CN106086046B

CN106086046B - One group of DNA molecular and its recombinant plasmid and recombination bacillus coli and its application for producing astragalin

Info

Publication number: CN106086046B
Application number: CN201610405275.2A
Authority: CN
Inventors: 裴建军; 董萍; 赵林果; 解静聪
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2016-06-08
Filing date: 2016-06-08
Publication date: 2019-08-16
Anticipated expiration: 2036-06-08
Also published as: CN106086046A

Abstract

One group of DNA molecular and its recombinant plasmid and recombination bacillus coli and its application for producing astragalin, including optimized arabidopsis glycosyltransferase gene78D2, saccharose phosphorylation enzyme geneBasp, uridyltransferase geneugpAWith sucrose permease geneCscB,Its nucleic acid sequence is respectively as shown in SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:6.The glycosyltransferase gene of recombinant bacterium energy high efficient expression full genome optimizationop78D2, the enzyme can efficiently, specificity be glycosylated in 3 hydroxyls of kaempferol；Simultaneously by strengthening the route of synthesis of recombinant bacterium UDP-glucose, enables recombinant bacterium efficient provision UDP-glucose, release the bottleneck of recombinant bacterium synthesis astragalin.Eventually by the optimization of fermentation condition, efficiently synthesizing for astragalin is realized.

Description

One group of DNA molecular and its recombinant plasmid and recombination bacillus coli and its production astragalin Application

Technical field

The invention belongs to technique for gene engineering and biomedicine fields, and in particular to one group of DNA molecular and its recombinant plasmid With the application of recombination bacillus coli and its production astragalin.

Background technique

Astragalin is a kind of flavone compound, is present in various plants.Such as lotus leaf, mulberry leaf, tianshan mountainash branchlet and fruit leaf, dimension Marshmallow is spent.Entitled 3,5,7,4 '-kaempferol -3- glucoside of astragalin Science of Chemistry, molecular formula C₂₁H₂₀O₁₁, Relative molecular weight is 448.38, and molecular structural formula is as shown in figure -1.With significant antioxidant activity, anti-inflammatory activity, anti-mistake Quick property adjusts the multiple pharmacological effects such as immunity of organisms.

Anti-inflammatory effect: astragalin can significantly inhibit LPS induction RAW264.7 cell NO, PGE2 and IL-6 or TNF-α Generation；Research shows that astragalin can reduce the Human gingival epithelial cells proinflammatory cytokines of porphyromonas gingivalis capsule induction The gene expression dose of COX-2, IL-6, IL-8, MMP-1 and MMP-3 show that it is a kind of potential Treatment in Patients with Chronic Periodontitis medicine Object.

Anti-allergic effects: have been reported that display astragalin there is treatment well to make anaphylactia such as allergic dermatitis With.Matsumoto etc. is administered orally allergic dermatitis mouse, and discovery astragalin can mitigate its dermatitis symptom, and subtract Few transepidermal water is lost.People's basophilic that the researchs such as Kotani discovery astragalin can inhibit high-cutting slope along road to be crosslinked is white Blood disease cell (KU812) histamine release is horizontal, weakens mouse passive cutaneous anaphylaxis and scytitis reaction, it is thin to reduce inflammatory Born of the same parents' such as mast cells infiltration is lowered IgE level and splenic T lymphocyte in blood and is secreted to IL-4 and IL-13.

Antioxidation: flavone compound is widely used as antioxidant use all the time.It can be effectively Scavenging capacity oxygen radical, and terminate with peroxy radical effect the free radical in polyunsaturated fatty acid oxidation process Chain reaction.Park etc. confirms that astragalin can fight active oxygen radical, protects cell membrane from shining upon caused skin Skin damage.The researchs such as Zhang Yindi find that astragalin has haemocylolysis and anti-CCl caused by anti-polygalic acid₄Liver toxicity, Enhance Sudismase in mouse red blood cell (SOD) activity simultaneously, reduce malonaldehyde (MDA) in Mouse Liver and increases glutathione (GSH) content.The oxidation that the researchs such as Choi discovery astragalin can effectively prevent human red blood cells free radical (AAPH) from inducing is molten Blood and intracellular anti-oxidation substance glutathione (GSH) failure.Saito etc. passes through HPLC- UV detection device (HPLC- UV) find astragalin Scavenging ability and its hydrogen bond is formed between G-C base-pair to reinforce it between DNA Chimeric ability is related.The researchs such as Kovganko discovery astragalin can protect catalase in PBS solution and not split by ultrasound Solution, protecting effect are better than propylgallate and 4- tert-butyl catechol.

Immunoregulation effect: astragalin is to enhance a kind of effective component of body immunity.You Lifen etc. studies table The astragalin (5 μ of μ g~0.05 g/mL) of bright debita spissitudo has significant facilitation to Human peripheral blood NK cells activity, Effect is strong and weak related with the immune level of body.The researchs such as Zhang Yindi discovery astragalin can fight cyclophosphamide (Cyclophosphamide)、⁶⁰Oligoleukocythemia and raising hydrocortisone (Hydr in peripheral blood caused by CO- gamma-rays DEG C ortisone) immunosuppressed mice peripheral blood lymphocytes, weight gain spleen and mouse is significantly improved by stress be as cold, high Endurance when temperature, anoxic.

Astragalin is mainly extracted to obtain crude extract by organic solvent from mulberry leaf, mesona etc. at present, then chromatographed by column, The methods of crystallization obtains sterling.But since comparision contents of the astragalin in plant are low, while containing there are many flavones in plant The disadvantages of class chemical composition is complicated, causes extraction cost excessively high, environmental pollution.Synthetic biology developed in recent years is The synthesis of natural products provides better solution.There are the route of synthesis of astragalin in plant, if it is possible to different Building astragalin in source efficiently synthesizes approach, will be expected to solve efficiently to obtain the technical bottleneck of astragalin.Induction biosynthesis is purple It is that glucose supplies with uridine diphosphate glucose (UDP-glucose) by glycosyl transferase that cloud English glycosides, which is using Kaempferol as substrate, Body synthesizes astragalin.Efficiently synthesizing for astragalin is realized in heterologous host, it is necessary first to which acquisition energy is efficient, specificity is urged Change the transglycosylase that Kaempferol generates astragalin；Next needs host can efficient provision UDP-glucose.

The present invention carries out the ability of 5 kinds of glycosyl transferases synthesis astragalin in arabidopsis, ginkgo, bacillus source To compare, screening obtains arabidopsis glycosyltransferase gene 78D2, which generates astragalin, with When Kaempferol is substrate, Km and Vmax are 0.3mM and 27U/mg.It is excellent according to Escherichia coli optimal codon to the enzyme gene Change, and has been practised in Escherichia coli high efficient expression using strong promoter.On the other hand, by strengthening UDP- in recombinant bacterium The route of synthesis of glucose realizes the efficient provision of UDP-glucose, further improves the yield of astragalin.Herein On the basis of, the zymotechnique of recombinant bacterium is optimized, the optimal conditions of fermentation that recombinant bacterium produces astragalin, purple cloud are obtained The yield of English glycosides reaches 2381mg/L, molar yield 95%.Post separation, vacuum drying are chromatographed by HPD400 macroreticular resin The astragalin highly finished product that purity is 97% are obtained, the yield of astragalin is 85%.

Summary of the invention

The technical issues of solution: the present invention provides one group of DNA molecular and its recombinant plasmid and recombination bacillus coli and its The application of astragalin is produced, the glycosyltransferase gene op78D2 of recombinant bacterium energy high efficient expression full genome optimization, which can be high Effect, specificity glycosylated in 3 hydroxyls of kaempferol；Simultaneously by strengthening the route of synthesis of recombinant bacterium UDP-glucose, Enable recombinant bacterium efficient provision UDP-glucose, releases the bottleneck of recombinant bacterium synthesis astragalin.Eventually by fermentation condition Optimization, realizes efficiently synthesizing for astragalin.

Technical solution: one group of DNA molecular, including optimized arabidopsis glycosyltransferase gene 78D2, saccharose phosphorylation Enzyme gene Basp, uridyltransferase gene ugpA and sucrose permease gene cscB, nucleic acid sequence is respectively such as SEQ ID Shown in NO:1, SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:6.

