CN106086052A - Produce antibacterial and the application thereof of pyrroloquinoline quinone - Google Patents
Produce antibacterial and the application thereof of pyrroloquinoline quinone Download PDFInfo
- Publication number
- CN106086052A CN106086052A CN201610512635.9A CN201610512635A CN106086052A CN 106086052 A CN106086052 A CN 106086052A CN 201610512635 A CN201610512635 A CN 201610512635A CN 106086052 A CN106086052 A CN 106086052A
- Authority
- CN
- China
- Prior art keywords
- albumen
- sequence
- dna
- encoding gene
- sequence table
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
- C12P17/182—Heterocyclic compounds containing nitrogen atoms as the only ring heteroatoms in the condensed system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses antibacterial and the application thereof producing pyrroloquinoline quinone.Special plasmid is imported the bacterium that sets out and obtains by antibacterial provided by the present invention, and described special plasmid is that the encoding gene importing the encoding gene of PqqA albumen, the encoding gene of PqqB albumen, the encoding gene of PqqC albumen, the encoding gene of pqqD albumen and PqqE albumen in the plasmid that sets out obtains.Described PqqA albumen is (Y1) or (Y2) or (Y3): (Y1) PqqA1 albumen, PqqA2 albumen and PqqA3 albumen；(Y2) any two albumen in PqqA1 albumen, PqqA2 albumen and PqqA3 albumen；(Y3) PqqA1 albumen, PqqA2 albumen or PqqA3 albumen.It is demonstrated experimentally that antibacterial provided by the present invention can be effectively improved the yield of PQQ, have that raw material is cheap, technique simple, production efficiency advantages of higher, there is good industrial applications prospect.
Description
Technical field
The present invention relates to microorganism field, be specifically related to produce antibacterial and the application thereof of pyrroloquinoline quinone.
Background technology
Pyrroloquinoline quinone (pyrroloquinoline quinone, PQQ) is that one is widely present in gram negative bacteria
In, also with the presence of the oxidoreduction enzyme cofactor of trace in people and animal and plant body.PQQ participates in the electron transmission of respiratory chain, has
Promote body growth and the physiological function such as nerve growth factor synthesis, regulation body Free Radical Level, keep healthy at food and medicine
Field has important DEVELOPMENT PROSPECT.Up to now, only part gram negative bacteria can produce PQQ, but escherichia coli
(Escherichia coli.) can not synthesize PQQ.The PQQ synthetic quantity gap of different bacterium is notable, such as Rhodopseudomonas, micro-
The antibacterial of ring Pseudomonas and Mycoplana can only synthesize the PQQ of trace to meet the physiological metabolism demand of self, and Hyphomicrobium
Belong to, Alteromonas and can produce excessive PQQ addicted to methylotrophic bacterias such as Methylobacillus and secrete outside born of the same parents.
Denitrogenation Hyphomicrobium (Hyphomicrobium denitrificans) belongs to Hyphomicrobium, is that a class can be with first
The one-carbon compounds such as alcohol are the chemoheterotrophy facultative anaerobe of sole carbon source and energy sources.
Summary of the invention
The technical problem to be solved is how to produce pyrroloquinoline quinone.
For solving above-mentioned technical problem, present invention firstly provides a kind of specific DNA molecular.
Specific DNA molecular provided by the present invention, it may include following element: section A, section B, section C, section D and district
Section E；
Described section A can be following (1) or (2) or (3):
(1) encoding gene of the encoding gene of PqqA1 albumen, the encoding gene of PqqA2 albumen and PqqA3 albumen is contained
DNA molecular；
(2) in the encoding gene containing the encoding gene of PqqA1 albumen, the encoding gene of PqqA2 albumen and PqqA3 albumen
The DNA molecular (encoding gene such as the encoding gene containing PqqA1 albumen and PqqA2 albumen of any two encoding gene
DNA molecular)；
(3) encoding gene of the encoding gene of PqqA1 albumen, the encoding gene of PqqA2 albumen or PqqA3 albumen is contained
DNA molecular；
Described section B can be the DNA molecular of the encoding gene containing PqqB albumen；
Described section C can be the DNA molecular of the encoding gene containing PqqC albumen；
Described section D can be the DNA molecular of the encoding gene containing PqqD albumen；
Described section E can be the DNA molecular of the encoding gene containing PqqE albumen.
Described PqqA1 albumen can be a1) or a2):
A1) protein shown in sequence 1 during aminoacid sequence is sequence table；
A2) by shown in sequence in sequence table 1 aminoacid sequence through one or several amino acid residue replacement and/or
The protein with identical function that disappearance and/or interpolation obtain.
Described PqqA2 albumen can be b1) or b2):
B1) protein shown in sequence 2 during aminoacid sequence is sequence table；
B2) by shown in sequence in sequence table 2 aminoacid sequence through one or several amino acid residue replacement and/or
The protein with identical function that disappearance and/or interpolation obtain.
Described PqqA3 albumen can be c1) or c2):
C1) protein shown in sequence 3 during aminoacid sequence is sequence table；
C2) by shown in sequence in sequence table 3 aminoacid sequence through one or several amino acid residue replacement and/or
The protein with identical function that disappearance and/or interpolation obtain.
Described PqqB albumen can be d1) or d2):
D1) protein shown in sequence 4 during aminoacid sequence is sequence table；
D2) by shown in sequence in sequence table 4 aminoacid sequence through one or several amino acid residue replacement and/or
The protein with identical function that disappearance and/or interpolation obtain.
Described PqqC albumen can be e1) or e2):
E1) protein shown in sequence 5 during aminoacid sequence is sequence table；
E2) by shown in sequence in sequence table 5 aminoacid sequence through one or several amino acid residue replacement and/or
The protein with identical function that disappearance and/or interpolation obtain.
Described PqqD albumen can be f1) or f2):
F1) protein shown in sequence 6 during aminoacid sequence is sequence table；
F2) by shown in sequence in sequence table 6 aminoacid sequence through one or several amino acid residue replacement and/or
The protein with identical function that disappearance and/or interpolation obtain.
Described PqqE albumen can be g1) or g2):
G1) protein shown in sequence 7 during aminoacid sequence is sequence table；
G2) by shown in sequence in sequence table 7 aminoacid sequence through one or several amino acid residue replacement and/or
The protein with identical function that disappearance and/or interpolation obtain.
The encoding gene of described PqqA1 albumen can be A1) or A2) or A3):
A1) DNA molecular shown in sequence 9 during nucleotide sequence is sequence table；
A2) nucleotide sequence and A1) limited has 75% or more than 75% homogeneity, and encodes described PqqA1 albumen
DNA molecular；
A3) under strict conditions with A1) or the A2) nucleotide sequence hybridization that limits, and encode described PqqA1 albumen
DNA molecular.
The encoding gene of described PqqA2 albumen can be B1) or B2) or B3):
B1) DNA molecular shown in sequence 10 during nucleotide sequence is sequence table；
B2) nucleotide sequence and B1) limited has 75% or more than 75% homogeneity, and encodes described PqqA2 albumen
DNA molecular；
B3) under strict conditions with B1) or the B2) nucleotide sequence hybridization that limits, and encode described PqqA2 albumen
DNA molecular.
The encoding gene of described PqqA3 albumen can be C1) or C2) or C3):
C1) DNA molecular shown in sequence 11 during nucleotide sequence is sequence table；
C2) nucleotide sequence and C1) limited has 75% or more than 75% homogeneity, and encodes described PqqA3 albumen
DNA molecular；
C3) under strict conditions with C1) or the C2) nucleotide sequence hybridization that limits, and encode described PqqA3 albumen
DNA molecular.
The encoding gene of described PqqB albumen can be D1) or D2) or D3):
D1) DNA molecular shown in sequence 13 during nucleotide sequence is sequence table；
D2) nucleotide sequence and D1) limited has 75% or more than 75% homogeneity, and encodes described PqqB albumen
DNA molecular；
D3) under strict conditions with D1) or the D2) nucleotide sequence hybridization that limits, and encode the DNA of described PqqB albumen
Molecule.
The encoding gene of described PqqC albumen can be E1) or E2) or E3):
E1) DNA molecular shown in sequence 14 during nucleotide sequence is sequence table；
E2) nucleotide sequence and E1) limited has 75% or more than 75% homogeneity, and encodes described PqqC albumen
DNA molecular；
E3) under strict conditions with E1) or the E2) nucleotide sequence hybridization that limits, and encode the DNA of described PqqC albumen
Molecule.
