant bacterium of an enterotoxigenic escherichia coli K88 adhesin albumen FaeG, it is characterised in that be by Prepared by following methods:

1) from the enterotoxigenic escherichia coli K88 bacterial strain of pig source, clone adhesin FaeG gene, and be connected to expression vector PET-28a, constructs the recombiant plasmid pET28a FaeG expressing enterotoxigenic escherichia coli K88 adhesin FaeG gene；

2) by recombiant plasmid pET28a FaeG and Chaperonin GroEL/GroES vector plasmid pGro7 cotransformation to escherichia coli In BL21 (DE3) competence, it is thus achieved that coexpression adhesin FaeG gene and the recombinant bacterium of Chaperonin GroEL/GroES gene.

2. the high density fermentation cultural method of recombinant bacterium as claimed in claim 1, it is characterised in that comprise the following steps:

1) inoculation: the recombinant bacterium bacterium solution that kind of age is 5～15h being inoculated in basal medium, the volume of described bacterium solution accounts for basis The 5～15% of culture volume, and add the L-arabinose of final concentration of 0.5-1.5g/L；

2) fermentation: fermentation Airflow amount is 2-4vvm, and in tank, temperature is 27～32 DEG C, under dissolved oxygen amount is slow in fermentation liquid Fall, by by rotating speed and dissolved oxygen coupling, controls oxygen dissolving value 25～35%, and with ammonia control the pH of fermentation liquid be 6.8～ 7.2；

3) protein induced expression: as the OD of zymocyte liquid₆₀₀When value reaches 9～11, temperature is reduced to 15～20 DEG C, and adds end Concentration is the isopropylthiogalactoside of 0.1～1mmol/L, carries out protein induced expression；

4) feed supplement: by add supplemented medium add glucose, set feed regimes as: 9-12h adds 0.6g/L glucose, 12-15h adds 1.1g/L glucose, and 15-21h adds 1.4g/L glucose, and 21-48h adds 1.1g/L glucose；

5) fermentation terminates: after 48h, terminates fermentation.

3. the high density fermentation cultural method of recombinant bacterium as claimed in claim 2, it is characterised in that: described basal medium contains Following component: glucose 10g/L；Yeast powder 18g/L；Peptone 9g/L；KH₂PO₄17mmol/L；K₂HPO₄72mmol/L； MgSO₄1.2g/L；(NH₄)₂SO₄5g/L；EDTA 8.4mg/L；CaCl₂1.5g/L；CuCl₂1.5g/L；CoCl₂ 2.5g/ L；FeCl₃27g/L；ZnCl₂5.25g/L；H₃BO₃3g/L；Na₂MoO₄2.5g/L；MnCl₂1.5g/L；FeSO₄2.8g/L； Thiamine 4.5g/L.

4. the high density fermentation cultural method of recombinant bacterium as claimed in claim 2, it is characterised in that: described supplemented medium contains Following component: glucose 100g/L；Peptone 15g/L；Yeast powder 30g/L；MgSO₄ 10g/L。

5. the high density fermentation cultural method of recombinant bacterium as claimed in claim 2, it is characterised in that: the kind of described recombinant bacterium is age 10h。

6. the high density fermentation cultural method of recombinant bacterium as claimed in claim 2, it is characterised in that: the volume of described bacterium solution accounts for base The 10% of basal culture medium volume.

7. the high density fermentation cultural method of recombinant bacterium as claimed in claim 2, it is characterised in that: step 1) in, described L-Ah Draw the final concentration of 0.8g/L of uncle's sugar.

8. the high density fermentation cultural method of recombinant bacterium as claimed in claim 2, it is characterised in that: step 3) in, work as zymocyte The OD of liquid₆₀₀When value reaches 10, temperature is reduced to 18 DEG C, and add the isopropylthio galactose of final concentration of 0.3mmol/L Glycosides, carries out protein induced expression.