A pair of of recombinant plasmid containing above-mentioned DNA molecular, arabidopsis glycosyltransferase gene 78D2 are with pGEX-2T for load Body, construction recombination plasmid pGEX-op78D2 are expressed, saccharose phosphorylation enzyme gene Basp, uridyltransferase gene ugpA It is the construction recombination plasmid pACYCDuet-cscB-Basp- using pACYCDuet-1 as carrier with sucrose permease gene cscB UgpA is expressed.

The construction method of pGEX-op78D2 are as follows: according to SEQ ID NO:1 design primer, 78D2-1: CCCGGATCCATGACTAAACCGTCTGACCC and 78D2-2:CCCGAATTCTTAGATGATGTTAACCACCGC；With SEQ ID NO:1 is template, carries out PCR with the primer of synthesis, the condition of amplification is 95 DEG C, 5min；Time out adds Pyrobest to polymerize Enzyme adds 40 μ L paraffin oil seals；35 times circulation (94 DEG C, 50s；51 DEG C, 90s；72 DEG C, 1.2min)；72 DEG C, 10min；Reaction stops Only, 4 DEG C of heat preservations；Pcr amplification product is purified by gel reclaims kit, obtain glycosyltransferase gene op78D2 and PGEX-2T carries out double digestion with BamH I and EcoR I respectively, and is tapped and recovered respectively, and 16 DEG C of connections overnight, will even after concentration Object of practicing midwifery converts escherichia coli jm109 competent cell, and screening positive clone carries out sequence analysis；Select correct gram of sequence Grand extraction plasmid obtains recombinant plasmid pGEX-op78D2.

The construction method of pACYCDuet-cscB-Basp-UgpA are as follows: first round PCR, using the genome of E.coli W as mould Plate, with the primer cscB-12:CCACAAATCAAATCAGAAGAGTATTGCTAATGGCACTGAATATTCCAT T of synthesis and CscB-2:CCCCCTGCATTAGGCCGGTTGAGGGATATAGAGC carries out PCR, and the condition of amplification is 95 DEG C, 5min；Pause meter When, add Pyrobest polymerase, adds 40 μ L paraffin oil seals；35 times circulation (94 DEG C, 50s；51 DEG C, 90s；72 DEG C, 1.5min)； 72 DEG C, 10min；Reaction stops, and 4 DEG C of heat preservations purify pcr amplification product by gel reclaims kit；Second wheel PCR, using above-mentioned PCR fragment as template, with the primer cscB-11:CCCCCTGCATTAGGACCTATTGACAATTAAAG of synthesis GCTAAAATGCTATAATTCCACAAATCAAATCAGAAG and cscB-2:CCCCCTGCATTAGGCCGGTTGAGGGATATAG AGC carries out PCR, and the condition of amplification is 95 DEG C, 5min；Time out adds Pyrobest polymerase, adds 40 μ L paraffin oil seals； 35 times circulation (94 DEG C, 50s；51 DEG C, 90s；72 DEG C, 1.5min)；72 DEG C, 10min；Reaction stops, and 4 DEG C of heat preservations pass through gel QIAquick Gel Extraction Kit purifies pcr amplification product, obtains the cscB gene for carrying promoter；By the cscB gene of acquisition and PACYCDuet uses EcoN I digestion respectively, and is tapped and recovered, and connection product overnight, is converted large intestine bar by 16 DEG C of connections after concentration Bacterium JM109 competent cell, screening positive clone carry out sequence analysis；It selects sequence and correctly clones extraction plasmid, weighed Group plasmid pACYCDuet-cscB；

Using SEQ ID NO:7 as template, with the primer Basp-1:CCCCCATGGGCAAAAACAAAGTTCAG of synthesis and Basp-2:CCCGAATTCTTACGCAACAACTGGAGGATTG carries out PCR, obtains opBasp；By the opBasp gene of acquisition and PACYCDuet-cscB uses Nco I and EcoR I double digestion respectively, and is tapped and recovered, and 16 DEG C of connections overnight, will connect after concentration Product converts escherichia coli jm109 competent cell, and screening positive clone carries out sequence analysis；Sequence is selected correctly to clone Plasmid is extracted, recombinant plasmid pACYCDuet-cscB-Basp is obtained；

Using SEQ ID NO:8 as template, with the primer ugpA-1:CCCCATATGTTTGCGGAGGATCTGAAACG of synthesis PCR is carried out with ugpA-2:CCCGGTACCTTAAACCCAATCGCCCGGTTC, obtains opugpA；By the opugpA gene of acquisition It uses Nde I and Kpn I double digestion respectively with pACYCDuet-cscB-Basp, and is tapped and recovered, 16 DEG C of connections are stayed overnight after concentration, Connection product is converted into escherichia coli jm109 competent cell, screening positive clone carries out sequence analysis；It is correct to select sequence Clone extract plasmid, obtain recombinant plasmid pACYCDuet-cscB-Basp-UgpA.

Escherichia coli containing the recombinant plasmid, are made by following methods: by recombinant plasmid pGEX-op78D2 and recombination Plasmid pACYCDuet-cscB-Basp-UgpA cotransformation e. coli bl21 (DE3) obtains recombination bacillus coli.

Application of the above-mentioned Escherichia coli in conversion kaempferol production astragalin.

Above-mentioned application the specific steps are, by recombination bacillus coli with the inoculum concentration of volume ratio 1% be inoculated in addition ammonia benzyl In the LB culture medium of penicillin and chlorampenicol resistant, 37 DEG C of culture OD₆₀₀To 2.5, inducer IPTG to 0.05mM, sucrose are added To 0.5wt.%, kaempferol to 1600mg/L, 37 DEG C, 180rpm resting cell is for 24 hours.The yield of astragalin is 2381mg/ L, molar yield 95%.Above-mentioned conversion fluid is centrifuged, supernatant is taken, post separation is chromatographed by HPD400 macroreticular resin, is used 90% ethyl alcohol directly elutes, and vacuum drying obtains the astragalin highly finished product that purity is 97%, and the yield of astragalin is 85%.

The utility model has the advantages that glycosyl transferase energy efficient catalytic kaempferol contained by 1. recombinant bacteriums of the present invention generates purple cloud English glycosides, Km and Vmax are respectively 0.3mM and 27U/mg；

2. glycosyl transferase contained by recombinant bacterium of the present invention can specific 3 hydroxyls progress glycosyl in kaempferol Change；

3. recombinant bacterium energy efficient provision UDP-glucose of the present invention releases the bottle of recombinant bacterium synthesis astragalin Neck；

4. recombinant bacterium of the present invention can efficiently synthesize astragalin, astragalin yield reaches 2381mg/L, mole Conversion ratio is 95%, is the maximum output in current report；

5. the simple process of recombinant bacterium fermentation preparation astragalin of the present invention.

Detailed description of the invention

Fig. 1 is the schematic diagram that recombinant bacterium converts that kaempferol generates astragalin；CscB indicates that sucrose permease, Basp indicate Sucrose phosphorylase, ugpA indicate that uridyltransferase, 78D2 indicate that glycosyl transferase, Sucrose indicate sucrose, glucose 1-phosphate indicates that Cori's eater Cori, UDP-glucose indicate UDP-glucose.

Fig. 2 is the electrophoretogram of recombinant bacterium high efficient expression glycosyl transferase；M indicates protein standard substance, and 1 indicates 37 DEG C of inductions Recombinant bacterium BL21-OP78D2 whole-cell protein, 2 indicate the recombinant bacterium BL21-OP78D2 soluble protein of 37 DEG C of inductions, and 3 indicate The recombinant bacterium BL21-OP78D2 whole-cell protein of 30 DEG C of inductions, 4 indicate that the recombinant bacterium BL21-OP78D2 of 30 DEG C of inductions is soluble Albumen, 5 indicate the recombinant bacterium BL21-OP78D2 whole-cell protein of 20 DEG C of inductions, and 6 indicate the recombinant bacterium BL21- of 20 DEG C of inductions OP78D2 soluble protein, 7 indicate the recombinant protein 78D2 of purifying.

Fig. 3 is the zymologic property research schematic diagram for recombinating glycosyl transferase 78D2, and a indicates influence of the pH to enzyme activity, and b is indicated Influence of the temperature to enzyme activity.

Fig. 4 strengthens UDP-glucose supply to the influence diagram of recombinant bacterium synthesis astragalin；

Fig. 5 conversion condition produces the influence diagram of astragalin, influence of a conversion temperature to astragalin yield to recombinant bacterium；b Influence of the inducer IPTG concentration to astragalin yield；Influence of the c sucrose concentration to astragalin yield；D induction starting time pair The influence of astragalin yield.