The encoding gene of described PqqD albumen can be F1) or F2) or F3):
F1) DNA molecular shown in sequence 15 during nucleotide sequence is sequence table；
F2) nucleotide sequence and F1) limited has 75% or more than 75% homogeneity, and encodes described PqqD albumen
DNA molecular；
F3) under strict conditions with F1) or the F2) nucleotide sequence hybridization that limits, and encode the DNA of described PqqD albumen
Molecule.
The encoding gene of described PqqE albumen can be G1) or G2) or G3):
G1) DNA molecular shown in sequence 16 during nucleotide sequence is sequence table；
G2) nucleotide sequence and G1) limited has 75% or more than 75% homogeneity, and encodes described PqqE albumen
DNA molecular；
G3) under strict conditions with G1) or the G2) nucleotide sequence hybridization that limits, and encode the DNA of described PqqE albumen
Molecule.
Any of the above-described described specific DNA molecular, can include following element successively: described section A, described section B, described
Section C, described section D and described section E.
Described specific DNA molecular can be (z1) or (z2) or (z3) or (z4) or (z5) or (z6) or (z7) or (z8) or
Or (z10) (z9):
(z1) DNA molecular of DNA sequence shown in the sequence 12 of DNA sequence and sequence table shown in the sequence 9 containing ordered list；
(z2) sequence 12 of DNA sequence and sequence table shown in the sequence 9 containing ordered list is from 5 ' ends the 12nd to 3222
The DNA molecular of DNA sequence shown in position；
(z3) shown in the sequence 10 containing ordered list, shown in the sequence 12 of DNA sequence and sequence table, the DNA of DNA sequence divides
Son；
(z4) sequence 12 of DNA sequence and sequence table shown in the sequence 10 containing ordered list is from 5 ' ends the 12nd to 3222
The DNA molecular of DNA sequence shown in position；
(z5) shown in the sequence 11 containing ordered list, shown in the sequence 12 of DNA sequence and sequence table, the DNA of DNA sequence divides
Son；
(z6) sequence 12 of DNA sequence and sequence table shown in the sequence 11 containing ordered list is from 5 ' ends the 12nd to 3222
The DNA molecular of DNA sequence shown in position；
(z7) DNA sequence and sequence table shown in the sequence 18 of DNA sequence, sequence table shown in the sequence 9 containing ordered list
The DNA molecular of DNA sequence shown in sequence 12；
(z8) DNA sequence and sequence table shown in the sequence 18 of DNA sequence, sequence table shown in the sequence 9 containing ordered list
Sequence 12 is the DNA molecular of the 12nd to 3222 shown DNA sequence from 5 ' ends；
(z9) DNA sequence, the sequence of sequence table shown in the sequence 18 of DNA sequence, sequence table shown in the sequence 9 containing ordered list
The DNA molecular of DNA sequence shown in the sequence 12 of DNA sequence and sequence table shown in row 19；
(z10) DNA sequence, sequence table shown in the sequence 18 of DNA sequence, sequence table shown in the sequence 9 containing ordered list
The sequence 12 of DNA sequence and sequence table shown in sequence 19 DNA molecular of the 12nd to 3222 shown DNA sequence from 5 ' ends.
Special plasmid containing any of the above-described described specific DNA molecular falls within protection scope of the present invention.
The preparation method of described special plasmid can be as follows: imports described section A, described section B, described in the plasmid that sets out
Section C, described section D and described section E, obtain recombiant plasmid.
The preparation method of described special plasmid specifically can be as follows: imports described section A, described PqqB egg in the plasmid that sets out
White encoding gene, the encoding gene of described PqqC albumen, the encoding gene of described PqqD albumen and described PqqE albumen
Encoding gene, obtains recombiant plasmid.The described plasmid that sets out can be conventional expression vector.The described plasmid concretely plasmid that sets out
pBAD/hisB.Described plasmid pBAD/hisB is invitrogen Products, and catalog number is V430-01.
In the preparation method of described special plasmid, each encoding gene can insert respectively described in set out the different enzymes of plasmid
Cut site, it is also possible to any combination form insert respectively described in set out the different restriction enzyme sites of plasmid.
Described special plasmid concretely recombiant plasmid pBHdA1BE.Described recombiant plasmid pBHdA1BE is to plasmid
Between the recognition site of the restricted enzyme Nco I and Nhe I of pBAD/hisB, the DNA shown in sequence 9 of insertion sequence table divides
Son, between the recognition site of restricted enzyme EcoR I and Hind III, the DNA molecular shown in sequence 12 of insertion sequence table obtains
's.Described recombiant plasmid pBHdA1BE expresses described PqqA1 albumen, described PqqB albumen, described PqqC albumen, described PqqD egg
White and described PqqE albumen.
Described special plasmid concretely recombiant plasmid pBHdA2BE.Described recombiant plasmid pBHdA2BE is to plasmid
Between the recognition site of the restricted enzyme Nco I and Nhe I of pBAD/hisB, the DNA shown in sequence 10 of insertion sequence table divides
Son, between the recognition site of restricted enzyme EcoR I and Hind III, the DNA molecular shown in sequence 12 of insertion sequence table obtains
's.Described recombiant plasmid pBHdA2BE expresses described PqqA2 albumen, described PqqB albumen, described PqqC albumen, described PqqD egg
White and described PqqE albumen.
Described special plasmid concretely recombiant plasmid pBHdA3BE.Described recombiant plasmid pBHdA3BE is to plasmid
Between the recognition site of the restricted enzyme Nco I and Nhe I of pBAD/hisB, the DNA shown in sequence 11 of insertion sequence table divides
Son, between the recognition site of restricted enzyme EcoR I and Hind III, the DNA molecular shown in sequence 12 of insertion sequence table obtains
's.Described recombiant plasmid pBHdA3BE expresses described PqqA3 albumen, described PqqB albumen, described PqqC albumen, described PqqD egg
White and described PqqE albumen.
Described special plasmid concretely recombiant plasmid pBHdA1A2BE.Described recombiant plasmid pBHdA1A2BE is to plasmid
Between the recognition site of the restricted enzyme Nco I and Nhe I of pBAD/hisB, the DNA shown in sequence 9 of insertion sequence table divides
Son, between the recognition site of restricted enzyme Nhe I and Pst I, the DNA molecular shown in sequence 18 of insertion sequence table, restricted
Between the recognition site of restriction endonuclease EcoR I and Hind III, the DNA molecular shown in sequence 12 of insertion sequence table obtains.Described heavy
Group plasmid pBHdA1A2BE expresses described PqqA1 albumen, described PqqA2 albumen, described PqqB albumen, described PqqC albumen, institute
State PqqD albumen and described PqqE albumen.
Described special plasmid concretely recombiant plasmid pBHdA1A2A3BE.Described recombiant plasmid pBHdA1A2A3BE be to
The DNA shown in sequence 9 of insertion sequence table between the recognition site of the restricted enzyme Nco I and Nhe I of plasmid pBAD/hisB
Molecule, the DNA molecular shown in sequence 18 of insertion sequence table between the recognition site of restricted enzyme Nhe I and Pst I, by limit
The DNA molecular shown in sequence 19 of insertion sequence table, restriction enzyme between the recognition site of property restriction endonuclease Pst I and EcoR I processed
Between the recognition site of enzyme EcoR I and Hind III, the DNA molecular shown in sequence 12 of insertion sequence table obtains.Described restructuring matter
Grain pBHdA1A2A3BE expresses described PqqA1 albumen, described PqqA2 albumen, described PqqA3 albumen, described PqqB albumen, described
PqqC albumen, described PqqD albumen and described PqqE albumen.
Recombinant bacterium containing any of the above-described described special plasmid falls within protection scope of the present invention.
The preparation method of described recombinant bacterium can be as follows: any of the above-described described special plasmid is imported the bacterium that sets out, is recombinated
Bacterium.
In the preparation method of above-mentioned recombinant bacterium, described in the bacterium that sets out can be escherichia coli.
In the preparation method of above-mentioned recombinant bacterium, described in the bacterium that sets out can be E. coli mutant strain.Described E. coli mutant
Strain is by the encoding gene silence of iscR albumen in genome of E.coli being obtained.Described E. coli mutant strain is concrete
Can be e. coli k12 Δ iscR, e. coli k12 Δ iscR be the product of Japan's National Institute of Genetics, production code member
For ECK2528.
