CN106086043A - Capripox virus restructuring P32 gene and structure and the application in preparing vaccine - Google Patents
Capripox virus restructuring P32 gene and structure and the application in preparing vaccine Download PDFInfo
- Publication number
- CN106086043A CN106086043A CN201610562276.8A CN201610562276A CN106086043A CN 106086043 A CN106086043 A CN 106086043A CN 201610562276 A CN201610562276 A CN 201610562276A CN 106086043 A CN106086043 A CN 106086043A
- Authority
- CN
- China
- Prior art keywords
- pvax1
- sheep pox
- gene
- preparation
- recombinations
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24211—Parapoxvirus, e.g. Orf virus
- C12N2710/24222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/24011—Poxviridae
- C12N2710/24211—Parapoxvirus, e.g. Orf virus
- C12N2710/24234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Epidemiology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Pharmacology & Pharmacy (AREA)
- Virology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Crystallography & Structural Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The open a kind of capripox virus restructuring of the present inventionP32Gene and structure and the application in preparing vaccine, by transformation capripox virusP32 gene orders, gene order size is 777 bp, it is 98.32% with original series concordance, compared to original series, inserts 3 bp bases at 102 ~ 103 interdigits, amino acid number is 259, compared with original series, between 36 ~ 37, insert N aminoacid, but overall amino acid order does not change, isoelectric point, IP pI:9.10, relative molecular mass MW=30.268 kD.By building with sheep poxP32 recombinations are the live vector DNA vaccination of target antigen gene, obtaining can continuous passage in vitro, there is good safety in vivo, and can in immune effector cell the attenuated salmonella typhimurium live vector DNA new oral vaccine of high efficient expression, be with a wide range of applications and prospect.
Description
Technical field
The present invention relates to the technical field of molecular biology, be specifically related to a kind of capripox virus P32 recombination, this gene
Preparation method, this gene is as the technical field preparing oral DNA vaccine purposes.
Background technology
Capripox virus (Sheeppox virus and Goatpox virus, SGPV) and in classification, belong to Poxviridae
(Poxviridae) Chorodopoxvirinae (Chordopoxvirnae) Capripoxvirus (Capripoxvirus, CPV),
Mainly include sheep pox virus (sheeppox virus, SPPV) and goat capripoxvirus (goatpox virus, GTPV), permissible
Cause sheep pox (Sheep pox, SP) and goatpox (Goat pox, GP).Primary disease is the most serious in all animal pox
One, pregnancy ewes infects and easily miscarries, has higher case fatality rate in lamb.The infected flock of sheep productivity drops significantly
Low, hair quality also considerable decrease, there are the susceptible animal of the countries and regions that sheep pox is popular and Related product thereof to be arranged by countries in the world
For the strict object limiting turnover, have a strong impact on the development of international trade and sheep husbandry.Meanwhile, capripox virus is alternatively arranged as biology
Weapon, threatens national defense safety.This disease is classified as legal circular infectious disease by World Health Organization (WHO), and the Center for Disease Control is by its stroke
Being grouped into II class danger virus, China is classified as I class Animal diseases.
The current treatment to sheep pox, without specific drug, mainly inoculates against and symptomatic treatment.Inactivated vaccine immune effect is not
Good, of short duration protection can only be provided.Attenuated vaccine has potential pathogenic and virulence and returns strong danger, and the most increasingly
Many reports show, attenuated vaccine can cause the complication such as skin nodules, miscarriage, and the effective prevention and control for sheep pox bring hidden danger,
It is unfavorable for utterly destroying sheep pox.Additionally, the situation of messenger's infected cattle poxvirus happens occasionally in Europe in recent years, particularly without kind
The youngster of pox immunity.The continuous appearance of the situation of these animal derived poxvirus infection people, makes the shape of mankind prevention and control poxvirus
Gesture increasingly complex, sheep pox prevention and control ability, mutton food be faced with formidable challenges safely etc., safe and efficient novel sheep pox epidemic disease
The development of Seedling is extremely urgent.
Along with the announcement of SGPV genome, in the time of several years, lot of documents report research conditions, wherein withP32 eggs
It is the focus of current Chinese scholars research in vain for target antigen development of new vaccine.P32 albumen are SGPV distinctive cyst membrane knots
Structure albumen, is made up of 319-324 aminoacid, has helical structure and the hydrophobic region of cross-film, and transmembrane structure is positioned at C end 287-
At 307 amino acids, hydrophobic region is positioned at 1-18,134-137 amino acids.P32 albumen contain main antigenic determinant, tool
There is the highest conservative, all exist in SGPV strain that is all separated and that detect, antibody can be produced in early days infecting, and
And antibody tormation dynamic response it was found that,PFirst 32 albumen cause the reaction of antibody.In recent years, the most much
Research worker expandsP32Gene, is cloned into different carriers, and have expressed certain activity respectively in protokaryon and eukaryotic cell
Destination protein.But research finds,PThe cross-film district of 32 albumen has toxic action to cell, there will be during expressing
The problems such as expression is low, unstable expression, this govern to a certain extent withP32 albumen are the application of the vaccine of target antigen
Prospect.Research is it has proven convenient that clipPThe cross-film district of 32 albumen or hydrophobic region contribute toPThe expression of 32 albumen, and it is biological to strengthen it
Learn activity, but the most also do not have to clip the restructuring of hydrophobic region and transmembrane structure and gene mutation simultaneouslyP32 albumen are as anti-
The report of former related vaccines.