The time plot of Fig. 6 recombinant bacterium production astragalin.

Specific embodiment

Below in conjunction with the embodiment of the present invention, technical scheme in the embodiment of the invention is clearly and completely described, Obviously, described embodiment is only a part of the embodiment of the present invention, instead of all the embodiments.Based on the reality in the present invention Example is applied, every other embodiment obtained by those of ordinary skill in the art without making creative efforts all belongs to In the scope of protection of the invention.

For a further understanding of the present invention, below with reference to embodiment, the present invention will be described in detail, wherein such as without special Illustrate, various reaction reagents involved in embodiment can be commercially available by commercial channel；Unless otherwise specified, embodiment Involved in concrete operations referring to " the Molecular Cloning:A Laboratory guide third edition ".

Embodiment 1

1. the screening of glycosyltransferase gene

The synthesis of 1.1 glycosyltransferase genes

To glycosyl transferase 78D2 (NP_197207.1), the 73B3 in the source arabidopsis (Arabidopsis thaliana) (NP_567953.1) and 78D1 (NP_564357.1) gene, the glycosyl transferase UFGT in the source ginkgo (Ginkgo biloba) (AEQ33588.2) glycosyl transferase BTGT (AGH18136.1) gene of gene and the source Bacillus sp.HH1500, according to E. coli k12 optimal codon table (http://www.kazusa.or.jp/codon/) carries out said gene sequence excellent Change, glycosyl of the codon for selecting amino acid synonym searching frequency high as optimal codon, after finally being optimized Transferase gene sequence information, is synthesized by Shanghai Jierui Biology Engineering Co., Ltd, the glycosyltransferase gene after being optimized Op78D2, op73B3, op78D1, opUFGT, opBTGT, nucleic acid sequence are respectively SEQ ID NO:1, SEQ ID NO:2, Shown in SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5.

The building of 1.2 recombinant plasmids

The building of recombinant plasmid pGEX-op78D2:

According to the gene order SEQ ID NO:1 design primer after optimization, primer is closed by Shanghai bioengineering Co., Ltd At.78D2-1:CCCGGATCCATGACTAAACCGTCTGACCC and 78D2-2: CCCGAATTCTTAGATGATGTTAACCACCGC.It is synthesized using the gene order SEQ ID NO:1 of optimum synthesis as template Primer carries out PCR, and the condition of amplification is 95 DEG C, 5min；Time out adds Pyrobest polymerase, adds 40 μ L paraffin oil seals； 35 times circulation (94 DEG C, 50s；51 DEG C, 90s；72 DEG C, 1.2min)；72 DEG C, 10min；Reaction stops, 4 DEG C of heat preservations.Pass through gel QIAquick Gel Extraction Kit purifies pcr amplification product.It obtains glycosyltransferase gene op78D2 and pGEX-2T and uses BamH I respectively Double digestion is carried out with EcoR I, and is tapped and recovered respectively, connection product overnight, is converted Escherichia coli by 16 DEG C of connections after concentration JM109 competent cell, screening positive clone carry out sequence analysis；It selects sequence and correctly clones extraction plasmid, recombinated Plasmid pGEX-op78D2.

The building of recombinant plasmid pGEX-op73B3:

According to the gene order SEQ ID NO:2 design primer after optimization, primer is closed by Shanghai bioengineering Co., Ltd At.73B3-1:CCCGGATCCATGAGCAGCGATCCGCATCG and 73B3-2: CCCGAATTCTTAGCTGGTGAACTCTTCAAT.It is synthesized using the gene order SEQ ID NO:2 of optimum synthesis as template Primer carries out PCR, and the condition of amplification is 95 DEG C, 5min；Time out adds Pyrobest polymerase, adds 40 μ L paraffin oil seals； 35 times circulation (94 DEG C, 50s；51 DEG C, 90s；72 DEG C, 1.5min)；72 DEG C, 10min；Reaction stops, 4 DEG C of heat preservations.Pass through gel QIAquick Gel Extraction Kit purifies pcr amplification product.It obtains glycosyltransferase gene op73B3 and pGEX-2T and uses BamH I respectively Double digestion is carried out with EcoR I, and is tapped and recovered respectively, connection product overnight, is converted Escherichia coli by 16 DEG C of connections after concentration JM109 competent cell, screening positive clone carry out sequence analysis；It selects sequence and correctly clones extraction plasmid, recombinated Plasmid pGEX-op73B3.

The building of recombinant plasmid pGEX-op78D1:

According to the gene order SEQ ID NO:3 design primer after optimization, primer is closed by Shanghai bioengineering Co., Ltd At.78D1-1:CCCGGATCCATGACCAAATTCAGCGAACC and 78D1-2: CCCGAATTCTTAAACTTTAACAATTTCAT.Drawn using the gene order SEQ ID NO:3 of optimum synthesis as what template synthesized Object carries out PCR, and the condition of amplification is 95 DEG C, 5min；Time out adds Pyrobest polymerase, adds 40 μ L paraffin oil seals；35 It is secondary circulation (94 DEG C, 50s；51 DEG C, 90s；72 DEG C, 1.5min)；72 DEG C, 10min；Reaction stops, 4 DEG C of heat preservations.It is returned by gel Kit is received to purify pcr amplification product.Obtain glycosyltransferase gene op78D1 and pGEX-2T use respectively BamH I and EcoR I carries out double digestion, and is tapped and recovered respectively, and connection product overnight, is converted Escherichia coli by 16 DEG C of connections after concentration JM109 competent cell, screening positive clone carry out sequence analysis；It selects sequence and correctly clones extraction plasmid, recombinated Plasmid pGEX-op78D1.

The building of recombinant plasmid pGEX-opUFGT:

According to the gene order SEQ ID NO:4 design primer after optimization, primer is closed by Shanghai bioengineering Co., Ltd At.UFGT-1:CCCGGATCCATGGAAAATGGTAATCGTAA and UFGT-2: CCCGAATTCTTATGCTGCTTCCATGCTAA.Drawn using the gene order SEQ ID NO:4 of optimum synthesis as what template synthesized Object carries out PCR, and the condition of amplification is 95 DEG C, 5min；Time out adds Pyrobest polymerase, adds 40 μ L paraffin oil seals；35 It is secondary circulation (94 DEG C, 50s；51 DEG C, 90s；72 DEG C, 1min)；72 DEG C, 10min；Reaction stops, 4 DEG C of heat preservations.It is recycled by gel Kit purifies pcr amplification product.Obtain glycosyltransferase gene opUFGT and pGEX-2T use respectively BamH I and EcoR I carries out double digestion, and is tapped and recovered respectively, and connection product overnight, is converted Escherichia coli by 16 DEG C of connections after concentration JM109 competent cell, screening positive clone carry out sequence analysis；It selects sequence and correctly clones extraction plasmid, recombinated Plasmid pGEX-opUFGT.

The building of recombinant plasmid pET-opBTGT:

According to the gene order SEQ ID NO:5 design primer after optimization, primer is closed by Shanghai bioengineering Co., Ltd At.BTGT-1:CCCCATATGGCAAATGTTCTGGTTAT and BTGT-2:CCCCTCGAGTTTAATTTTAACATACGGTT.With The gene order SEQ ID NO:xx of optimum synthesis is that the primer of template synthesis carries out PCR, and the condition of amplification is 95 DEG C, 5min；Time out adds Pyrobest polymerase, adds 40 μ L paraffin oil seals；35 times circulation (94 DEG C, 50s；51 DEG C, 90s；72 DEG C, 1min)；72 DEG C, 10min；Reaction stops, 4 DEG C of heat preservations.Pcr amplification product is purified by gel reclaims kit. It obtains glycosyltransferase gene opBTGT and pET-20b and carries out double digestion with Nde I and Xho I respectively, and be tapped and recovered respectively, Connection product overnight, is converted escherichia coli jm109 competent cell, screening positive clone carries out sequence by 16 DEG C of connections after concentration Column analysis；It selects sequence and correctly clones extraction plasmid, obtain recombinant plasmid pET-opBTGT.