Described iscR albumen can be h1) or h2):
H1) protein shown in sequence 8 during aminoacid sequence is sequence table；
H2) by shown in sequence in sequence table 8 aminoacid sequence through one or several amino acid residue replacement and/or
The protein with identical function that disappearance and/or interpolation obtain.
The encoding gene of described iscR albumen can be H1) or H2) or H3):
H1) DNA molecular shown in sequence 17 during nucleotide sequence is sequence table；
H2) nucleotide sequence and H1) limited has 75% or more than 75% homogeneity, and encodes described iscR albumen
DNA molecular；
H3) under strict conditions with H1) or the H2) nucleotide sequence hybridization that limits, and encode the DNA of described iscR albumen
Molecule.
In the preparation method of above-mentioned recombinant bacterium, described in the bacterium that sets out can be e. coli k12.
Any of the above-described described specific DNA molecular, or, any of the above-described described special plasmid, or, any of the above-described described recombinant bacterium
Application in preparation pyrroloquinoline quinone falls within protection scope of the present invention.
For solving above-mentioned technical problem, present invention also offers a kind of method preparing pyrroloquinoline quinone.
The method of preparation pyrroloquinoline quinone provided by the present invention, it may include following steps: any of the above-described institute of fermentation culture
State recombinant bacterium, obtain pyrroloquinoline quinone.
In said method, the culture medium that described fermentation culture uses can be fermentation medium first or fermentation medium second.
Described fermentation medium first is the M9 culture medium containing 0.4～0.6g/L L-arabinose.
Described fermentation medium second is the M9 training containing 0.4～0.6g/L L-arabinose and 25～35 μMs of ferrous ions
Support base.
In described fermentation medium second, described ferrous ion is to add with the form of ferrous sulfate.
In described fermentation culture, initial inoculum is 2%～7%.
The condition of culture of described fermentation culture is 35 DEG C～39 DEG C, cultivates 60～70h.
Following A) or B) fall within protection scope of the present invention:
A) fusion protein, including following element: PqqA albumen, any of the above-described described PqqB albumen, any of the above-described described
PqqC albumen, any of the above-described described PqqD albumen and any of the above-described described PqqE albumen；
Described PqqA albumen is following (P1) or (P2) or (P3):
(P1) any of the above-described described PqqA1 albumen, any of the above-described described PqqA2 albumen and any of the above-described described PqqA3 egg
In vain；
(P2) any of the above-described described PqqA1 albumen, any of the above-described described PqqA2 albumen and any of the above-described described PqqA3 egg
Any two albumen in Bai (as described in any of the above-described PqqA1 albumen and any of the above-described as described in PqqA2 albumen)；
(P3) any of the above-described described PqqA1 albumen, any of the above-described described PqqA2 albumen or any of the above-described described PqqA3 egg
In vain；
B) protein composition, by described PqqA albumen, any of the above-described described PqqB albumen, any of the above-described described PqqC egg
In vain, any of the above-described described PqqD albumen, any of the above-described described PqqE albumen composition.
It is demonstrated experimentally that import the specific DNA molecular that the present invention provides in the plasmid that sets out, obtain recombiant plasmid, then will
This recombiant plasmid imports e. coli k12 Δ iscR, obtains recombinant bacterium.Utilize this recombinant bacterium can be effectively improved the yield of PQQ, tool
Have that raw material is cheap, technique simple, production efficiency advantages of higher, there is good industrial applications prospect.
Accompanying drawing explanation
Fig. 1 is PQQ bioassay standard curve.
Fig. 2 is the testing result of the PQQ yield of embodiment 3 step one.
Fig. 3 is the testing result of the PQQ yield of embodiment 3 step 2.
Detailed description of the invention
Being further described in detail the present invention below in conjunction with detailed description of the invention, the embodiment be given is only for explaining
The bright present invention rather than in order to limit the scope of the present invention.
Experimental technique in following embodiment, if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
Quantitative test in following example, is respectively provided with three times and repeats experiment, results averaged.
E. coli k12 is recorded in the following literature: Tomoya Baba, Takeshi Ara, Miki Hasegawa,
Yuki Takai, Yoshiko Okumura, Miki Baba, KirillA Datsenko, Masaru Tomita, Barry L
Wanner and Hirotada Moril.Construction of Escherichia coli K-12in-frame,
Single-gene knockout mutants:the Keio collection.Molecular Systems
Biology.2006:1-11). the public can obtain from Fujian Normal University (i.e. at applicant), to repeat the application experiment.
E. coli k12 Δ iscR is the product of Japan's National Institute of Genetics, and production code member is ECK2528.Large intestine
Bacillus K12 Δ iscR is by being obtained by the gene knockout encoding iscR albumen in e. coli k12 genome.Described iscR
Protein amino acid sequence is as shown in sequence 8 in sequence table.The gene of described coding iscR albumen is for such as sequence 17 institute in sequence table
Show.
Plasmid pBAD/hisB is invitrogen Products, and catalog number is V430-01.PQQ standard substance are
Sigma Products, catalog number is D7783.DNA Assembly test kit, T4 ligase, restricted enzyme Nco I,
Restricted enzyme Nhe I, restricted enzyme Pst I, restricted enzyme EcoR I and restricted enzyme Hind III are
NEB Products, catalog number is respectively E2621, M0202, R3193, R3131, R3140, R3101 and R3104.
The solute of M9 culture medium and concentration thereof is: disodium hydrogen phosphate 6g/L, potassium dihydrogen phosphate 3g/L, ammonium chloride 1g/L, chlorine
Change sodium 0.5g/L, glycerol 2.5g/L, glucose 0.5g/L, magnesium sulfate 0.12g/L, calcium chloride 33mg/L, liquid microelement 1mL/
L, solvent is distilled water, and pH value is 7.0；Wherein solute and the concentration thereof of liquid microelement is: iron chloride 8.3g/L, zinc chloride
0.84g/L, manganese chloride 0.016g/L, copper chloride 0.13g/L, cobaltous chloride 0.1g/L, boric acid 0.1g/L, biotin 1g/L and Wei Sheng
Element B11g/L, solvent is distilled water, and pH value is natural.
M9 culture medium first: the M9 culture medium containing L-arabinose, L-arabinose concentration in M9 culture medium first is
0.5g/L。
M9 culture medium second: containing L-arabinose and FeSO4M9 culture medium, dense in M9 culture medium second of L-arabinose
Degree is 0.5g/L, FeSO4Concentration in M9 culture medium second is 30 μMs.
LB solid medium: tryptone 10g, yeast extract 5g, NaCl 5g and agar powder 15g are dissolved in 1L distillation
Water obtains.
LB solid plate: poured into while hot in culture dish by LB solid medium, obtains LB solid plate.
Denitrogenation Hyphomicrobium (Hyphomicrobium denitrificans) FJNU-R8CGMCC No.10620 is in 2015
It is preserved in China General Microbiological culture presevation administrative center (abbreviation CGMCC, address: the Chaoyang District, Beijing City North Star on March 13, in
West Road 1 No. 3 Institute of Microorganism, Academia Sinica of institute, postcode: 100101), the public can protect from China's General Microbiological Culture
Hide administrative center and obtain this bacterial strain.Denitrogenation Hyphomicrobium (Hyphomicrobium denitrificans) FJNU-R8CGMCC
No.10620 is hereinafter called for short denitrogenation Hyphomicrobium.
Embodiment 1, structure recombination bacillus coli
One, construction recombination plasmid
1, the structure of recombiant plasmid pBHdA1BE
(1) genomic DNA of denitrogenation Hyphomicrobium is extracted.
(2) synthetic primers F 1:5'-CATGCCATGGAAAGCAGTTACCG-3'(underscore is restricted enzyme
The restriction endonuclease recognition sequence of Nco I) and R1:5'-CTAGCTAGCTCAGATGAGGTTGATCTCAG-3'(underscore is restricted interior
Cut the restriction endonuclease recognition sequence of enzyme Nhe I).
(3), after completing step (1) and (2), the genomic DNA extracted with step (1), as template, enters with F1 and R1 for primer
Performing PCR expands, and obtains the double chain DNA molecule of about 140bp.
(4) double chain DNA molecule obtained by restricted enzyme Nco I and Nhe I double digestion step (3), reclaims enzyme action and produces
Thing.
(5) with restricted enzyme Nco I and Nhe I double digestion plasmid pBAD/hisB, the carrier framework of about 4.1kb is reclaimed.