DNA vaccination be by can under strong eukaryotic promoter (such as CMV promoter) controls encoding exogenous antigen gene thin
Bacteria plasmid forms, when, after transfecting host, DNA vaccination is transported to lymphatic organ and expresses target antigen by antigen-presenting cell (APCs)
And induce the immunne response such as corresponding cell, body fluid.Traditional DNA vaccination immunisation route is mainly intramuscular injection, subcutaneous
Injection and electric pulse injection etc., research it has been shown that these methods to there is antigen presentation relatively inefficient, the immune level of induction
The highest, immune protective effect is undesirable, thus, seek the pass that a kind of safe and efficient vaccine delivery system is DNA vaccination success or failure
Key.Attenuated salmonella typhimurium is intracellular aggressive antibacterial, it is possible to by settling down, after adhering to, attacking, the lymph being correlated with at intestinal
Tissue, and arrive liver, spleen through mesenteric mesaraic lymph node, it is a kind of well mucosal vaccine carrier.Carry DNA vaccination matter
DNA plasmid can be directly presented to APCs by the attenuated salmonella typhimurium of grain, dissolves, or gulp down with host in APCs
The form biting corpusculum enters Cytoplasm, thus is discharged in nucleus by DNA plasmid, make exogenous gene at cell inner expression, from
And stimulate body to produce corresponding immunne response.Attenuated salmonella typhimurium live vector is except the advantage with virus live vector
Outward, also have that exogenous gene saturation is big, preparation is convenient, stimulate the advantages such as cellular immunity is strong, and bacteria carrier itself
The unmethylated motif (motif) of liposome class material and DNA may also function as adjuvant effect, stimulate body produce higher B,
T cell immunne response.The orally available immunity of attenuated salmonella typhimurium live vector vaccine, can induce body produce mucosa, cell,
The panimmunity responsing reactions such as humoral immunization, therefore make the live vector of vaccine with it and have huge application potential, multiple
Further investigation is expanded on the prevention and control vaccine of epidemic disease.
Summary of the invention
For the most domestic and international hydrophobic region and cross-film district for Capripoxvirus P 32 Protein, cell is had toxic action,
During expressing, there will be the prior art problem such as low, the unstable expression of expression, cause immunocompetence low, in certain journey
Govern P32 albumen on degree and develop into the application prospect of vaccine.It is contemplated that in providing a kind of capripox virus restructuringP32 genes
And build and application in preparing vaccine, by transformation capripox virusP32 gene orders, build with sheep poxP32 recombinations
For the live vector DNA vaccination of target antigen gene, obtain can continuous passage in vitro, there is good safety in vivo and in vitro,
And can in immune effector cell the new oral attenuated salmonella typhimurium live vector DNA vaccination of high efficient expression P32 albumen.
The main technical schemes that the present invention uses:
First purpose of the present invention is to provide a kind of cross-film district and hydrophobic region of deleting, then through gene mutation, insertion base
Mode transforms capripox virusP32 gene orders, it is contemplated that this recombinant gene vaccine has positive work to prevention and the treatment of sheep pox
With；Second object of the present invention is to provide this sheep poxPThe preparation method of 32 recombinations, sick by taking Xinjiang region
The skin varioliform exanthema tissue of sheep, isolated viral, breeding is incubated at primary lamb testicular cell, by virus infected cell culture repeatedly
DNA is extracted in freeze thawing, carries out PCR with the DNA of sheep pox for template, preparationP32 genes；Third object of the present invention is to provide one
Plant and utilize sheep pox disclosed by the inventionP32 recombination preparations are for treating or prevent the vaccine of sheep pox, a kind of permissible
Oral immunity, the live vector DNA vaccination having preferable immune effect and the preparation method of this vaccine.The capripox virus of preparationP32 gene attenuated salmonella typhimurium live vector DNA vaccinations can continuous passage in vitro, safety is good and has good life
Thing activity, can in immune effector cell high efficient expression, compare DNA vaccination intramuscular injection immunity, this live vector DNA vaccination be administered orally
Immunity can produce higher levels of humoral immunization and cellular immune level by inducing mouse, and antibody can continue with higher level
For more time, this Synthetical prevention carrying out sheep pox for application vaccine provides a kind of new selection, is also the system of sheep pox new generation vaccine
For opening a new approach.
The present invention specifically provides a kind of sheep poxP32 recombinations, have the base sequence as shown in sequence table SEQ ID NO.1
Row,P32 gene order sizes are 777 bp, are 98.32% with original series concordance, compared to original series, 78,119,
123,215,275,281,286,492,571,591,594,601,609 there is single base mutation, in 102 ~ 103 bit-interleaved
Entering 3 bp bases, amino acid number is 259, and compared with original series, 28,42,43,72,111,113,115 aminoacid become
Change, between 36 ~ 37, insert N aminoacid, but overall amino acid order does not change, isoelectric point, IP pI:9.10, average molecular
Mass M W=30.268 kD.
Meanwhile, the present invention provides above-mentioned sheep poxPThe preparation method of 32 recombinations, by choosing the sick sheep in Xinjiang region
Skin varioliform exanthema tissue, isolated viral, breeding is incubated at primary lamb testicular cell, by virus infected cell culture multigelation
Extract DNA, carry out PCR with the DNA of sheep pox for template, preparationP32 genes, by inciting somebody to actionPFront 20 ammonia of 32 gene original series
Base acid hydrophobic region is all removed as the corresponding base in cross-film district with 282 ~ 304 aminoacid, and design is with restriction enzyme site primer, logical
Cross PCR sudden change, base is inserted, and transforms formerP32 gene orders obtain, the upstream and downstream primer of employing respectively:
Forward primer:
5'-CCCAAGCTTACGATGGCCAGAATTAAAAAGTGGCAATGATAT-3'
Downstream primer:
5'-ACCGAATTCTGAAACCAATGGATGGGATACATAG-3'
Further, the present invention uses the sheep pox of above-mentioned offerP32 recombinations preparation for prevent and treat sheep pox medicine or for
Preparation prevents and treats the vaccine of sheep pox.
The present invention preferentially uses and prepares a kind of attenuated salmonella typhimurium mobile load preventing and treating sheep pox that can orally use
Body DNA vaccination, this vaccine is by aforementioned for coding sheep poxPThe DNA vaccination plasmid of 32 recombinations proceeds to attenuated Salmonella typhinaurium sramana
In Salmonella bacterial strain, build with sheep poxP32 recombinations are the live vector DNA vaccination of target antigen gene, wherein said attenuation
Salmonella typhimurium can be expressed in DNA vaccination plasmid is delivered directly to immune effector cell.