1.3 glycosyltransferase genes convert the comparison that Kaempferol generates astragalin ability

Respectively by above-mentioned recombinant plasmid pGEX-op78D2, pGEX-op73B3, pGEX-op78D1, pGEX-opUFGT and PET-opBTGT converts e. coli bl21 (DE3) host strain (Novagen), respectively obtains recombinant bacterium BL21-OP78D2, BL21-OP73B3, BL21-OP78D1, BL21-OPUFGT and BL21-OPBTGT.Containing ampicillin (50 μ g/mL) By 37 DEG C of trainings on LB plate (LB culture medium: tryptone 10g/L, yeast extract 5g/L, NaCl 5g/L, agar 15g/L) It supports overnight, chooses transformant 37 DEG C of (50 μ g/mL ampicillin), 200rpm shaken cultivation to OD into the LB culture medium of 10mL₆₀₀ When being 0.6, the mountain of final concentration of 0.1mM isopropyl ss-D- Thiogalactopyranoside (IPTG) inducer and 0.5g/L is added How phenol, 20 DEG C conversion for 24 hours.The measurement of kaempferol and astragalin is measured using HPLC method, the condition of HPLC measurement are as follows: Agilent 1260Infinity；DAD detector Detection wavelength is 368nm, and column temperature is 40 DEG C, flow rate of mobile phase 0.8mL/ Min (A: methanol, B:1% formic acid water=55:45,15min).The result shows that the recombinant bacterium containing glycosyl transferase 78D2 gene turns Change ability is most strong (table 1).

The comparison of 1 separate sources glycosyl transferase conversion capability of table

2. the purifying of glycosyl transferase 78D2 and qualitative

The expression condition optimization of 2.1 glycosyl transferase 78D2

Recombinant plasmid pGEX-op78D2 is converted into e. coli bl21 (DE3) host strain (Novagen), is containing ammonia benzyl LB plate (the LB culture medium: tryptone 10g/L, yeast extract 5g/L, NaCl 5g/L, agar of penicillin (50 μ g/mL) Pass through 37 DEG C of overnight incubations on 15g/L), choose transformant 37 DEG C of (50 μ g/mL ampicillin) into the LB culture medium of 10mL, 200rpm shaken cultivation is to OD₆₀₀When being 0.6, final concentration of 0.1mM isopropyl ss-D- Thiogalactopyranoside (IPTG) is added Inducer, difference 20 DEG C of cultures 16h, 30 DEG C of cultures 10h, 37 DEG C of culture 6h, with high speed freezing centrifuge by culture solution at 4 DEG C Under, 15min is centrifuged with 13,000rpm, collects thallus, and detects the recombinant expression of glycosyl transferase 78D2 by protein electrophoresis. The result shows that 20 DEG C, 0.1mM IPTG induces the generation that can effectively reduce recombinant bacterium inclusion body, realizes that glycosyl transferase 78D2 can Dissolubility high efficient expression (Fig. 2).

The purifying of 2.2 glycosyl transferase 78D2

Recombinant plasmid pGEX-OP78D2 is converted into e. coli bl21 (DE3) host strain (Novagen), is containing ammonia benzyl Pass through 37 DEG C of overnight incubations on the LB plate of penicillin (50 μ g/mL), chooses transformant (50 μ g/mL into the LB culture medium of 200mL Ampicillin) 37 DEG C, 200rpm shaken cultivation to OD₆₀₀When being 0.6, the thio pyrrole of final concentration of 0.1mM isopropyl ss-D- is added Mutter galactoside (IPTG) inducer, 20 DEG C of Fiber differentiation 16h, with high speed freezing centrifuge by culture solution at 4 DEG C, with 13, 000rpm is centrifuged 15min, collects thallus.Due to containing glutathione GST label in recombinant plasmid pGEX-op78D2, pass through GST-Sefinose^TMKit (the raw work in Shanghai) is purified, the recombinase purified.Specific operation process:

A. the processing of sample

(1) it by washed thallus, is resuspended with 1 × Binding Buffer 20mL, supersonic wave wall breaking.

(2) after broken wall, 13,000g centrifugation 30min, taking supernatant is sample.

B. pillar is handled

(1) the sterile washing pillar of 10mL is used.

(2) pillar is washed with 1 × Binding Buffer of 10mL.

C. loading

(1) pillar, coutroi velocity 6 drop about per minute is added in sample.

(2) pillar is washed with 1 × Binding of 10mL Buffer, removes unbonded protein.

(3) pillar is washed with 5mL 1 × Eluting Buffer eluent, obtains target protein.

The Purity of the glycosyl transferase 78D2 purified by this process, the glycosyl transferase 78D2 of purifying use SDS-PAGE method carries out, as a result as shown in Figure 2.

3. the zymologic property research of glycosyl transferase 78D2

3.1 enzyme activity determination

100 μ L of reaction system, 10 μ L 500mmol/L trishydroxymethylaminomethanes-hydrochloric acid (Tris-HCl) buffer (pH 8.0), the UDP-glucose of 2 μ L 50mmol/L, the kaempferol of 10 μ L 2mmol/L add 10 first in 35 DEG C of incubation 5min μ L enzyme solution (being diluted to suitable multiple) reacts 10min, and 400 μ L methanol are added and terminate reaction, the survey of kaempferol and astragalin Surely it is measured using HPLC method, the condition of HPLC measurement are as follows: Agilent 1260Infinity；DAD detector Detection wavelength is 368nm, column temperature are 40 DEG C, and flow rate of mobile phase is 0.8mL/min (A: methanol, B:1% formic acid water=55:45,15min).Enzyme activity Unit of force (U) is defined as: under determination condition, generating enzyme amount used in 1 μm of ol astragalin per minute is 1 enzyme activity list Position.

3.2 optimal reactive temperature

Within the scope of 25-50 DEG C, every 5 DEG C, enzyme activity is measured respectively.Buffering is 50mmol/L Tris-HCl buffer, pH 8.0, the optimal reactive temperature of discovery glycosyl transferase 78D2 is 35 DEG C (Fig. 3).

3.3 optimal reaction pH

Under the conditions of different pH (7.0-9.5,50mmol/L Tris-HCl buffer), 35 DEG C measure enzyme activity respectively, hair The optimal reaction pH of existing glycosyl transferase 78D2 is 7.5 (Fig. 3).

3.4Km and Vmax

Under 8.0,35 DEG C of optimum conditions of pH, using the kaempferol of various concentration as substrate, enzyme activity is measured, then with double inverses It is 0.3mM to the Michaelis constant Km of kaempferol that graphing method, which obtains glycosyl transferase 78D2, and maximum reaction velocity Kmax is 27U/mg.

4. the building of recombinant plasmid pACYCDuet-cscB-Basp-UgpA

Sucrose permease gene (cscB, ADT76024.1) is the base by PCR from E. coli W It is obtained because being extended in group, and the genome of E.coli W is to buy to obtain from DSMZ Culture Collection Center (www.dsmz.de).It is logical Cross promoter and ribosome bind site that 2 wheel PCR make cscB upstream region of gene carry moderate strength, specific nucleic acid sequence information As shown in SEQ ID NO:6.First round PCR, using the genome of E.coli W as template, with the primer cscB-12:CCA of synthesis CAAATCAAATCAGAAGAGTATTGCTAATGGCACTGAATATTCCATT and cscB-2:CCCCCTGCATTAGGCCGGTTG AGGGATATAGAGC carries out PCR, and the condition of amplification is 95 DEG C, 5min；Time out adds Pyrobest polymerase, adds 40 μ L stones Wax oil sealing；35 times circulation (94 DEG C, 50s；51 DEG C, 90s；72 DEG C, 1.5min)；72 DEG C, 10min；Reaction stops, 4 DEG C of heat preservations. Pcr amplification product is purified by gel reclaims kit.Second wheel PCR, using above-mentioned PCR fragment as template, with synthesis Primer cscB-11:CCCCCTGCATTAGGACCTATTGACAATTAAAGGCTAAAATGCTATAAT TCCACAAATCAAAT CAGAAG and cscB-2:CCCCCTGCATTAGGCCGGTTGAGGGATATAGAGC carries out PCR, and the condition of amplification is 95 DEG C, 5min；Time out adds Pyrobest polymerase, adds 40 μ L paraffin oil seals；35 times circulation (94 DEG C, 50s；51 DEG C, 90s；72 DEG C, 1.5min)；72 DEG C, 10min；Reaction stops, 4 DEG C of heat preservations.Pcr amplification product is carried out by gel reclaims kit pure Change.Obtain the cscB gene for carrying promoter.The cscB gene and pACYCDuet of acquisition are used into EcoN I digestion respectively, and It is tapped and recovered, connection product overnight, is converted escherichia coli jm109 competent cell, the screening positive gram by 16 DEG C of connections after concentration It is grand, carry out sequence analysis；It selects sequence and correctly clones extraction plasmid, obtain recombinant plasmid pACYCDuet-cscB.