(6) the carrier framework T4 ligase that digestion products step (4) reclaimed and step (5) reclaim connects, and obtains
Middle interstitial granules.
(7) synthetic primers F 2:
5'-CTGCAGCTGGTACCATATGGGAATTC
ATGATCATAAAAGTGCTCGGGT-3'(underscore is the homologous sequence on plasmid pBAD/hisB, and square frame is RBS sequence, double
Underscore be in sequence table sequence 12 from 5' end the 12nd to 33) and R2:5'-CTCTCATCCGCCAAAACAGCCAAGCTT -3'(underscore is on plasmid pBAD/hisB
Homologous sequence, double underline is sequence 12 reverse complementary sequence of the 3203rd to 3222 from 5' end in sequence table).
(8) genomic DNA extracted with step (1) is as template, carries out PCR amplification with F2 and R2 for primer, obtains about
The double chain DNA molecule of 3.3kb.
(9) the middle interstitial granules obtained by restricted enzyme EcoR I and Hind III double digestion step (6), reclaims about 4.2kb
Carrier framework.
(10) carrier framework that double chain DNA molecule step (8) obtained and step (9) reclaim utilizes DNA Assembly
Test kit connects, and obtains recombiant plasmid pBHdA1BE.
According to sequencing result, recombiant plasmid pBHdA1BE is carried out structure and is described as follows: to the restriction of plasmid pBAD/hisB
The DNA molecular shown in sequence 9 of insertion sequence table, restricted enzyme between the recognition site of property restriction endonuclease Nco I and Nhe I
The DNA molecular shown in sequence 12 of insertion sequence table between the recognition site of EcoR I and Hind III.Recombiant plasmid pBHdA1BE table
Reach in sequence table the protein shown in sequence 4 in the protein (hereinafter referred to as PqqA1 albumen) shown in sequence 1, sequence table (following
Be called for short PqqB albumen), in sequence table in the protein (hereinafter referred to as PqqC albumen) shown in sequence 5, sequence table shown in sequence 6
Protein (hereinafter referred to as PqqE albumen) shown in sequence 7 in protein (hereinafter referred to as PqqD albumen) and sequence table.
2, the structure of recombiant plasmid pBHdA2BE
(1) genomic DNA of denitrogenation Hyphomicrobium is extracted.
(2) synthetic primers F 3:5'-CATGCCATGGAGGACATCATGAAGAC-3'(underscore is restriction enzyme
The restriction endonuclease recognition sequence of enzyme Nco I) and R3:5'-CTAGCTAGCTTAGATGAGGTCGATCTCGG-3'(underscore is restricted
The restriction endonuclease recognition sequence of restriction endonuclease NheI).
(3), after completing step (1) and (2), the genomic DNA extracted with step (1), as template, enters with F3 and R3 for primer
Performing PCR expands, and obtains the double chain DNA molecule of about 110bp.
(4) double chain DNA molecule obtained by restricted enzyme Nco I and Nhe I double digestion step (3), reclaims enzyme action and produces
Thing.
(5) with restricted enzyme Nco I and Nhe I double digestion plasmid pBAD/hisB, the carrier framework of about 4.1kb is reclaimed.
(6) the carrier framework T4 ligase that digestion products step (4) reclaimed and step (5) reclaim connects, and obtains
Middle interstitial granules.
(7) synthetic primers F 2:
5'-CTGCAGCTGGTACCATATGGGAATTC Under-3'(
Being scribed ss the homologous sequence on plasmid pBAD/hisB, square frame is RBS sequence, and double underline is that in sequence table, sequence 12 is last from 5'
Hold the 12nd to 33) and R2:5'-CTCTCATCCGCCAAAACAGCCAAGCTT Under-3'(
Be scribed ss the homologous sequence on plasmid pBAD/hisB, double underline be in sequence table sequence 12 from 5' end the 3203rd to
The reverse complementary sequence of 3222).
(8) genomic DNA extracted with step (1) is as template, carries out PCR amplification with F2 and R2 for primer, obtains about
The double chain DNA molecule of 3.3kb.
(9) the middle interstitial granules obtained by restricted enzyme EcoR I and Hind III double digestion step (6), reclaims about 4.2kb
Carrier framework.
(10) carrier framework that double chain DNA molecule step (8) obtained and step (9) reclaim utilizes DNA Assembly
Test kit connects, and obtains recombiant plasmid pBHdA2BE.
According to sequencing result, recombiant plasmid pBHdA2BE is carried out structure and is described as follows: to the restriction of plasmid pBAD/hisB
The DNA molecular shown in sequence 10 of insertion sequence table, restricted enzyme between the recognition site of property restriction endonuclease Nco I and Nhe I
The DNA molecular shown in sequence 12 of insertion sequence table between the recognition site of EcoR I and Hind III.Recombiant plasmid pBHdA2BE table
Reach in sequence table the PqqB albumen shown in sequence 4, sequence in the protein (hereinafter referred to as PqqA2 albumen) shown in sequence 2, sequence table
In list in the PqqC albumen shown in sequence 5, sequence table in the PqqD albumen shown in sequence 6 and sequence table shown in sequence 7
PqqE albumen.
3, the structure of recombiant plasmid pBHdA3BE
(1) genomic DNA of denitrogenation Hyphomicrobium is extracted.
(2) synthetic primers F 4:5'-CATGCCATGGGTATGAAAGTCTGGACGAAACC-3'(underscore is for limiting
The restriction endonuclease recognition sequence of property restriction endonuclease Nco I) and R4:5'-CTAGCTAGCTTAGATCAGATCGATCTCAGCC-3'(underscore
Restriction endonuclease recognition sequence for restricted enzyme Nhe I).
(3), after completing step (1) and (2), the genomic DNA extracted with step (1), as template, enters with F4 and R4 for primer
Performing PCR expands, and obtains the double chain DNA molecule of about 110bp.
(4) double chain DNA molecule obtained by restricted enzyme Nco I and Nhe I double digestion step (3), reclaims enzyme action and produces
Thing.
(5) with restricted enzyme Nco I and Nhe I double digestion plasmid pBAD/hisB, the carrier framework of about 4.1kb is reclaimed.
(6) the carrier framework T4 ligase that digestion products step (4) reclaimed and step (5) reclaim connects, and obtains
Middle interstitial granules.
(7) synthetic primers F 2:
5'-CTGCAGCTGGTACCATATGGGAATTC Under-3'(
Being scribed ss the homologous sequence on plasmid pBAD/hisB, square frame is RBS sequence, and double underline is that in sequence table, sequence 12 is last from 5'
Hold the 12nd to 33) and R2:5'-CTCTCATCCGCCAAAACAGCCAAGCTT Under-3'(
Be scribed ss the homologous sequence on plasmid pBAD/hisB, double underline be in sequence table sequence 12 from 5' end the 3203rd to
The reverse complementary sequence of 3222).
(8) genomic DNA extracted with step (1) is as template, carries out PCR amplification with F2 and R2 for primer, obtains about
The double chain DNA molecule of 3.3kb.
(9) the middle interstitial granules obtained by restricted enzyme EcoR I and Hind III double digestion step (6), reclaims about 4.2kb
Carrier framework.
(10) carrier framework that double chain DNA molecule step (8) obtained and step (9) reclaim utilizes DNA Assembly
Test kit connects, and obtains recombiant plasmid pBHdA3BE.
According to sequencing result, recombiant plasmid pBHdA3BE is carried out structure and is described as follows: to the restriction of plasmid pBAD/hisB
The DNA molecular shown in sequence 11 of insertion sequence table, restricted enzyme between the recognition site of property restriction endonuclease Nco I and Nhe I
The DNA molecular shown in sequence 12 of insertion sequence table between the recognition site of EcoR I and Hind III.Recombiant plasmid pBHdA3BE table
Reach in sequence table the PqqB albumen shown in sequence 4, sequence in the protein (hereinafter referred to as PqqA3 albumen) shown in sequence 3, sequence table
In list in the PqqC albumen shown in sequence 5, sequence table in the PqqD albumen shown in sequence 6 and sequence table shown in sequence 7
PqqE albumen.
4, the structure of recombiant plasmid pBHdA1A2BE
(1) genomic DNA of denitrogenation Hyphomicrobium is extracted.
(2) synthetic primers F 5:5'-CTAGCTAGCLower stroke of AAGGAGATATAATGGAGGACATCATGAAGAC-3'(
Line is the restriction endonuclease recognition sequence of restricted enzyme Nhe I) and R5:5'-AACTGCAGUnder TTAGATGAGGTCGATCTCGG-3'(
It is scribed ss the restriction endonuclease recognition sequence of restricted enzyme Pst I).