The preparation method of the above-mentioned oral live vector DNA vaccination preventing and treating sheep pox, concrete preparation method is as follows:
By by the capripox virus of the present inventionP32 recombinations are connected construction recombination plasmid with DNA vaccination expression vector pVAX1
pVAX1-P32, by recombiant plasmid pVAX1-P32 electricity are transformed into the escherichia coli X6212 of fresh preparation, extract restructuring matter from it
Grain, heat shock method proceeds to be attenuated attenuated salmonella typhimurium intermediate host X3730, makes DNA vaccination plasmid obtain mouse typhus sramana
The methylation patterns of Salmonella, then from X3730 bacterium, separate DNA vaccination plasmid, electricity converts final host bacterium X4550, is attenuated
Salmonella typhimurium live vector DNA vaccination bacterium X4550/pVAX1-P32, i.e. obtain the present invention for preventing and treating the oral work of sheep pox
Carrier DNA vaccine.
By implementing the concrete summary of the invention of the present invention, techniques below effect can be reached:
(1) restructuring of the present inventionP32 genes by genetic engineering means delete before original series hydrophobic region 20 amino acids and
Cross-film district 282-304 amino acids correspondence base, then through base mutation and insertion, the sequence length after Optimizing Reconstruction is 777
Bp, is 98.32% with original gene sequence concordance, and these transformations are conducive to improving the expression of P32 albumen and biology lives
Property, and reduce the toxicity to cell.
(2) capripox virus prepared by the present inventionP32 genes can be expressed in vivo, and safety is good and has good biological work
Property；The attenuated salmonella typhimurium live vector DNA vaccination strain of the present invention can continuous passage in vitro, have good in vivo
Safety, and can in immune effector cell high efficient expression, compare DNA vaccination intramuscular injection immunity, this live vector DNA vaccination mouth
Take immunity and can produce higher levels of humoral immunization and cellular immunization by inducing mouse, and antibody horizontal can be held with higher level
The continuous longer time, this Synthetical prevention carrying out sheep pox for application vaccine provides a kind of new selection, is also sheep pox new generation vaccine
Preparation opens a new approach.
(3) use the present invention by DNA vaccination pVAX1-P32, live vector X4550/pVAX1-P32 vaccines carry out muscle respectively
Injecting immune group, oral immunity group, indirect elisa method detection mice serum IgG antibody level, oral immunity X4550/pVAX1-P32 groups and intramuscular injection pVAX1-P32 groups immunity 42 days after antibody horizontal be pole significant difference (P < 0.01), oral immunity
X4550/pVAX1-PThe IgG antibody highest serum dilution titer of 32 groups reaches 1:51200.Result shows, attenuated Salmonella typhinaurium Salmonella
The immune effect of bacterium live vector DNA vaccination is substantially better than DNA vaccination injecting immune group, and the induction of oral live vector DNA vaccination
The humoral immunization duration is longer, and antibody horizontal is higher.
(4) mice of the present invention is used to detect the propagation of splenocyte, oral live vector DNA vaccination after immune 14 d
X4550/pVAX1-P32 immune group and blank group difference are extremely notable (P < 0.01), DNA vaccination X4550/pVAX1-P32 fleshes
Meat injecting immune group and blank group significant difference (0.01 < P < 0.05).Result shows relatively and DNA vaccination, and the present invention carries
The live vector DNA vaccination X4550/pVAX1-of confessionP32 pairs of specific the proliferative function of lymphocyte effects are higher, are more easy to inducing machine
Body produces stronger cell immune response.
(5) present invention is used to carry recombiant plasmid pVAX1-PThe attenuated salmonella typhimurium X4550 of 32 is in the medium
Growth curve is good, can stably pass on for 100 generations；By colony counting, recombiant vaccine bacterium X4550/pVAX1-P32 can relatively persistently exist
Survival in mouse spleen, is conducive to stimulating body to produce immunne response.X4550/pVAX1-is detected by Immunohistochemical MethodP32
Expression in mouse spleen, attenuated salmonella typhimurium mobile load physical ability is by DNA vaccination plasmid pVAX1-P32 are efficiently transported to exempt from
Epidemic disease effector organ, and at its intracellular high efficient expression.
Accompanying drawing explanation
Fig. 1 showPThe gel electrophoresis figure of 32 genes of interest PCR, in figure: M is DNA Marker DL5000；1 is negative
Comparison；2 arePThe PCR primer of 32 genes.
Fig. 2 show DNA vaccination recombiant plasmid pVAX1-PThe gel electrophoresis figure of the PCR of 32, in figure: M is DNA Marker
DL2000；1 is negative control；2 arePThe PCR primer of 32 genes.
Fig. 3 show DNA vaccination recombiant plasmid pVAX1-PThe double digestion gel electrophoresis figure of 32, in figure: M is DNA
Marker DL5000；1 is recombiant plasmid pVAX1-PThe double digestion result of 32.
Fig. 4 show DNA vaccination recombiant plasmid pVAX1-PIndirect immunofluorescene assay knot after 32 transfection BHK-21 cells
Fruit figure, in figure: A:pVAX1-P32 transfects light field；B:pVAX1-P32 transfects fluorescence field；C:pVAX1 transfects light field；D:
PVAX1 transfects fluorescence field.
Fig. 5 show attenuated salmonella typhimurium live vector DNA vaccination X4550/pVAX1-P32 stably passed on for 100 generations
The double digestion of rear extraction plasmid identifies gel electrophoresis figure, in figure: M is DNA Marker DL5000；1-4 is recombiant plasmid
pVAX1-PThe double digestion result of 32.
Fig. 6 is to show attenuated salmonella typhimurium live vector DNA vaccination X4550/pVAX1-P32 with empty bacterial strain
The growth curve comparison diagram of X4550.
Fig. 7 show attenuated salmonella typhimurium live vector DNA vaccination X4550/pVAX1-PLittle after 32 oral immunities
SABC inspection figure in Mus spleen cell, in figure: A is X4550 immune group；B is X4550/pVAX1-P32 immune group.
Fig. 8 show attenuated salmonella typhimurium live vector DNA vaccination X4550/pVAX1-PLittle after 32 oral immunities
Mus serum antibody ELISA testing result cartogram.
Fig. 9 show attenuated salmonella typhimurium live vector DNA vaccination X4550/pVAX1-P32 oral immunities with
pVAX1-PMice serum antibody ELISA testing result comparison diagram after 32 intramuscular injection immunity.