Sucrose phosphorylase gene (Basp, WP_011742626.1) gene source in Bifidobacterium adolescentis, according to e. coli k12 optimal codon table (http: // Www.kazusa.or.jp/codon/) said gene sequence is optimized, selects amino acid synonym searching frequency high Codon as optimal codon, gene sequence information after finally being optimized, by the limited public affairs of Shanghai JaRa bioengineering Department's synthesis, the gene opBasp after being optimized, nucleic acid sequence are SEQ ID NO:7.Using the sequence after optimizing as template, with The primer Basp-1:CCCCCATGGGCAAAAACAAAGTTCAG and Basp-2 of synthesis: CCCGAATTCTTACGCAACAACTGGAGGATTG carries out PCR, obtains opBasp.By the opBasp gene of acquisition and PACYCDuet-cscB uses Nco I and EcoR I double digestion respectively, and is tapped and recovered, and 16 DEG C of connections overnight, will connect after concentration Product converts escherichia coli jm109 competent cell, and screening positive clone carries out sequence analysis；Sequence is selected correctly to clone Plasmid is extracted, recombinant plasmid pACYCDuet-cscB-Basp is obtained.

UTP-glucose-1-phosphate uridylyltransferase gene(ugpA,YP_003971086.1) Gene source in Bifidobacterium bifidum, according to e. coli k12 optimal codon table (http: // Www.kazusa.or.jp/codon/) said gene sequence is optimized, selects amino acid synonym searching frequency high Codon as optimal codon, gene sequence information after finally being optimized, by the limited public affairs of Shanghai JaRa bioengineering Department's synthesis, the gene opugpA after being optimized, nucleic acid sequence are SEQ ID NO:8.Using the sequence after optimizing as template, with The primer ugpA-1:CCCCATATGTTTGCGGAGGATCTGAAACG and ugpA-2 of synthesis: CCCGGTACCTTAAACCCAATCGCCCGGTTC carries out PCR, obtains opugpA.By the opugpA gene of acquisition and PACYCDuet-cscB-Basp uses Nde I and Kpn I double digestion respectively, and is tapped and recovered, and 16 DEG C of connections overnight, will after concentration Connection product converts escherichia coli jm109 competent cell, and screening positive clone carries out sequence analysis；It is correct to select sequence Clone extracts plasmid, obtains recombinant plasmid pACYCDuet-cscB-Basp-UgpA.

5. the acquisition of recombinant bacterium BL21-II

By recombinant plasmid pGEX-op78D2 and recombinant plasmid pACYCDuet-cscB-Basp-UgpA cotransformation Escherichia coli BL21 (DE3) host strain (Novagen), in the LB plate for containing ampicillin (50 μ g/mL) and chloramphenicol (40 μ g/mL) It was cultivated on (LB culture medium: tryptone 10g/L, yeast extract 5g/L, NaCl 5g/L, agar 15g/L) by 37 DEG C Night obtains recombinant bacterium BL21-II.

6. recombinant bacterium (BL21-OP78D2) and recombinant bacterium (BL21-II) conversion capability compare

Recombinant bacterium (BL21-OP78D2) and recombinant bacterium (BL21-II) are inoculated in addition with 1% inoculum concentration of volume ratio respectively In the LB culture medium of suitable resistance, 37 DEG C of culture OD₆₀₀To 0.8,1% sucrose, 0.1mM IPTG, kaempferol to 0.5g/ are added L, 20 DEG C, 180rpm resting cell for 24 hours, measures conversion ratio respectively, as a result, it has been found that recombinant bacterium (BL21-II) is recombinant bacterium (BL21-OP78D2) 2 times of yield, as shown in Figure 4.

7. the optimization of conversion condition

7.1 conversion temperatures generate the influence of astragalin to recombinant bacterium (BL21-II) conversion kaempferol

Recombinant bacterium is inoculated in LB culture medium with 1% inoculum concentration of volume ratio, 37 DEG C of culture OD₆₀₀To 0.8, addition is induced Agent IPTG is 0.1mM, and kaempferol to 1600mg/L, sucrose concentration 1%, conversion temperature is respectively 20,30,37,40,45 and 50 DEG C, 180rpm resting cell for 24 hours, measures the yield of astragalin respectively, as a result, it has been found that when conversion temperature is 37 DEG C, Chinese milk vetch The yield highest of glycosides, as shown in Figure 5 a.

7.2IPTG dosage generates the influence of astragalin to recombinant bacterium (BL21-II) conversion kaempferol

Recombinant bacterium is inoculated in LB culture medium with 1% inoculum concentration of volume ratio, 37 DEG C of culture OD₆₀₀To 0.8, addition is induced Agent IPTG is respectively 0,0.05,0.1,0.2,0.4 and 0.8mM, kaempferol to 1600mg/L, sucrose concentration 1%, and 37 DEG C, 180rpm resting cell for 24 hours, measures the yield of astragalin respectively, as a result, it has been found that when addition 0.05mM IPTG, astragalin Yield highest, as shown in Figure 5 b.

7.3 sucrose concentrations generate the influence of astragalin to recombinant bacterium (BL21-II) conversion kaempferol

Recombinant bacterium is inoculated in LB culture medium with 1% inoculum concentration of volume ratio, 37 DEG C of culture OD₆₀₀To 0.8, addition is induced Agent IPTG is 0.05mM, and kaempferol to 1600mg/L, sucrose concentration is respectively 0,0.1,0.5,1,2 and 4%, 37 DEG C, 180rpm Resting cell for 24 hours, measures the yield of astragalin respectively, as a result, it has been found that the yield of astragalin is most when 0.5% sucrose of addition Height, as shown in Figure 5 c.

7.5 induction starting times generate the influence of astragalin to recombinant bacterium (BL21-II) conversion kaempferol

Recombinant bacterium is inoculated in LB culture medium with 1% inoculum concentration of volume ratio, 37 DEG C of culture OD₆₀₀To 0.4,0.8,1.5, 2.5 and 3, adding inducer IPTG respectively is 0.05mM, kaempferol to 1600mg/L, sucrose concentration 0.5%, conversion temperature point Wei not be 37 DEG C, 180rpm resting cell for 24 hours, measures the yield of astragalin, as a result, it has been found that OD respectively₆₀₀It is induction to 2.5, The yield highest of astragalin, as fig 5d.

8. the preparation of astragalin

Recombinant bacterium (BL21-II) is inoculated in the LB culture medium of 500mL with 1% inoculum concentration of volume ratio, 37 DEG C of cultures OD₆₀₀When to 2.5 or so, addition inducer IPTG is 0.05mM, kaempferol to 1600mg/L, sucrose concentration 0.5%, conversion Temperature is respectively 37 DEG C, and for 24 hours, astragalin is measured by sampling 0,2,4,8,12 respectively after induction in 180rpm resting cell for 24 hours Yield, for 24 hours after astragalin yield be 2381mg/L, molar yield 95%.The time graph that astragalin generates As shown in Figure 6.

By the sample after converting 24 hours, supernatant, by the direct upper prop of the supernatant of acquisition, chromatographic column are collected in 6000g centrifugation Filler is HPD400 macroreticular resin (diameter 5cm, column length 30cm), and chromatographic column deionized water balance after completion of the sample, is used The deionization of 15 times of volumes washes chromatographic column, is then eluted with 90% ethyl alcohol, the sample of acquisition is dried in vacuo to obtain purity For 97% astragalin highly finished product, the yield of astragalin is 85%.