(3), after completing step (1) and (2), the genomic DNA extracted with step (1), as template, enters with F5 and R5 for primer
Performing PCR expands, and obtains the double chain DNA molecule of about 130bp.
(4) double chain DNA molecule obtained by restricted enzyme Nhe I and Pst I double digestion step (3), reclaims enzyme action and produces
Thing.
(5) the middle interstitial granules obtained with (6) in restricted enzyme Nhe I and Pst I double digestion step 1, reclaims about 4.1kb
Carrier framework.
(6) the carrier framework T4 ligase that digestion products step (4) reclaimed and step (5) reclaim connects, and obtains
Middle interstitial granules first.
(7) synthetic primers F 2:
5'-CTGCAGCTGGTACCATATGGGAATTC Under-3'(
Being scribed ss the homologous sequence on plasmid pBAD/hisB, square frame is RBS sequence, and double underline is that in sequence table, sequence 12 is last from 5'
Hold the 12nd to 33) and R2:5'-CTCTCATCCGCCAAAACAGCCAAGCTT Under-3'(
Be scribed ss the homologous sequence on plasmid pBAD/hisB, double underline be in sequence table sequence 12 from 5' end the 3203rd to
The reverse complementary sequence of 3222).
(8) genomic DNA extracted with step (1) is as template, carries out PCR amplification with F2 and R2 for primer, obtains about
The double chain DNA molecule of 3.3kb.
(9) the middle interstitial granules first obtained by restricted enzyme EcoR I and Hind III double digestion step (6), reclaims about
The carrier framework of 4.2kb.
(10) carrier framework that double chain DNA molecule step (8) obtained and step (9) reclaim utilizes DNA Assembly
Test kit connects, and obtains recombiant plasmid pBHdA1A2BE.
According to sequencing result, recombiant plasmid pBHdA1A2BE is carried out structure and is described as follows: to the limit of plasmid pBAD/hisB
The DNA molecular shown in sequence 9 of insertion sequence table, restricted enzyme between the recognition site of property restriction endonuclease Nco I and Nhe I processed
The DNA molecular shown in sequence 18 of insertion sequence table, restricted enzyme EcoR I He between the recognition site of Nhe I and Pst I
The DNA molecular shown in sequence 12 of insertion sequence table between the recognition site of Hind III.Recombiant plasmid pBHdA1A2BE expresses sequence
In list in the PqqA1 albumen shown in sequence 1, sequence table in the PqqA2 albumen shown in sequence 2, sequence table shown in sequence 4
Sequence in PqqD albumen shown in sequence 6 and sequence table in PqqC albumen shown in sequence 5, sequence table in PqqB albumen, sequence table
PqqE albumen shown in row 7.
5, the structure of recombiant plasmid pBHdA1A2A3BE
(1) genomic DNA of denitrogenation Hyphomicrobium is extracted.
(2) synthetic primers F 6:5'-AACTGCAG(underscore is AAGGAGATATAATGAAAGTCTGGACGAAACC
The restriction endonuclease recognition sequence of restricted enzyme Pst I)-3' and R6:5'-GGAATTCTTAGATCAGATCGATCTCAGCC (lower stroke
Line is the restriction endonuclease recognition sequence of restricted enzyme EcoR I)-3'.
(3), after completing step (1) and (2), the genomic DNA extracted with step (1), as template, enters with F6 and R6 for primer
Performing PCR expands, and obtains the double chain DNA molecule of about 120bp.
(4) double chain DNA molecule obtained by restricted enzyme Pst I and EcoR I double digestion step (3), reclaims enzyme action and produces
Thing.
(5) the middle interstitial granules first obtained with (6) in restricted enzyme Pst I and EcoR I double digestion step 4, reclaims about
The carrier framework of 4.2kb.
(6) the carrier framework T4 ligase that digestion products step (4) reclaimed and step (5) reclaim connects, and obtains
Middle interstitial granules second.
(7) synthetic primers F 7:
5'-CCGAGATCGACCTCATCTAAGAATTC Under-3'(
Being scribed ss the homologous sequence on plasmid pBAD/hisB, square frame is RBS sequence, and double underline is that in sequence table, sequence 12 is last from 5'
Hold the 12nd to 33) and R2:5'-CTCTCATCCGCCAAAACAGCCAAGCTT Under-3'(
Be scribed ss the homologous sequence on plasmid pBAD/hisB, double underline be in sequence table sequence 12 from 5' end the 3203rd to
The reverse complementary sequence of 3222).
(8) genomic DNA extracted with step (1) is as template, carries out PCR amplification with F7 and R2 for primer, obtains about
The double chain DNA molecule of 3.3kb.
(9) the middle interstitial granules second obtained by restricted enzyme EcoR I and Hind III double digestion step (6), reclaims about
The carrier framework of 4.3kb.
(10) carrier framework that double chain DNA molecule step (8) obtained and step (9) reclaim utilizes DNA Assembly
Test kit connects, and obtains recombiant plasmid pBHdA1A2A3BE.
According to sequencing result, recombiant plasmid pBHdA1A2A3BE is carried out structure and is described as follows: to plasmid pBAD/hisB's
The DNA molecular shown in sequence 9 of insertion sequence table, restriction enzyme between the recognition site of restricted enzyme Nco I and Nhe I
The DNA molecular shown in sequence 18 of insertion sequence table between the recognition site of enzyme Nhe I and Pst I, with restricted enzyme Pst I
And the DNA molecular shown in sequence 19 of insertion sequence table between the recognition site of EcoR I, restricted enzyme EcoR I and Hind
The DNA molecular shown in sequence 12 of insertion sequence table between the recognition site of III.Recombiant plasmid pBHdA1A2A3BE expressed sequence
In table in the PqqA1 albumen shown in sequence 1, sequence table in the PqqA2 albumen shown in sequence 2, sequence table shown in sequence 3
Sequence in PqqC albumen shown in sequence 5, sequence table in PqqB albumen shown in sequence 4, sequence table in PqqA3 albumen, sequence table
PqqE albumen shown in sequence 7 in PqqD albumen shown in row 6 and sequence table.
Two, recombination bacillus coli is built
1, recombination bacillus coli KQ01 is built
Recombiant plasmid pBHdA1BE is imported e. coli k12, obtains the escherichia coli containing recombiant plasmid pBHdA1BE
K12, named recombination bacillus coli KQ01, be called for short KQ01.
2, recombination bacillus coli KQ02 is built
Recombiant plasmid pBHdA1BE is imported e. coli k12 Δ iscR, obtains the large intestine containing recombiant plasmid pBHdA1BE
Bacillus K12 Δ iscR, named recombination bacillus coli KQ02, be called for short KQ02.
3, recombination bacillus coli KQ03 is built
Recombiant plasmid pBHdA2BE is imported e. coli k12 Δ iscR, obtains the large intestine containing recombiant plasmid pBHdA2BE
Bacillus K12 Δ iscR, named recombination bacillus coli KQ03, be called for short KQ03.
4, recombination bacillus coli KQ04 is built
Recombiant plasmid pBHdA3BE is imported e. coli k12 Δ iscR, obtains the large intestine containing recombiant plasmid pBHdA3BE
Bacillus K12 Δ iscR, named recombination bacillus coli KQ04, be called for short KQ04.
5, recombination bacillus coli KQ05 is built
Recombiant plasmid pBHdA1A2BE is imported e. coli k12 Δ iscR, obtains containing recombiant plasmid pBHdA1A2BE's
E. coli k12 Δ iscR, named recombination bacillus coli KQ05, be called for short KQ05.
6, recombination bacillus coli KQ06 is built
Recombiant plasmid pBHdA1A2A3BE is imported e. coli k12 Δ iscR, obtains containing recombiant plasmid
The e. coli k12 Δ iscR of pBHdA1A2A3BE, named recombination bacillus coli KQ06, be called for short KQ06.
7, recombination bacillus coli KQ07 (empty vector control) is built
Plasmid pBAD/hisB is imported e. coli k12 Δ iscR, obtains the e. coli k12 containing plasmid pBAD/hisB
Δ iscR, named recombination bacillus coli KQ07, be called for short KQ07.