Figure 10 show attenuated salmonella typhimurium live vector DNA vaccination X4550/pVAX1-PAfter 32 oral immunities little
Antibody titer detection figure during Mus serum antibody top level.
Figure 11 show attenuated salmonella typhimurium live vector DNA vaccination X4550/pVAX1-PSpleen after 32 oral immunities
Dirty lymphopoiesis MTT testing result figure.
Figure 12 show attenuated salmonella typhimurium live vector DNA vaccination X4550/pVAX1-PThe structure flow chart of 32.
Figure 13 showP32 gene sequencing results and original gene sequence comparison diagram, in figure: two row represent respectively
Genbank announce sequence (AF124517) andP32 gene sequencing results.
Figure 14 showPWith original protein sequences comparison diagram after 32 gene translations, in figure: two row represent original protein respectively
Sequence andP32 albumen.
Detailed description of the invention
Being further elucidated with the present invention below in conjunction with specific embodiment, certainly, these embodiments are merely to illustrate the present invention, and
It is not used in restriction the scope of protection of present invention.
Main raw and auxiliary material, reagent and the instrument and equipment related in the present invention:
Key instrument and reagent: MSSPX-250 type biochemical cultivation case, MLS-3020 high-pressure steam sterilizing pan, SW-CJ-1F Type B
Single two-sided clean work station, E360K centrifuge, HWY-100 constant-temperature table, Eppendorf No:5345PCR instrument, Heraeus
MultifugeX1R high-performance high-capacity and high-speed freezing desk centrifuge, Biotek FLS800t all-wave length automatic luciferase mark
Instrument, Bio-Rad Mode 200/2.0 electrophresis apparatus, Bio-Rad GelDoc XR gel imaging instrument, Eppendorf
BioPhotometer Plus nucleic acid-protein analyzer, BB150 CO2 gas incubator, NIKON ECLIPSE Ti-E research grade
Inverted fluorescence microscope, Xseries II type inductivity coupled plasma mass spectrometry (ICP-MS), Seven Easy Plus S20P type
Accurate pH meter, DHG-924OA type electric heating constant-temperature blowing drying box, THZ-82 gas bath constant temperature oscillation case, GMSX-280 steam
Steriliser etc..
The restricted enzyme such as EcoRI, HindIII, T4 DNA Ligase, DNA Marker DL5000, Ex Taq enzyme,
Precious biological engineering (Dalian) company limited；PurePlasmid Mini Kit, DNA Purification Kit, Beijing health is generation
Discipline bio tech ltd；PageRuler Prestained Protein Ladder, Ferments company；Diaminourea heptan
Diacid (diaminopimelic acid, DAP), how pyridine keto acid (Nalidixic acid, NA), Sigma company；Radix Cochleariae officinalis mistake
The rabbit anti-sheep IgG of oxide enzyme (HRP) labelling, Beijing Baeyer enlightening Bioisystech Co., Ltd；Nickel post, QIGEN；
Lipofectamine 2000 lipofectamine box, Invitrogen company；RPMI-1640 culture medium, Hyclone is public
Department；Hyclone, Hangzhoupro, sky, Zhejiang biology company limited；DyLight405 Immunofluorescence Detection Kit
(Goat), Sangon Biotech (Shanghai) Co., Ltd.；CCK-8 Cell proliferation-Cell toxicity detection test kit, upper sea cowry
Rich biology；APC Rat Anti-Mouse CD4、FITC Rat Anti-Mouse CD8a、PE Hamster Anti-Mouse
CD3e, APC Rat Anti-Mouse IFN-γ, PE Rat Anti-Mouse IL-4, fixative, washing buffer,
Golgi stop, BD biosciences；Erythrocyte cracked liquid, Biosharp；Water is ultra-pure water, 18.2 M Ω cm, remaining
Reagent is analytical pure.
The common escherichia coli X6212(△ asd that the present invention uses) (hereinafter referred to as X6212), the middle place of Salmonella
Main X3730(△ asd, Tcs, Strr, △ Gal) (hereinafter referred to as X3730), Salmonella final host X4550(△ asd,
△ crp, Nalr, △ cya) (hereinafter referred to as X4550) and DNA vaccination expression plasmid pVAX1.It is special that above bacterial strain is disclosed in the U.S.
Profit US 6872547, those of ordinary skill in the art can be obtained by public's channel approach.
All reagent and the instrument selected in the present invention are all to it is well known that selection, but are not intended to the reality of the present invention
Executing, other reagent more well known in the art and equipment are applied both to the enforcement of implementation below of the present invention.
Embodiment one:PThe preparation of 32 genes
Infecting from sheep pox and separate capripox virus the incrustation of sheep, breeding is cultivated, and extracts capripox virus DNA, carries out with DNA profiling
PCR, according to the GPV P32 gene order (Genbank accession number: AF124517) delivered on GenBank, designs primer amplification
Delete hydrophobic region and the P32 base in cross-film district.Use upstream and downstream primer respectively:
Forward primer F1 sequence is:
5'-CCCAAGCTTACGATGGCCAGAATTAAAAAGTGGCAATGATAT-3'
Italic isHindRestriction enzyme site, in square frame, sequence is Kozak sequence.
Downstream primer F2 sequence is:
5'-ACCGAATTCTGAAACCAATGGATGGGATACATAG -3'
Italic isEcoR I restriction enzyme site.
PCR reaction is carried out for template, reaction system with the DNA of XJCJ-GPV: 10 ×Taq Recation buffer(contains
MgCl2) 2 μ L, dNTP(10 mmol/L) 1.6 μ L, upstream, downstream primer Fl/F2(10 pmol/ μ L) each 0.4 μ L, DNA mould
Plate 1 μ L, sterilizing distilled water 14.1 μ L.Reaction condition: 95 DEG C, 5 min；94 ℃、1 min；61 ℃、l min；72 ℃、1
Min, 34 circulations, 72 DEG C, 10 min.PCR primer sees accompanying drawing 1 through 1.2 % agarose gel electrophoresiies, electrophoresis result.With
DNA Purification Kit purification reclaims genes of interest, and order-checking is identified.Sequencing result with primary sequence homology is
98.32%, compared to original series, at 78,119,123,215,275,281,286,492,571,591,594,601,609
12 base mutations occurring, inserts 3 bp bases at 102-103 interdigit, result is shown in accompanying drawing 13, and amino acid number is 259, with former
Beginning sequence is compared, and 28,42,43,72,111,113,115 aminoacid convert, insertion agedoite between 36-37, but totally
Amino acid sequence does not change, and result is shown in accompanying drawing 14, isoelectric point, IP pI:9.10, relative molecular mass MW=30.268 kD.On
State the sheep pox of employingP32 recombinations, have the base sequence as shown in attached sequence table SEQ ID NO.1.