SEQUENCE LISTING

<110>Nanjing Forestry University

<120>one groups of DNA moleculars and its recombinant plasmid and recombination bacillus coli and its application for producing astragalin

<130>

<160> 25

<170> PatentIn version 3.3

<210> 1

<211> 1383

<212> DNA

<213>artificial sequence

<400> 1

atgactaaac cgtctgaccc gacccgcgac tctcacgttg cagttctggc tttcccgttc 60

ggcacccacg cagctccgct gctgaccgtt acccgccgtc tggcgtctgc gtctccgtct 120

accgtgttct ctttcttcaa caccgcgcag tctaactctt ctctgttttc cagcggtgac 180

gaggcggatc gtccggctaa catccgcgtg tatgacatcg ctgacggcgt gccggagggt 240

tacgttttct ctggtcgccc gcaggaagcg attgaactgt ttctgcaggc tgcgccggag 300

aactttcgtc gtgaaatcgc gaaagcggaa actgaagttg gcaccgaggt taagtgtctg 360

atgaccgacg ctttcttttg gtttgctgcg gacatggcaa ctgagatcaa cgcttcttgg 420

atcgcgtttt ggactgctgg cgcaaactct ctgtctgcgc acctgtacac tgacctgatt 480

cgcgagacta tcggcgttaa agaggtgggt gaacgtatgg aggagaccat tggtgttatc 540

agcggcatgg agaaaatccg tgttaaggac accccggaag gtgttgtttt cggtaacctg 600

gactctgtgt tttctaaaat gctgcatcag atgggtctgg cactgccgcg tgcgaccgca 660

gtgtttatca actctttcga agatctggac ccgaccctga ccaacaacct gcgctctcgt 720

ttcaaacgtt acctgaacat cggtccgctg ggcctgctgt cctccaccct gcagcagctg 780

gttcaggacc cgcatggttg cctggcgtgg atggaaaaac gctcttccgg ttctgttgcg 840

tacatctcct ttggtaccgt tatgactccg ccgccgggtg agctggcggc gattgcggaa 900

ggcctggagt cttctaaagt gccgttcgtg tggtctctga aggaaaagag cctggttcag 960

ctgccgaagg gctttctgga ccgtacccgt gagcagggta tcgttgtgcc gtgggcaccg 1020

caggtggaac tgctgaaaca cgaagcgacc ggcgtgtttg tgacccactg tggctggaac 1080

agcgttctgg aatctgtttc cggtggtgtg ccgatgatct gccgtccgtt cttcggtgat 1140

cagcgtctga acggtcgtgc ggttgaggtg gtttgggaaa tcggtatgac catcattaac 1200

ggtgtgttca ctaaagatgg tttcgagaaa tgtctggaca aggttctggt gcaggatgat 1260

ggcaagaaaa tgaagtgcaa cgcgaaaaag ctgaaagaac tggcatacga ggcagtttct 1320

agcaaaggtc gttcctctga aaacttccgc ggtctgctgg acgcggtggt taacatcatc 1380

taa 1383

<210> 2

<211> 1446

<212> DNA

<213>artificial sequence

<400> 2

atgagcagcg atccgcatcg taaactgcat gttgttttct ttccgtttat ggcatacggt 60

cacatgattc cgaccctgga tatggcaaaa ctgtttagca gccgtggtgc aaaaagcacc 120

attctgacca ccccgctgaa tagcaaaatt tttcagaaac cgattgaacg ctttaaaaat 180

ctgaatccga gctttgaaat tgatattcag atttttgatt ttccgtgtgt tgatctgggt 240

ctgccggaag gttgtgaaaa tgttgatttc tttaccagca acaacaacga tgatcgtcag 300

tatctgaccc tgaaattctt caaaagcacc cgctttttca aagatcagct ggaaaaactg 360

ctggaaacca cccgcccgga ttgtctgatt gcagatatgt tcttcccgtg ggcaaccgaa 420

gcagcagaaa aattcaatgt tccgcgcctg gtttttcatg gcaccggtta ttttagcctg 480

tgtagcgaat attgtattcg cgttcataat ccgcagaata ttgttgcaag ccgctatgaa 540

ccgtttgtta ttccggatct gccgggtaat attgttatta cccaggaaca gattgcagat 600

cgtgatgaag aaagcgaaat gggcaaattc atgattgaag ttaaagaaag cgatgttaaa 660

agcagcggtg ttattgttaa tagcttttat gaactggaac cggattatgc agatttttac 720

aaaagcgttg ttctgaaacg cgcatggcat attggtccgc tgagcgttta taatcgcggt 780

tttgaagaaa aagcagaacg cggcaaaaaa gcaagcatta acgaagttga atgtctgaaa 840

tggctggata gcaaaaaacc ggatagcgtt atatacatta gctttggtag cgttgcatgt 900

tttaaaaacg aacagctgtt tgaaattgca gcaggtctgg aaaccagcgg tgcaaatttt 960

atttgggttg ttagaaagaa tattggtatt gaaaaagaag aatggctgcc ggaaggtttt 1020

gaagaacgag ttaaaggtaa aggtatgatt attcgcggtt gggcaccgca ggttctgatt 1080

ctggatcatc aggcaacctg tggttttgtt acccattgtg gttggaatag cctgctggaa 1140

ggtgttgcag caggtctgcc gatggttacc tggccggttg cagcagaaca gttttataat 1200

gagaaactgg ttacccaggt tctgcgcacc ggtgttagcg ttggtgctaa gaagaatgtt 1260

cgtaccaccg gggactttat tagccgcgaa aaagttgtta aagcagttcg cgaagttctg 1320

gttggtgaag aagcagatga acgtcgcgaa cgtgcgaaga aactggcaga aatggcaaaa 1380

gcagcagttg aaggtggtag cagctttaat gatctgaata gctttattga agagttcacc 1440

agctaa 1446

<210> 3

<211> 1362

<212> DNA

<213>artificial sequence

<400> 3

atgaccaaat tcagcgaacc gattcgtgat agccatgttg cagttctggc atttttcccg 60

gttggtgcac atgcaggtcc gctgctggca gttacccgtc gcctggcagc agcaagcccg 120

agcaccattt ttagcttttt caataccgcg cgctcaaatg caagcctgtt tagcagcgat 180

catccggaaa atattaaagt tcatgatgtt agcgatggtg ttccggaagg gacaatgctg 240

ggtaatccgc tggaaatggt tgaactgttt ctggaagcag caccgcgtat ttttcgtagc 300

gaaattgcag cagcagaaat tgaagttgga aagaaagtta cctgtatgct gaccgatgca 360

ttcttctggt ttgcagcaga tattgcagca gaactgaatg caacctgggt tgcattttgg 420

gcaggtggtg caaatagcct gtgtgcacat ctgtataccg atctgattcg cgaaaccatt 480

ggtctgaaag atgttagcat ggaagaaacc ctgggtttta ttccgggtat ggaaaattat 540

cgcgttaaag atattccgga agaagttgtt tttgaggatc tggatagcgt ttttccgaaa 600

gcactgtatc agatgagcct ggcactgccg cgcgcaagcg cagtttttat tagcagcttt 660

gaagaactgg aaccgaccct gaattataat ctgcgtagca aactgaaacg ctttctgaat 720

attgcaccgc tgaccctgct gagcagcacc agcgaaaaag aaatgcgtga tccgcatggt 780

tgttttgcat ggatgggtaa acgtagcgca gcaagcgttg catatattag ctttgggacg 840

gttatggaac cgccgccgga agaactggtt gcaattgcac agggtctgga aagcagcaaa 900

gttccgtttg tttggagcct gaaagaaaag aacatggttc atctgccgaa aggttttctg 960

gatcgtaccc gcgaacaggg tattgttgtt ccgtgggcac cgcaggttga actgctgaaa 1020

catgaagcaa tgggtgttaa tgttacccat tgtggttgga atagcgttct ggaaagcgtt 1080

agcgcaggtg ttccgatgat tggtcgcccg attctggcag ataatcgtct gaatggtcgc 1140

gcagttgaag ttgtttggaa agttggtgtt atgatggata atggtgtttt taccaaagaa 1200

ggttttgaaa aatgtctgaa tgatgttttt gttcatgatg atggcaaaac catgaaagca 1260

aatgcgaaaa agctgaaaga aaaactgcaa gaagatttta gcatgaaagg tagcagcctg 1320

gaaaatttta aaattctgct ggatgaaatt gttaaagttt aa 1362

<210> 4

<211> 1491

<212> DNA

<213>artificial sequence

<400> 4

atggaaaatg gtaatcgtaa agaactgctg catcatgttc tgatgtttcc gtggctggca 60

catggtcata ttagcccgtt tctggaactg tcaatgcgtc tggcaggtcg cggtattacc 120

gttagctttt gtagcacccc gagcaatatt aatagcatta aacgtacctt acaaagccat 180