Embodiment 2, the mensuration of unit cell PQQ yield
Using high performance liquid chromatography (HPLC) analytical unit cell PQQ yield, concrete determination step is as follows:
One, the drafting of PQQ standard curve
Taking 1mg PQQ standard substance, be placed in 25mL volumetric flask, add 20mL ultra-pure water, vortex makes it use after being completely dissolved again
Ultra-pure water is settled to 25mL, obtains the solution 1 that PQQ standard concentration is 40mg/L；Then with ultra-pure water, solution 1 is diluted, depend on
The secondary PQQ of obtaining standard concentration be the solution 2 of 30mg/L, PQQ standard concentration be the solution 3 of 20mg/L, PQQ standard concentration
For the solution 4 of 16mg/L, PQQ standard concentration be the solution 5 of 12mg/L, PQQ standard concentration be the solution 6 of 8mg/L, PQQ
Standard concentration be the solution 7 of 6mg/L, PQQ standard concentration be the solution 8 and PQQ standard concentration of 4mg/L be 2mg/L's
Solution 9.Above-mentioned each solution water system filter of 0.22 μm is filtered, collects filtrate, then use HPLC to quantitative determine, with
The peak area of absworption peak (retention time is 1.78～1.79min) is abscissa, and solution concentration is vertical coordinate, draws PQQ standard
Curve, is shown in Fig. 1.
HPLC condition determination is as follows: chromatographic column: WatersReversed-phase column (3.5 μm, 150 × 2.1mm)；Post
Temperature: 45 DEG C；Detection wavelength: 330nm；Flowing phase: (water+0.1%TFA): acetonitrile (v:v)=20:80；Flow velocity: 0.25mL/min.
Two, the assay method of unit cell PQQ yield
1, the mensuration of the PQQ yield in bacterium solution to be measured
Taking 5mL bacterium solution to be measured, 10000g is centrifuged 5min, obtains supernatant.Take described supernatant, by the water system filter mistake of 0.22 μm
Filter, collects filtrate and uses HPLC to quantitative determine.Peak area according to bacterium solution absworption peak to be measured and the PQQ of step one drafting
Standard curve, obtains the PQQ yield in bacterium solution to be measured.
The computing formula of the PQQ yield in bacterium solution to be measured is as follows:
PQQ yield (C in bacterium solution to be measuredPQQ, mg/L) and=1.3746 × Pst+0.8096；
Wherein Pst represents the peak area (Pst unit: μ V S) of bacterium solution absworption peak to be measured.
2, the mensuration of Biomass in bacterium solution to be measured
Taking 20mL bacterium solution to be measured, be placed in the centrifuge tube weighed, 10000g is centrifuged 5min, abandons supernatant, then will contain
The centrifuge tube of thalline is placed in baking oven, and 80 DEG C process 48h, and then weigh (m2)。
In bacterium solution to be measured, the computing formula of Biomass is as follows:
Biomass (DCW, g/L)=(m in bacterium solution to be measured2-m1)/0.02；
Wherein m2Represent the centrifuge tube weight (unit: g) containing thalline；m1Represent the weight (unit: g) of empty centrifuge tube.
3, the calculating of unit cell PQQ yield
The computing formula of unit cell PQQ yield is as follows:
Unit cell PQQ yield (PPQQ, mg/g DCW) and=CPQQ/DCW。
Embodiment 3, KQ01～KQ06 utilizing embodiment 1 to build produce PQQ
One, the ferrous ion impact on unit cell PQQ yield is added
1, on the LB solid plate containing 100 μ g/mL penbritin, the KQ01 (activation condition that embodiment 1 builds is activated
For: 37 DEG C, 12h), obtain KQ01 monoclonal.
2, after completing step 1, take KQ01 monoclonal, be seeded to the 10mL M9 culture medium containing 100 μ g/mL penbritin
In, 37 DEG C, 200rpm shaken cultivation 12h, obtain cultivating bacterium solution 1.
3, after completing step 2, take cultivation bacterium solution 1, be seeded to M9 culture medium first or M9 culture medium second with the volume ratio of 1:20,
30 DEG C, 200rpm shaken cultivation 65h, obtain cultivating bacterium solution 2.
4, according to the method for embodiment 2, measure and cultivate unit cell PQQ yield and Biomass in bacterium solution 2, obtain KQ01 and connect
Plant the unit cell PQQ yield to M9 culture medium first or M9 culture medium second and Biomass.
According to the method described above, KQ01 being replaced with KQ02, other step is the most constant, obtains KQ02 and is seeded to M9 culture medium first
Or the unit cell PQQ yield in M9 culture medium second and Biomass.
Experimental result is shown in that (KQ01 is that KQ01 is seeded to M9 culture medium first to Fig. 2；KQ01+30 μm Fe is that KQ01 is seeded to M9 training
Support base second；KQ02 is that KQ02 is seeded to M9 culture medium first；KQ02+30 μm Fe is that KQ02 is seeded to M9 culture medium second).Result table
Bright, KQ01 unit cell PQQ yield in M9 culture medium second is higher, it is seen then that add ferrous ion in the medium favourable
In the synthesis PQQ of e. coli k12, unit cell PQQ yield brings up to 3.07mg/g DCW from 2.42mg/g DCW；KQ02 exists
Unit cell PQQ yield in M9 culture medium first is 3.13mg/g DCW, and the unit cell PQQ yield in M9 culture medium second is
3.19mg/g DCW, both are without significant difference, show in the culture medium of cultivation e. coli k12 Δ iscR regardless of whether contain two
Valency iron ion, all can promote the synthesis of PQQ.Above-mentioned each Biomass is all without significant difference.
Two, PqqA1 albumen, PqqA2 albumen or the impact on unit cell PQQ yield of the PqqA3 albumen
1, on the LB solid plate containing 100 μ g/mL penbritin, the KQ02 (activation condition that embodiment 1 builds is activated
For: 37 DEG C, 12h), obtain KQ02 monoclonal.
2, after completing step 1, take KQ02 monoclonal, be seeded in the M9 culture medium containing 100 μ g/mL penbritin, 37
DEG C, 200rpm shaken cultivation 24h, obtain cultivate bacterium solution 1.
3, after completing step 2, take cultivation bacterium solution 1, be seeded to M9 culture medium first with the inoculum concentration of 5% (percent by volume),
30 DEG C, 200rpm shaken cultivation 65h, obtain cultivating bacterium solution 2.
4, according to the method for embodiment 2, measure and cultivate unit cell PQQ yield and Biomass in bacterium solution 2, obtain KQ02 and connect
Plant the unit cell PQQ yield to M9 culture medium first and Biomass.
According to the method described above, KQ02 being replaced with KQ03, other step is the most constant, obtains KQ03 and is seeded to M9 culture medium first
In unit cell PQQ yield and Biomass.
According to the method described above, KQ02 being replaced with KQ04, other step is the most constant, obtains KQ04 and is seeded to M9 culture medium first
In unit cell PQQ yield and Biomass.
According to the method described above, KQ02 replacing with e. coli k12 Δ iscR, other step is the most constant, obtains large intestine bar
Unit cell PQQ yield that bacterium K12 Δ iscR is seeded in M9 culture medium first and Biomass (as comparison).
According to the method described above, KQ02 being replaced with KQ07, other step is the most constant, obtains KQ07 and is seeded to M9 culture medium first
In unit cell PQQ yield and Biomass.
Experimental result is shown in A in Fig. 3.Result shows, KQ02, KQ03 and KQ04 unit cell PQQ in M9 culture medium first
Yield is respectively 3.22mg/g DCW, 2.12mg/g DCW and 3.56mg/g DCW；E. coli k12 Δ iscR and KQ07 is at M9
Unit cell PQQ yield in culture medium first is 0mg/g DCW.E. coli k12 Δ iscR, KQ07, KQ02, KQ03 and
KQ04 Biomass in M9 culture medium first is without significant difference.The above results shows, the pqqA3 base shown in sequence 11 in sequence table
Because of the raising most beneficial for unit cell PQQ yield.
Three, the protein classes impact on unit cell PQQ yield
1, on the LB solid plate containing 100 μ g/mL penbritin, the KQ02 (activation condition that embodiment 1 builds is activated
For: 37 DEG C, 12h), obtain KQ02 monoclonal.
2, after completing step 1, take KQ02 monoclonal, be seeded in the M9 culture medium containing 100 μ g/mL penbritin, 37
DEG C, 200rpm shaken cultivation 24h, obtain cultivate bacterium solution 1.