Embodiment two: DNA vaccination plasmid pVAX1-PThe structure of 32 and qualification
WillP32 gene purpose fragments and expression vector pVAX1 are respectivelyEcoR I HeHindDouble digestion, recovery and purification, willP32GeneBeing connected by T4 DNA Ligase according to the ratio that molal quantity is 3:l with pVAX1, the converted product after connection is transformed into
Fresh preparationE.coli In DH5 α competence, it is uniformly coated on converting bacterial strain on the LB flat board containing 50 μ g/mL Kan, 37
After DEG C putting cultivation 14 h, dip monoclonal bacterium colony with sterilizing toothpick and put in the LB culture medium containing Kan and cultivate 14 h, in a small amount
After extracting plasmidHindWithEcoR I carries out double digestion and PCR identifies, will identify that correct Strain Designation is pVAX1-P32, PCR and double digestion qualification result see accompanying drawing 2 and accompanying drawing 3.
Embodiment three: DNA vaccination plasmid pVAX1-PThe immunogenicity detection of 32 expressing proteins
1. cell is cultivated
From liquid nitrogen, take out frozen BHK-21 cell, be placed in fast melt in 37 DEG C of cell culture incubators, in the EP pipe of 7 mL
Adding 1640 complete mediums of 4 mL, and add the BHK-21 cell melted, 3000 rpm are centrifuged 3 min, abandon supernatant,
Add 1 mL culture medium re-suspended cell, be placed in 25 cm2Tissue Culture Flask in, and in 37 DEG C, 5 % CO2Incubator is cultivated.
Indirect immunofluorescene assay pVAX1-PIn 32 transfectional cellsPThe expression of 32 albumen
Conventionally cultivating BHK-21 cell, carry out cell transfecting with the method for liposome transfection, concrete grammar is as follows:
(1) day before transfection, counts after trypsinization BHK-21 cell and with cell counting count board, and cell is with 2 × 106The density of individual/mL
Uniform spreading, in 6 orifice plates, makes the cell coverage density when transfection reach 70 % ~ 80 with 37 DEG C of cultivations in cell culture incubator
%, transfects front 2 h, changes 1640 culture medium of antibiotic-free serum-free；(2) EP pipe A: draw 500 μ L serum-frees and antibiotic
1640 culture medium, add 8 μ g pVAX1-P32 recombiant plasmid, bomb tube wall, to mix liquid, stands 5 min under room temperature condition；
(3) EP pipe B: draw 500 μ L serum-frees and 1640 culture medium of antibiotic, adds 10 μ L Lip 2000 liposomees, softly mixes
Even, under room temperature environment, place 5 min；(4) by the solution mixing in A pipe and B pipe, stand 20 min, discard cell culture medium,
By 1640 culture medium of serum-free and antibiotic, cell is washed twice；(5) mixed solution is added dropwise over every hole, gently with
The direction of decussation is rocked, and makes solution uniformly be paved with at the bottom of whole hole, is positioned in 37 DEG C of cell culture incubators and cultivates 6 h；(6)
Discard culture medium, be replaced by complete 1640 culture medium, in CO2Cell culture incubator is cultivated；(7) PBST washs 3 times, adds fixing
Liquid chamber temperature is fixed 20 min, PBST and is washed 3 times, adds 0.1 penetrating 15 min of % Triton-X；Wash 3 times with PBST again, add
Entering confining liquid room temperature and close 45 min, the standard sheep pox positive serum adding 1:100 dilution in every hole resists as one, 4 DEG C of mistakes
Night hatches.PBST washs 4 times, adds the rabbit anti goat igg of the DyLight405 labelling of 1:500 dilution, and lucifuge hatches 60 min,
PBST washs 3 times, drips the glycerine water solution of 900 mol/L, in fluorescence microscopy Microscopic observation, indirect immunofluorescene assay result
Display, transfects pVAX1-PThe BHK-21 of 32 recombiant plasmid is intracellular can detect visible fluorescence, shows recombinant DNA vaccine plasmid
At cell inner expression P32 albumen, and the BHK-21 cell detection of pVAX1 plasmid can be transfected less than visible fluorescence, see accompanying drawing 4.
Embodiment four: live vector DNA vaccination X4550/pVAX1-PThe preparation of 32
1. recombiant plasmid pVAX1-P32 transformed competence colibacillus X6212
Experimental procedure is as follows: (1) is by 3 μ L pVAX1-P32 and 100 μ L X6212 competence bacteria mixings, ice bath 30 min；(2)
Put into water-bath 90 s(that temperature is 42 DEG C and be sure not vibration)；(3) put into rapidly in ice, ice bath 1 min；(4) about 800 are added
μ L 37 DEG C preheating containing 50 μ g/mL DAP SOC culture medium, 37 DEG C, shaken cultivation 1 h；(5) 3000 rpm are centrifuged 10
Min, abandons part supernatant, leaves about 200 μ L culture medium, blows afloat the thalline bottom pipe gently；(6) by above-mentioned bacterium solution even spread
In the LB flat board containing 20 μ g/mL NA, it is inverted and cultivates 16～18 h；(7), after sterilizing toothpick picking monoclonal, 37 DEG C are shaken bacterium training
Supporting 16 h, alkaline lysis extracts plasmid in a small amount.