gatgatggtg aaaccgcact gaatagcatt aatctggttg aactgccgct gccgctggtt 240

gatggtctgg gtccgagcca tgaaaccacc gcaagcctgc cgccgcatct gatgccgctg 300

ctgaaaaaag catttgatag cctggaaacc agctttggta tgctgctaca gcgcctgagc 360

ccggattgtg ttattcatga ttttctccag ccgtggacca gcccggttgc aagcaaattt 420

ggtattccga gcctgacctt tgttccgtgt agcgcagttg ttgttgcata ttttctgtgt 480

gcagttaaag gtaaagatag cgaacaggtt accgttgagg atctgattaa tccgctggat 540

tttccgagca gcagcaccgt tcgcctgcat cagtttgaag cattacagac cctgaatatg 600

tacaaacgta atcgcgaaac cggtattagc gattgtgaac gcttgcaggg ttgtgcaaac 660

aaatgtagcg caattgcagt taaaaccttt ccggaaattg aaggtaaatt tctgcgcctg 720

ctggaaagcc tgaccggtaa acatgttgtt gcactgggtc cgctgctgac caaacagccg 780

agcagcaatg caagcgaaca ggatagcaaa tgtctggcat ggctggatcg tcagaaacgt 840

agcagcgttg tttttgttag ctttgggact gaatattttc tgagcaaaga tcagattgaa 900

gaaattgcac tgggtctgga agcaagcgaa cagagcttta tgtgggttct gcgctttccg 960

cagggtccgg aaggtaatgt taatgatcag cagcgtcgcg ttagcgcaag cctgagcgca 1020

ggttttgaag aacgtatgaa agttaaaggt attgttgtta gcggttgggc accgcagatg 1080

aaaattctgc gtcatccgag caccggtggt tttatgaccc attgtggttg gagcagcgtt 1140

atggaaggta tgagcgcagg tctgccgctg attgcactgc cgatgcagct ggatcagccg 1200

ctgaatgcac gcctggttgc aggcgacctg aaagttgcaa ttgaagttcg taaaggtagc 1260

gatggtcgcc tggatcgtaa cgagattgaa cgcgcactgc gcattgcaat ggttgaagaa 1320

gaaggtttgc aactgcgtat gaatgcaaaa cacatgggtg aaattatgat ggcaaaaagc 1380

gaagaagaac gcggtctgga tctgctggtt gaagaaattg aaaccctggt tggtaaacgt 1440

aataacgttt ttcgtcgcga tagcaatatt attagcatgg aagcagcata a 1491

<210> 5

<211> 1209

<212> DNA

<213>artificial sequence

<400> 5

atggcaaatg ttctggttat taattttccg ggtgaaggtc atattaatcc gaccctggca 60

attgttagcg aactgattca gcgcggtgaa accgttgtta gctattgtat tgaagattat 120

cgaaagaagg ttgaagcaac cggtgcagaa tttcgcgttt ttgaaaattt tctgagccag 180

attaatatta tggaaagggt taacgagggt ggtagcccgc tgatgatgct gagccacatg 240

attgaagcaa gcgaacgcat tgttacccag attgttgaag aaaccaaaga agaaaaatat 300

gattatctga tatacgataa tcattttccg gttggtcgca ttattgcaaa tattcttcag 360

ctgccgagcg ttagcagctg taccaccttt gcagttaatc agtatattaa ttttcatgat 420

ggtcaggaaa gccgtcaggt tgatgaaatt aatccgctgt atcagagctg tctggcaggt 480

atggaacgct ggaacaaaca ttatggtatg aaatgtaata gcatgtatga tattatgaat 540

catccggggg acattaccat tgtttatacc agcaaagaat atcagccgcg tagcgatctg 600

tatgatgaaa gctacaaatt tgttggtccg agcattgcaa cccgtaaaga agttggtagc 660

tttccgaccg aggatctgaa aaatgagaaa gttattttta ttagcatggg gactgttttt 720

aacgagcagc cggcactgta tgaaaaatgt tttgaagcgt tcaaagatgt tgatgcaacc 780

gttgttctgg ttgttggaaa aaagatcaat accagccagt ttgaaaatat tccgaaaaat 840

tttaaactgt ataattatgt tccgcagctg gaagttctgc aacacgcaga tgtttttgtt 900

acacacggtg gtatgaatag cagcagcgaa gcactgtatt atggtgttcc gctggttgtt 960

attccggtta ccggggacca gccgtttgtt gcaaaacgcc tgaccgaagt tggtgcaggt 1020

attaccctga atcgcaacga gctgaccagc gaactgctgc gcgaaaccgt taaaaaagtt 1080

atggatgatg ttacctttaa agaaaatagc cgtaaagttg gtgaaagcct gcgcaatgca 1140

ggtggttatc agcgtgcagt tgaagaaatt tttgaactga agatgaaacc gtatgttaaa 1200

attaaataa 1209

<210> 6

<211> 1361

<212> DNA

<213>artificial sequence

<400> 6

acctattgac aattaaaggc taaaatgcta taattccaca aatcaaatca gaagagtatt 60

gctaatggca ctgaatattc cattcagaaa tgcgtactat cgttttgcat ccagttactc 120

atttctcttt tttatttcct ggtcgctgtg gtggtcgtta tacgctattt ggctgaaagg 180

acatctaggg ttgacaggga cggaattagg tacactttat tcggtcaacc agtttaccag 240

cattctattt atgatgttct acggcatcgt tcaggataaa ctcggtctga agaaaccgct 300

catctggtgt atgagtttca tcctggtctt gaccggaccg tttatgattt acgtttatga 360

accgttactg caaagcaatt tttctgtagg tctaattctg ggggcgctat tttttggctt 420

ggggtatctg gcgggatgcg gtttgcttga tagcttcacc gaaaaaatgg cgcgaaattt 480

tcatttcgaa tatggaacag cgcgcgcctg gggatctttt ggctatgcta ttggcgcgtt 540

ctttgccggc atatttttta gtatcagtcc ccatatcaac ttctggttgg tctcgctatt 600

tggcgctgta tttatgatga tcaacatgcg ttttaaagat aaggatcacc agtgcgtagc 660

ggcagatgcg ggaggggtaa aaaaagagga ttttatcgca gttttcaagg atcgaaactt 720

ctgggttttc gtcatattta ttgtggggac gtggtctttc tataacattt ttgatcaaca 780

actttttcct gtcttttatt caggtttatt cgaatcacac gatgtaggaa cgcgcctgta 840

tggttatctc aactcattcc aggtggtact cgaagcgctg tgcatggcga ttattccttt 900

ctttgtgaat cgggtagggc caaaaaatgc attacttatc ggagttgtga ttatggcgtt 960

gcgtatcctt tcctgcgcgc tgttcgttaa cccctggatt atttcattag tgaagttgtt 1020

acatgccatt gaggttccac tttgtgtcat atccgtcttc aaatacagcg tggcaaactt 1080

tgataagcgc ctgtcgtcga cgatctttct gattggtttt caaattgcca gttcgcttgg 1140

gattgtgctg ctttcaacgc cgactgggat actctttgac cacgcaggct accagacagt 1200

tttcttcgca atttcgggta ttgtctgcct gatgttgcta tttggcattt tcttcttgag 1260

taaaaaacgc gagcaaatag ttatggaaac gcctgtacct tcagcaatat agacgtaaac 1320

tttttccggt tgttgtcgat agctctatat ccctcaaccg g 1361

<210> 7

<211> 1518

<212> DNA

<213>artificial sequence

<400> 7

atgggcaaaa acaaagttca gttaatcact tatgcggatc gcttaggcga tgggacgatc 60

aaatctatga cggatattct gcgcacccgc tttgatggcg tgtatgatgg tgtgcatatc 120

ctgccgttct ttacaccgtt tgatggcgca gatgcgggct ttgatcctat cgatcatacc 180

aaagtggatg aacgcttagg ctcttgggat gatgttgcgg aactgagcaa aacacataat 240

atcatggttg atgcgattgt gaatcacatg tcttgggaat ctaaacagtt tcaggatgtg 300

ctggccaaag gtgaagaaag cgaatattat cctatgtttc tgacaatgtc aagcgtgttt 360

ccgaatggtg ctaccgaaga ggacctcgcc ggcatctatc gtccacgtcc gggcttaccg 420

tttacacatt acaagtttgc gggaaaaaca cgtctggttt gggtgagctt taccccacag 480

caggtggaca tagatacaga ttcagataaa ggttgggaat acctcatgtc tatctttgat 540

cagatggccg ctagtcatgt gagctatatt cgcttagatg cagttggcta tggtgccaaa 600

gaagccggca cctcttgctt tatgacacct aaaaccttta aattaatctc tcgcctgcgc 660

gaagaaggcg ttaaacgcgg cttagaaatc ctgattgaag tgcatagcta ttataagaaa 720

caggttgaaa ttgctagtaa agtggatcgc gtgtatgatt ttgctctgcc tccactgctg 780