3, after completing step 2, take cultivation bacterium solution 1, be seeded to M9 culture medium first with the inoculum concentration of 5% (percent by volume),
30 DEG C, 200rpm shaken cultivation 65h, obtain cultivating bacterium solution 2.
4, according to the method for embodiment 2, measure and cultivate unit cell PQQ yield and Biomass in bacterium solution 2, obtain KQ02 and connect
Plant the unit cell PQQ yield to M9 culture medium first and Biomass.
According to the method described above, KQ02 being replaced with KQ05, other step is the most constant, obtains KQ05 and is seeded to M9 culture medium first
In unit cell PQQ yield and Biomass.
According to the method described above, KQ02 being replaced with KQ06, other step is the most constant, obtains KQ06 and is seeded to M9 culture medium first
In unit cell PQQ yield and Biomass.
According to the method described above, KQ02 replacing with e. coli k12 Δ iscR, other step is the most constant, obtains large intestine bar
Unit cell PQQ yield that bacterium K12 Δ iscR is seeded in M9 culture medium first and Biomass (as comparison).
According to the method described above, KQ02 being replaced with KQ07, other step is the most constant, obtains KQ07 and is seeded to M9 culture medium first
In unit cell PQQ yield and Biomass.
Experimental result is shown in B in Fig. 3.Result shows, KQ02, KQ05 and KQ06 unit cell PQQ in M9 culture medium first
Yield is respectively 3.10mg/g DCW, 3.48mg/g DCW and 4.18mg/g DCW；E. coli k12 Δ iscR and KQ07 is at M9
Unit cell PQQ yield in culture medium first is 0mg/g DCW.E. coli k12 Δ iscR, KQ07, KQ02, KQ05 and
KQ06 Biomass in M9 culture medium first is without significant difference.The above results shows, expresses in e. coli k12 Δ iscR
The kind of PqqA1 albumen, PqqA2 albumen and PqqA3 albumen is the most, and its unit cell PQQ yield is the highest.
Claims (10)
1. specific DNA molecular, including following element: section A, section B, section C, section D and section E；
Described section A is following (1) or (2) or (3):
(1) DNA of the encoding gene containing the encoding gene of PqqA1 albumen, the encoding gene of PqqA2 albumen and PqqA3 albumen
Molecule；
(2) appointing in the encoding gene containing the encoding gene of PqqA1 albumen, the encoding gene of PqqA2 albumen and PqqA3 albumen
The DNA molecular of two encoding genes of meaning；
(3) DNA of the encoding gene containing the encoding gene of PqqA1 albumen, the encoding gene of PqqA2 albumen or PqqA3 albumen
Molecule；
Described section B is the DNA molecular of the encoding gene containing PqqB albumen；
Described section C is the DNA molecular of the encoding gene containing PqqC albumen；
Described section D is the DNA molecular of the encoding gene containing PqqD albumen；
Described section E is the DNA molecular of the encoding gene containing PqqE albumen；
Described PqqA1 albumen is a1) or a2):
A1) protein shown in sequence 1 during aminoacid sequence is sequence table；
A2) aminoacid sequence shown in sequence in sequence table 1 is passed through replacement and/or the disappearance of one or several amino acid residue
And/or add the protein with identical function obtained；
Described PqqA2 albumen is b1) or b2):
B1) protein shown in sequence 2 during aminoacid sequence is sequence table；
B2) aminoacid sequence shown in sequence in sequence table 2 is passed through replacement and/or the disappearance of one or several amino acid residue
And/or add the protein with identical function obtained；
Described PqqA3 albumen is c1) or c2):
C1) protein shown in sequence 3 during aminoacid sequence is sequence table；
C2) aminoacid sequence shown in sequence in sequence table 3 is passed through replacement and/or the disappearance of one or several amino acid residue
And/or add the protein with identical function obtained；
Described PqqB albumen is d1) or d2):
D1) protein shown in sequence 4 during aminoacid sequence is sequence table；
D2) aminoacid sequence shown in sequence in sequence table 4 is passed through replacement and/or the disappearance of one or several amino acid residue
And/or add the protein with identical function obtained；
Described PqqC albumen is e1) or e2):
E1) protein shown in sequence 5 during aminoacid sequence is sequence table；
E2) aminoacid sequence shown in sequence in sequence table 5 is passed through replacement and/or the disappearance of one or several amino acid residue
And/or add the protein with identical function obtained；
Described PqqD albumen is f1) or f2):
F1) protein shown in sequence 6 during aminoacid sequence is sequence table；
F2) aminoacid sequence shown in sequence in sequence table 6 is passed through replacement and/or the disappearance of one or several amino acid residue
And/or add the protein with identical function obtained；
Described PqqE albumen is g1) or g2):
G1) protein shown in sequence 7 during aminoacid sequence is sequence table；
G2) aminoacid sequence shown in sequence in sequence table 7 is passed through replacement and/or the disappearance of one or several amino acid residue
And/or add the protein with identical function obtained.
2. specific DNA molecular as claimed in claim 1, it is characterised in that:
The encoding gene of described PqqA1 albumen is A1) or A2) or A3):
A1) DNA molecular shown in sequence 9 during nucleotide sequence is sequence table；
A2) nucleotide sequence and A1) limited has 75% or more than 75% homogeneity, and encodes the DNA of described PqqA1 albumen
Molecule；
A3) under strict conditions with A1) or the A2) nucleotide sequence hybridization that limits, and the DNA encoding described PqqA1 albumen divides
Son；
The encoding gene of described PqqA2 albumen is B1) or B2) or B3):
B1) DNA molecular shown in sequence 10 during nucleotide sequence is sequence table；
B2) nucleotide sequence and B1) limited has 75% or more than 75% homogeneity, and encodes the DNA of described PqqA2 albumen
Molecule；
B3) under strict conditions with B1) or the B2) nucleotide sequence hybridization that limits, and the DNA encoding described PqqA2 albumen divides
Son；
The encoding gene of described PqqA3 albumen is C1) or C2) or C3):
C1) DNA molecular shown in sequence 11 during nucleotide sequence is sequence table；
C2) nucleotide sequence and C1) limited has 75% or more than 75% homogeneity, and encodes the DNA of described PqqA3 albumen
Molecule；
C3) under strict conditions with C1) or the C2) nucleotide sequence hybridization that limits, and the DNA encoding described PqqA3 albumen divides
Son；
The encoding gene of described PqqB albumen is D1) or D2) or D3):
D1) DNA molecular shown in sequence 13 during nucleotide sequence is sequence table；
D2) nucleotide sequence and D1) limited has 75% or more than 75% homogeneity, and encodes the DNA of described PqqB albumen
Molecule；
D3) under strict conditions with D1) or the D2) nucleotide sequence hybridization that limits, and the DNA encoding described PqqB albumen divides
Son；
The encoding gene of described PqqC albumen is E1) or E2) or E3):
E1) DNA molecular shown in sequence 14 during nucleotide sequence is sequence table；
E2) nucleotide sequence and E1) limited has 75% or more than 75% homogeneity, and encodes the DNA of described PqqC albumen
Molecule；
E3) under strict conditions with E1) or the E2) nucleotide sequence hybridization that limits, and the DNA encoding described PqqC albumen divides
Son；
The encoding gene of described PqqD albumen is F1) or F2) or F3):
F1) DNA molecular shown in sequence 15 during nucleotide sequence is sequence table；
F2) nucleotide sequence and F1) limited has 75% or more than 75% homogeneity, and encodes the DNA of described PqqD albumen
Molecule；
F3) under strict conditions with F1) or the F2) nucleotide sequence hybridization that limits, and the DNA encoding described PqqD albumen divides
Son；
The encoding gene of described PqqE albumen is G1) or G2) or G3):
G1) DNA molecular shown in sequence 16 during nucleotide sequence is sequence table；
G2) nucleotide sequence and G1) limited has 75% or more than 75% homogeneity, and encodes the DNA of described PqqE albumen
Molecule；
G3) under strict conditions with G1) or the G2) nucleotide sequence hybridization that limits, and the DNA encoding described PqqE albumen divides
Son.
3. contain the special plasmid of specific DNA molecular described in claim 1 or 2.
Special plasmid the most as claimed in claim 3, it is characterised in that: the preparation method of described special plasmid is as follows: setting out
Plasmid imports section A, described section B, described section C, described section D and described section E described in claim 1 or 2,
The recombiant plasmid arrived.
5. contain the recombinant bacterium of special plasmid described in claim 3 or 4.
6. recombinant bacterium as claimed in claim 5, it is characterised in that: the preparation method of described recombinant bacterium is as follows: by described special
Plasmid imports the bacterium that sets out, and obtains recombinant bacterium.