Recombiant plasmid electricity successively converts X3730 and X4550
Experimental procedure is as follows: (1) takes the recombiant plasmid pVAX1-that the 2-3 μ L from above-mentioned preparation normally modifiesP32 with attenuation Mus
Salmonella typhi X3730 competence mixes together, ice bath 10 min, and electric shock cup is placed on pre-cooling on ice；(2) filter paper is used
Wiping electricity revolving cup wall of cup, is added drop-wise to mixed liquor immediately in 0.2 precooled cm electricity revolving cup, is then placed in electroporation sample
In groove；(3) Studies on Electroporation Transformation: voltage (U) 2.5 kV, electric capacity (C) 25 Uf, resistance (Ω) 200 Ω, electricity is turned liquid and turns rapidly
Enter the SOC culture medium containing 50 μ g/mL DAP of 37 DEG C of preheatings, and the liquid in electric shock cup is proceeded in the EP pipe of sterilizing；(4)
37 DEG C, 1h is cultivated in shaking, discards part supernatant, blows afloat precipitation with remaining liq and coats containing 50 μ g/mL Kan, 50 μ g/
ML DAP, 20 μ g/mL NA LB flat board on, 37 DEG C be inverted cultivate 18 h；Monoclonal is selected, inoculation with the toothpick after sterilizing
In the 4 mL LB culture medium containing above-mentioned antibiotic, 37 DEG C of shaken cultivation 16 h, convert with electricity after alkaline lysis method of extracting plasmid
Method proceeds to attenuated salmonella typhimurium X4550 competence (the same X3730 of step of converting)；(6) recombinant bacterium of final gained with
X4550/pVAX1-P32 names, it is frozen standby in-80 DEG C of refrigerators that original bacterium solution adds 15% glycerol；(7) empty plasmid is built with method
Recombinant bacterium X4550/pVAX1 is as blank.Above by reference to accompanying drawing 12.
Embodiment five: live vector DNA vaccination X4550/pVAX1-PThe detection of 32
1. X4550/pVAX1-PThe vitro stability test of 32
Recombinant bacterium is seeded in containing 50 g/mL DAP, 50 g/mL Kan, 20 g/mL NA LB culture medium in, 37 DEG C are shaken
Bacterium cultivates 12 h, is inoculated in the ratio of 1:100 by recombinant bacterium and cultivates 12 h containing shaking bacterium in above-mentioned antibiotic LB culture medium, according to
The method cultivates 4 generations that is 50 h continuously, is equivalent to thalline and passed on for 100 generations.The bacterium solution 100 μ L taking 50 h cultivations coats containing upper
State on the LB flat board of antibiotic, randomly select 4 monoclonals be inoculated in respectively in the LB culture medium containing above-mentioned antibiotic shake bacterium training
Foster 16 h, alkaline lysis method of extracting plasmid, EcoR I HeHindDouble digestion, agarose gel electrophoresis, to determine that recombinant bacterium is at body
The stability of outgrowth.
Result shows, X4550/pVAX1-P32Cultivated for 100 generations continuously in the case of there is no extraneous selection pressure, at random
Select 4 single bacterium colonies through shake bacterium extract plasmid double digestion identify after, have purpose band to manifest, show to carry recombiant plasmid
pVAX1-P32Attenuated salmonella typhimurium X4550 at least can stably pass on for 100 generations, electrophoresis result sees accompanying drawing 5.
2. X4550/pVAX1-PThe growth characteristics test of 32
Picking recombinant bacterium X4550/pVAX1-respectivelyP32, X4550/pVAX1 is inoculated in containing 50 g/mL DAP, 50 g/mL
Kan, 20 g/mL NA LB culture medium in, after two strain bacterium 37 DEG C shaken cultivation 18 h, take 50 μ L respectively and be inoculated in 5 mL and contain
In the LB culture medium of above-mentioned corresponding antibiotic, continue shaken cultivation, measure OD every 1 h totally 18 h600Value, draws two simultaneously
Plant the growth curve of bacterium.Result shows X4550/pVAX1-PThe growth conditions of 32 and empty bacterium X4550 is good, and growth curve is basic
Unanimously, after showing that recombiant plasmid proceeds to attenuated salmonella typhimurium, the growth on this bacterium does not the most produce impact, growth curve
Figure sees accompanying drawing 6.
PTest at Mice Body internal stability
With 109 CFU recombinant bacterium X4550/pVAX1-P32 oral immunity BALB/C mice, after immunity the 2nd, 6,11,31 days each
Take 2 mices and take off neck execution, the aseptic spleen that takes, add the normal saline of 9 times of volumes, process with hand electric refiner, with
The rotating speed of 3000 r/min is centrifuged 15 min, takes supernatant and coats containing 50 μ g/mL Kan, 50 μ g/mL DAP, 20 μ g/mL
On the LB flat board of NA, it is inverted for 37 DEG C and cultivates 18 h, colony counting.Result shows, X4550/pVAX1-P32 oral vaccination mices
After immunity the 2nd day, spleen can't detect X4550/pVAX1-P32, ＞ 1000 can be detected on 6th, the 11st is still
Can detect that 317 ± 14, can't detect recombinant bacterium by 31 days, show this recombiant vaccine bacterium X4550/pVAX1-P32 can relatively hold
Survive in vivo for a long time, be conducive to stimulating body to produce immunne response.