ttacatgcac tgagtacggg tcatgtggaa ccagtggccc attggacgga tattcgtccg 840

aacaatgctg tgaccgtgtt agatacccat gatggcatcg gtgttatcga tataggtagc 900

gatcagctgg atcgctcact gaaaggcctg gttccagatg aagatgtgga taatttggtg 960

aataccatcc atgccaatac acatggcgaa agtcaggccg caacgggtgc agcagcgagt 1020

aatctcgatc tgtatcaggt taattcaacg tattatagtg cactgggctg taatgatcag 1080

cattatattg cagctcgcgc cgttcagttt ttcctgccag gcgttccgca ggtgtattat 1140

gtgggcgcct tagccggcaa aaatgatatg gaactgttac gcaaaaccaa taacggtcgc 1200

gacataaatc gtcattatta tagtacggca gaaatcgatg aaaatctgaa acgcccggtt 1260

gttaaagccc tgaatgcctt agccaaattt cgtaatgagc tggatgcctt tgatggtaca 1320

ttttcttata cgaccgatga tgatacgagc atcagtttca cttggcgcgg cgaaacctca 1380

caggcaaccc tgacctttga acctaaacgc ggtctgggcg tggataatac gaccccggtt 1440

gccatgctgg aatgggaaga ttcagcgggc gatcatcgta gcgatgatct aattgccaat 1500

cctccagttg ttgcgtaa 1518

<210> 8

<211> 1467

<212> DNA

<213>artificial sequence

<400> 8

atgtttgcgg aggatctgaa acgcaccgaa aaaatgaccg tggatgatgt gtttgaacag 60

agcgcccaga aaatgcgcga acagggtatg agcgaaattg caatctcaca gtttcgtcat 120

gcatatcatg tgtgggcaag tgaaaaagaa agtgcttgga ttcgcgaaga tgcagtggaa 180

ccactgcatg gcgttcgctc ttttcatgat gtgtataaga ccattgatca tgataaagcg 240

gttcatgcct ttgccaaaac cgcctttctg aaactgaatg gtggcctggg tacatctatg 300

ggcctccagt gtgccaaatc actgttacca gttcgtcgtc ataaagcacg tcagatgcgt 360

tttctggata ttatcttagg tcaggtgctg acagctcgta cacgcctgaa tgttccactg 420

ccggtgactt tcatgaactc ttttcgtaca agcgatgata ctatgaaagc cttacgtcat 480

cagcgcaaat tcaaacagac ggacatcccg ttagaaatca ttcagcatca ggaacctaaa 540

atcgatgctg ctacgggcgc cccagcctct tggccggcta atccagacct ggaatggtgt 600

cctccgggtc atggtgacct gtttagtacc ctgtgggaaa gcggcttact ggatacctta 660

ctggaacatg gctttgaata tctgtttatt agtaatagtg ataatctggg cgctcgtccg 720

agtcgcacat tagcacagta ttttgaagat acaggtgctc cttttatggt ggaagttgct 780

aatcgcacct atgcggatcg taaaggcggc catattgtgc gtgatacggc aacgggtcgc 840

ttaatcttac gcgaaatgtc tcaggtgcat ccggatgata aagatgcggc acaggatatt 900

gccaaacatc cgtattttaa taccaacaac atctgggttc gcatcgatgt gttaagggtt 960

atgctggcag aacatgatgg cgtgctgcca ttaccagtta ttatcaacaa caaaacggtt 1020

gatccgaccg atcctcagag tccagccgtt gtgcagctgg aaacggctat gggcgccgca 1080

atcggtctgt ttgaaggcgc catttgcgtg caggttgata gaatgcgttt tctgccggtt 1140

aaaacgacga atgatctgtt tatcatgcgt agcgatcgct ttcatctgac cgatagctat 1200

gagatggaag atggtaatta tatctttcca aatgtggact tagacccacg ctattacaag 1260

aatatcgaag attttaacga acgctttccg tataatgttc ctagcttagc agccgccaat 1320

tcagtgagca tcaaaggcga ttggaccttt ggtcgcgatg tgattatgtt tgccgatgcc 1380

cgcttagaag atcgcaacga gccgagctat gttcctaatg gcgaatatgt tggtcctatg 1440

ggtatcgaac cgggcgattg ggtttaa 1467

<210> 9

<211> 29

<212> DNA

<213>artificial sequence

<400> 9

cccggatcca tgactaaacc gtctgaccc 29

<210> 10

<211> 30

<212> DNA

<213>artificial sequence

<400> 10

cccgaattct tagatgatgt taaccaccgc 30

<210> 11

<211> 49

<212> DNA

<213>artificial sequence

<400> 11

ccacaaatca aatcagaaga gtattgctaa tggcactgaa tattccatt 49

<210> 12

<211> 34

<212> DNA

<213>artificial sequence

<400> 12

ccccctgcat taggccggtt gagggatata gagc 34

<210> 13

<211> 68

<212> DNA

<213>artificial sequence

<400> 13

ccccctgcat taggacctat tgacaattaa aggctaaaat gctataattc cacaaatcaa 60

atcagaag 68

<210> 14

<211> 26

<212> DNA

<213>artificial sequence

<400> 14

cccccatggg caaaaacaaa gttcag 26

<210> 15

<211> 31

<212> DNA

<213>artificial sequence

<400> 15

cccgaattct tacgcaacaa ctggaggatt g 31

<210> 16

<211> 29

<212> DNA

<213>artificial sequence

<400> 16

ccccatatgt ttgcggagga tctgaaacg 29

<210> 17

<211> 30

<212> DNA

<213>artificial sequence

<400> 17

cccggtacct taaacccaat cgcccggttc 30

<210> 18

<211> 29

<212> DNA

<213>artificial sequence

<400> 18

cccggatcca tgagcagcga tccgcatcg 29

<210> 19

<211> 30

<212> DNA

<213>artificial sequence

<400> 19

cccgaattct tagctggtga actcttcaat 30

<210> 20

<211> 29

<212> DNA

<213>artificial sequence

<400> 20

cccggatcca tgaccaaatt cagcgaacc 29

<210> 21

<211> 29

<212> DNA

<213>artificial sequence

<400> 21

cccgaattct taaactttaa caatttcat 29

<210> 22

<211> 29

<212> DNA

<213>artificial sequence

<400> 22

cccggatcca tggaaaatgg taatcgtaa 29

<210> 23

<211> 29

<212> DNA

<213>artificial sequence

<400> 23

cccgaattct tatgctgctt ccatgctaa 29

<210> 24

<211> 26

<212> DNA

<213>artificial sequence

<400> 24

ccccatatgg caaatgttct ggttat 26

<210> 25

<211> 29

<212> DNA

<213>artificial sequence

<400> 25

cccctcgagt ttaattttaa catacggtt 29

Claims

1. the Escherichia coli containing recombinant plasmid, it is characterised in that be made by following methods: by recombinant plasmid pGEX-op78D2 and Recombinant plasmid pACYCDuet-cscB-Basp-UgpA cotransformation e. coli bl21 (DE3) obtains recombination bacillus coli；It is described Recombinant plasmid pGEX-op78D2 is arabidopsis glycosyltransferase gene shown in SEQ ID NO:178D2Using pGEX-2T as carrier It is built-up；The recombinant plasmid pACYCDuet-cscB-Basp-UgpA is SEQ ID NO:7, SEQ ID NO:8 and SEQ Saccharose phosphorylation enzyme gene shown in ID NO:6Basp, uridyltransferase geneugpAWith sucrose permease genecscBWith PACYCDuet-1 forms for vector construction.

2. application of the Escherichia coli described in claim 1 in conversion kaempferol production astragalin.

3. application according to claim 2, it is characterised in that recombination bacillus coli to be inoculated with the inoculum concentration of volume ratio 1% In the LB culture medium of addition ampicillin and chlorampenicol resistant, 37 DEG C of culture OD₆₀₀To 2.5, addition inducer IPTG is extremely 0.05 mM, sucrose to 0.5wt.%, kaempferol to 1600 mg/L, 37 DEG C, 180 rpm resting cell, 24 h.