7. recombinant bacterium as claimed in claim 6, it is characterised in that the bacterium that sets out described in: is escherichia coli.
8. specific DNA molecular described in claim 1 or 2, or, special plasmid described in claim 3 or 4, or, claim 5 to 7
In arbitrary described recombinant bacterium preparation pyrroloquinoline quinone in application.
9. the method preparing pyrroloquinoline quinone, comprises the steps: the arbitrary described restructuring of fermentation culture claim 5 to 7
Bacterium, obtains pyrroloquinoline quinone.
10.A) or B):
A) fusion protein, including following element: PqqB albumen described in PqqA albumen, claim 1 or 2, described PqqC albumen,
Described PqqD albumen and described PqqE albumen；
Described PqqA albumen is following (P1) or (P2) or (P3):
(P1) PqqA1 albumen described in claim 1 or 2, described PqqA2 albumen and described PqqA3 albumen；
(P2) any two in PqqA1 albumen described in claim 1 or 2, described PqqA2 albumen and described PqqA3 albumen
Albumen；
(P3) PqqA1 albumen described in claim 1 or 2, described PqqA2 albumen or described PqqA3 albumen；
B) protein composition, by PqqB albumen described in described PqqA albumen, claim 1 or 2, described PqqC albumen, described
PqqD albumen, described PqqE albumen form.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610512635.9A CN106086052B (en) | 2016-07-01 | 2016-07-01 | Produce bacterium and its application of pyrroloquinoline quinone |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610512635.9A CN106086052B (en) | 2016-07-01 | 2016-07-01 | Produce bacterium and its application of pyrroloquinoline quinone |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106086052A true CN106086052A (en) | 2016-11-09 |
| CN106086052B CN106086052B (en) | 2019-11-01 |
Family
ID=57212014
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610512635.9A Active CN106086052B (en) | 2016-07-01 | 2016-07-01 | Produce bacterium and its application of pyrroloquinoline quinone |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106086052B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019012058A1 (en) * | 2017-07-14 | 2019-01-17 | Biosyntia Aps | Cell factory having improved iron-sulfur cluster delivery |
| CN110592249A (en) * | 2019-10-29 | 2019-12-20 | 山东省果树研究所 | Specific primer for rapidly identifying orchard efficient phosphate solubilizing bacteria, kit and separation identification method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1814761A (en) * | 2005-01-31 | 2006-08-09 | 中国人民解放军军事医学科学院生物工程研究所 | Pyrroloquinoline quinone synthesis related gene and its coding protein |
| CN104745513A (en) * | 2015-04-01 | 2015-07-01 | 福建师范大学 | Pyrroloquinoline-quinone-producing Hyphomicrobium strain and application thereof |
| CN105624084A (en) * | 2016-01-28 | 2016-06-01 | 福建师范大学 | Oriented domestication and breeding of methylotrophic bacterium capable of producing pyrroloquinoline quinone at high yield |
-
2016
- 2016-07-01 CN CN201610512635.9A patent/CN106086052B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1814761A (en) * | 2005-01-31 | 2006-08-09 | 中国人民解放军军事医学科学院生物工程研究所 | Pyrroloquinoline quinone synthesis related gene and its coding protein |
| CN104745513A (en) * | 2015-04-01 | 2015-07-01 | 福建师范大学 | Pyrroloquinoline-quinone-producing Hyphomicrobium strain and application thereof |
| CN105624084A (en) * | 2016-01-28 | 2016-06-01 | 福建师范大学 | Oriented domestication and breeding of methylotrophic bacterium capable of producing pyrroloquinoline quinone at high yield |
Non-Patent Citations (2)
| Title |
|---|
| CHONGRONG KE: "Producing pyrroloquinoline quinone in Escherichia coli through overexpression pqqA genes of Hyphomicrobium denitrificans", 《2015 SIMB ANNUAL MEETING AND EXHIBITION》 * |
| 吴波 等: "吡咯喹啉醌(PQQ)合成基因对PQQ产量的影响", 《武汉大学学报(自然科学版)》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019012058A1 (en) * | 2017-07-14 | 2019-01-17 | Biosyntia Aps | Cell factory having improved iron-sulfur cluster delivery |
| CN110592249A (en) * | 2019-10-29 | 2019-12-20 | 山东省果树研究所 | Specific primer for rapidly identifying orchard efficient phosphate solubilizing bacteria, kit and separation identification method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106086052B (en) | 2019-11-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Holmes et al. | Metatranscriptomic evidence for direct interspecies electron transfer between Geobacter and Methanothrix species in methanogenic rice paddy soils | |
| Willame et al. | Morphological and molecular characterization of planktonic cyanobacteria from Belgium and Luxembourg 1 | |
| Qin et al. | Comparative genomics reveals a deep-sea sediment-adapted life style of Pseudoalteromonas sp. SM9913 | |
| CN105886431B (en) | The method of one plant of corynebacterium glutamicum and its high yield isoleucine | |
| Wei et al. | Isolation of halotolerant Bacillus licheniformis WX-02 and regulatory effects of sodium chloride on yield and molecular sizes of poly-γ-glutamic acid | |
| Feng et al. | Extensive gene acquisition in the extremely psychrophilic bacterial species Psychroflexus torquis and the link to sea-ice ecosystem specialism | |
| Kurmayer et al. | Integrating phylogeny, geographic niche partitioning and secondary metabolite synthesis in bloom-forming Planktothrix | |
| Ding et al. | Microbiome characteristics and the key biochemical reactions identified on stone world cultural heritage under different climate conditions | |
| Wu et al. | Comparative genome analysis reveals genetic adaptation to versatile environmental conditions and importance of biofilm lifestyle in Comamonas testosteroni | |
| Wegner et al. | Lanthanide-dependent methylotrophs of the family Beijerinckiaceae: physiological and genomic insights | |
| Mogany et al. | Phenotypic and genotypic characterisation of an unique indigenous hypersaline unicellular cyanobacterium, Euhalothece sp. nov | |
| Zhao et al. | Enhancement of fengycin production in Bacillus amyloliquefaciens by genome shuffling and relative gene expression analysis using RT-PCR | |
| Licciardello et al. | Transcriptome analysis of Pseudomonas mediterranea and P. corrugata plant pathogens during accumulation of medium-chain-length PHAs by glycerol bioconversion | |
| CN106086052B (en) | Produce bacterium and its application of pyrroloquinoline quinone | |
| Li et al. | Novel bioflocculant produced by salt-tolerant, alkaliphilic strain Oceanobacillus polygoni HG6 and its application in tannery wastewater treatment | |
| Grouzdev et al. | Microbial communities of stratified aquatic ecosystems of Kandalaksha Bay (White Sea) shed light on the evolutionary history of green and brown morphotypes of Chlorobiota | |
| Merugu et al. | Biotechnological applications of purple non sulphur phototrophic bacteria: a minireview | |
| Almeida et al. | Culturomics remains a highly valuable methodology to obtain rare microbial diversity with putative biotechnological potential from two Portuguese salterns | |
| Wang et al. | Rhodanobacter panaciterrae sp. nov., a bacterium with ginsenoside-converting activity isolated from soil of a ginseng field | |
| DE60118401T2 (en) | GEN FOR THE RUBBER POLYPEPTIDE FROM METHYLOMONAS SP. CODED AND THAT IS INVOLVED IN THE MANUFACTURE OF EXOPOLYSACCHARIDES | |
| CN107460152A (en) | Produce recombinant bacterium, construction method and the purposes of rhodioside and the like | |
| Dziga et al. | Genetically engineered bacteria immobilized in alginate as an option of cyanotoxins removal | |
| CN102120966A (en) | Construction and application of URA3 defective P. pastoris X-33 strain | |
| Kizina | Insights into the biology of Candidate Division OP3 LiM populations | |
| CN104498558B (en) | A kind of method that utilization microorganism prepares Sophoridine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200714 Address after: 350108 Fujian Fuzhou city Fuzhou high tech Zone "Haixi Hi-tech Industrial Park" building B District 4 floor 418 room (Minhou County, Shanghai Street town of science and technology No. 8) Patentee after: FUJIAN LIDUOLI BIOLOGICAL TECHNOLOGY Co.,Ltd. Address before: 350117 Fujian city of Fuzhou province science and Technology University City Road No. 1 Qishan campus of Fujian Normal University Patentee before: Fujian Normal University |