PExpression in spleen
ImmunohistochemistryMethods Methods detection X4550/pVAX1-P32 expression in mouse spleen, test method is as follows: (1) is by immunity
After 11 days, mouse spleen is immersed in 10% formalin after taking out, and fixes 12 more than h until organizing hardening；(2) tissue is put
Enter in embedded box, with distilled water flushing 3 times, then rinse 3 times with 50% dehydrated alcohol, use alcohol concentration serial dehydration；(3) use
Leica embedding machine, by organization embedding in wax stone, places ambient temperature overnight；(4) paraffin embedded tissues is put into-20 DEG C of refrigerators, with section
Tissue is cut into the thin slice that thickness is 4 mm by machine；(5) tissue slice is put in 50 DEG C of distilled water, make thin slice launch, then use
The microscope slide processed drags for sheet；(6) 68 DEG C of constant temperature roasters bake microscope slide 2h；(7) before dewaxing, microscope slide is put in 68 DEG C of baking boxs
30 min；(8) microscope slide puts into dimethylbenzene15min in solution, dimethylbenzene15min in solution, dehydrated alcohol, 95 % ethanol、
95 % ethanol, the 80 each 5s of % ethanol, from the beginning washing one time, distillation washing one time；(9) during microscope slide is immersed in 3 % H2O2,
Room temperature places 10 min, and distillation washing 3 times, each 5 min, PBS wash 3 times, each 5min；(10) microscope slide immerses 0.01M Chinese holly
In rafter acid antigen retrieval buffers, microwave oven being adjusted to thaw point (92-98 DEG C) 10min, room temperature cools down, distillation washing 1 time, PBS
Wash 1 time；(11), during microscope slide puts into wet box, add one and resist, 4 DEG C of refrigerator overnight；(12) PBS washes 3 times, each 5 min, dropping
IgG-HRP, 37 DEG C of incubation 25 min, PBS solution washes 3 times, each 5 min；(13) freshly prepared DAB colour developing is dripped
Liquid develops the color, and controls developing time 3 ~ 10 min, tap water color development stopping under microscope；(14) haematoxylin redyes 5-10 min, steams
Distilled water is washed, acidic alcohol breaks up (being quickly stained with), returns indigo plant (warm water 1 min), dehydration (graded ethanol 80 %, 95 %、、
Dehydrated alcohol each 5 s), transparent (dimethylbenzene 、Each 5 s)；(15) neutral gum mounting, basis of microscopic observation, takes pictures.
Result shows, oral immunity group X4550/pVAX1-PHave in the mouse spleen of 32P32 protein expressions, Lignum Sappan Yihong
After dyeing, positobe focus can be detected in immune group, and compare sky bacterial immunity group and can't detect positobe focus, show to be attenuated Mus wound
Cold Salmonella mobile load physical ability is by DNA vaccination plasmid pVAX1-P32 are transported to immunological effect organ, and at its intracellular efficient table
Reaching, ImmunohistochemistryResults Results sees accompanying drawing 7.
Embodiment six: mouse immune is tested
1. mice serum IgG antibody horizontal detection
50 5 ~ 6 week old female BAl BIc/C mice are divided into saline control group, 50 μ g pVAX1-P32 intramuscular injection immunity
Group, 50 μ g pVAX1 intramuscular injection immune group, 1010 CFU X4550/pVAX1-P32 oral immunity groups, 1010 CFU X4550/
PVAX1 oral immunity group.Mice is before oral immunity, and overnight fast, after the immune same day prohibits water 4 h, first with 100 μ L 10 %
NaHCO3Gavage is to neutralize gastric acid, and immune mouse after 30 min, twice immunization interval 14 days, twice immunizing dose is identical.All
Mice before one exempts from (0 d), two exempt from before (14 d), two exempt from two weeks (28 d), two exempt from surrounding (42 d), two exempt from six weeks (56 d),
Taken a blood sample by eye socket blood collection method with capillary blood taking needle, separating immune serum.The OD of indirect elisa method detection serum antibody450Value,
WithP32 pure proteins as antigen coated ELISA 96 orifice plate, are one to resist, with the goat-anti of HRP labelling with the serum of mice to be detected
Mus IgG(1:20000) be two resist.Specific experiment step is as follows: (1) is antigen coated: willP32 recombiant proteins are dilute with being coated buffer
Releasing to 10 μ g/mL, every hole adds the 150 antigen coated liquid of μ L, and 4 DEG C are coated overnight；(2) close: discarding and be coated liquid, every hole adds
Entering 200 μ L PBST, wash 3 times, pat dry, every hole adds 200 μ L confining liquids, closes 2 h for 37 DEG C；(3) one anti-hatch: discard
Confining liquid, every hole adds 200 μ L PBST, washs 3 times, pats dry, and every hole adds the Mouse Blood to be detected of 2.5 % confining liquid dilutions
Clear 150 μ L, hatch 4 h for 37 DEG C；(4) two anti-hatch: discarding solution, every hole adds 200 μ L PBST, washs 3 times, pats dry,
Every hole adds the sheep anti-mouse igg 150 μ L of the HRP labelling that 1:20000 dilutes with 2.5 % confining liquids, hatches 1 h for 37 DEG C；(5)
Discard solution, add 200 μ L PBST, wash 3 times；(6) every hole adds freshly prepared 100 μ L TMB, and 37 DEG C of lucifuges show
Color 15 min, observes color variable gradient after taking-up；(7) every hole adds 50 μ L stop buffers, stops chromogenic reaction, measures OD450
Value；(8) data carry out statistical analysis, mapping by prism 5；(9) with method detection oral immunity live vector DNA vaccination group
Antibody titer during High antibody level.
Testing result shows, oral immunity X4550/pVAX1-PThe mice of 32 groups i.e. produces anti-at 14 dP32 IgG resist
Body, reaches peak value at 28 d antibody horizontals, then begins to slowly decline, but 42 d, 56 d and saline control group, oral
Immunity X4550/pVAX1 group compare antibody horizontal still in pole significant difference (P<0.01、P<0.01).Intramuscular injection recombiant plasmid pVAX1-P32 immune group mices also produce anti-at 14 dP32 IgG antibody, reach peak value in 28 d intramuscular immunity group mouse antibodies levels,
But its antibody horizontal declines quickly, in its antibody horizontal of 42 d and saline control group, intramuscular injection recombiant plasmid pVAX1 group
Difference notable (P>0.05、P> 0.05), statistical result sees accompanying drawing 8.Oral immunity X4550/pVAX1-PNote with muscle for 32 groups
Penetrate pVAX1-P32 groups immunity 42d after antibody horizontal be pole significant difference (P< 0.01), statistical result sees accompanying drawing 9.It is administered orally and exempts from
Epidemic disease X4550/pVAX1-PThe highest serum IgG antibody dilution titer of 32 groups reaches 1:51200, and statistical result sees accompanying drawing 10.Thus
May indicate that, although intramuscular injection DNA vaccination also can produce higher humoral immunity level by inducing mouse, but attenuated Salmonella typhinaurium Salmonella
The immune effect of bacterium live vector DNA vaccination is substantially better than DNA vaccination injecting immune group, and the body fluid of live vector DNA vaccination induction
Immune duration is longer, and antibody horizontal is higher.
The MTT detection of mice spleen lymphocytes proliferation
Mice detects the propagation of splenocyte after immune 14 d, and detection method is as follows: (1) mice takes off neck and puts to death, and is soaked in
In 75 % ethanol, in superclean bench, win spleen, 60 mm dish add 3 mL1640 complete mediums, by spleen in
200 mesh copper mesh are ground to without significantly tissue and cell mass, by cell suspension with 200 mesh copper mesh filtrations go to 15 mL from
In heart pipe；(2) 1200 rpm are centrifuged 7 min, abandon supernatant；(3) erythrocyte cracked liquid of about 1 mL is added, after cracking 1 min
Add 5 mL 1640 complete mediums and terminate reaction；(4) 1200 rpm are centrifuged 7 min, abandon supernatant；(5) 4 mL 1640 are added
Complete medium, dispels cell, if precipitated in a organized way, needs 200 copper mesh;(6) dilution 100 times carries out cell counting；(7) 1
×106Individual/mL splenocyte 100 μ L adds in 96 orifice plates, adds 150 μ L 1640 complete mediums, adds at edge hole
200 μ L culture medium；(8) every hole adds 20 μ g/uLP32 albumen, hatch 48 h for 37 DEG C；(9) every hole adds 10 μ L CCK-8
Solution, hatches 1-4 h for 37 DEG C；(10) absorbance value of every hole 450 nm is measured；(11) data are analyzed by prism, make
Figure.
Seeing accompanying drawing 11 and accompanying drawing 12, testing result shows, 14 d after immunity, oral live vector DNA vaccination immune group
Extremely notable with blank group difference (P< 0.01), DNA vaccination intramuscular injection immune group and blank group significant difference (0.01
<P< 0.05).Result shows relatively and DNA vaccination, and live vector DNA vaccination is to specific the proliferative function of lymphocyte effect more
By force, it is more easy to induce body to produce stronger cell immune response.
Last it is noted that the foregoing is only the preferred embodiments of the present invention, it is not limited to this
Bright, although being described in detail the present invention with reference to previous embodiment, for a person skilled in the art, it is still
Technical scheme described in foregoing embodiments can be modified, or wherein portion of techniques feature is carried out equivalent replace
Change.All within the spirit and principles in the present invention, any modification, equivalent substitution and improvement etc. made, should be included in the present invention
Protection domain within.
SEQ ID NO.1
<110>Xinjiang University
<120>capripox virus restructuring P32 gene and structure and the application in preparing vaccine
<130> 1
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 777
<212> DNA
<213>sheep poxP32 recombinations
<400> 1
CCAGAATTAAAAAGTGGCAATGATATATTTTATAAAAAAGTTGACACAGTAAAAGATTTT 60
AAAAATTCAGATGTAAATTTTTTTTTAAAAGATAAAAAAGATGATATCAGTTTATCATAT 120
AAGTTACTTATATGGGAAAAGGTAGAAAAATCAGGAGGTGTTGAAAATTTTACAGAATAT 180
TTTTCTGGATTATGTAATGCTCTTTGTACAAAAGAGGCAAAAAGTTCTATTGCAAAACAC 240
TTTAGTTTATGGAAATCGTATGCCGATGCGGATATAAAAAATTCTGAGAATAAGTTTATT 300
GTTGTTATAGAAGATGATAACACATTAAAAGATTCAATAATAATACATAACATTATAATT 360
GAAATGCAAGAAAAAAATATAGACATTTTCCAATTACGTGAAACTTTTCATAATAGTAAT 420
TCTAGAATATTGTTCAATCAAGAAAATAATAATTTTATGTATTCGTACACAGGGGGATAT 480
GATTTTACCTTATCCGCATATGTAATTAGATTATCGTCTGCCATAAAAATAATAAACGAA 540
ATTATAAAAAATAAAGGTATTTCTACCAGTTTAAGTTTTGAAATGTATAAGTTAGAGAAA 600
GAACTAAAACTAAATAGACAAGTTTTAAATGACTCATCTAAGTATATACTTCACAATACT 660
AAGTATTTGTCAAAAAAAAGAGCTAACGAAATGAAAAACGGTATATGGAATAGAGTTGGA 720
AAATGGATGGCTCATAGATTTCCTGATTTTTCTTACTATGTATCCCATCCATTGGTT 777
Claims (9)
1. a sheep poxP32 recombinations, have the base sequence as shown in sequence table SEQ ID NO.1.
2. the sheep pox provided such as claim 1P32 recombinations, it is characterised in thatP32 gene order sizes are 777 bp,
Be 98.32% with original series concordance, compared to original series, 78,119,123,215,275,281,286,492,571,
591,594,601,609 there is single base mutation, insert 3 bp bases at 102-103 interdigit, and amino acid number is 259,
Compared with original series, 28,42,43,72,111,113,115 aminoacid convert, and insert N aminoacid between 36-37, but
P32 Argine Monohydrochloride order does not change, isoelectric point, IP pI:9.10, relative molecular mass MW=30.268 kD.
3. a sheep pox as claimed in claim 1PThe preparation method of 32 recombinations, it is characterised in that by separating Xinjiang
Area capripox virus, extracts DNA, according to DNA profiling design upstream and downstream primer, uses polymerase chain reaction (PCR) preparation weight
Group gene.
Capripox virus the most according to claim 3 is recombinatedPThe preparation method of 32 genes, it is characterised in that infect from sheep pox
Separating capripox virus in the incrustation of sheep, breeding is cultivated, and extracts capripox virus DNA, carries out PCR with DNA profiling.
Capripox virus the most according to claim 3 is recombinatedPThe preparation method of 32 genes, it is characterised in that employing upper and lower
Swim primer respectively:
Forward primer:
5'-CCCAAGCTTACGATGGCCAGAATTAAAAAGTGGCAATGATAT-3'
Downstream primer:
5'-ACCGAATTCTGAAACCAATGGATGGGATACATAG-3'。
6. sheep pox as claimed in claim 1P32 recombinations prevent and treat, for preparation, the medicine that sheep pox is sick.
7. sheep pox as claimed in claim 1P32 recombinations prevent and treat, for preparation, the vaccine that sheep pox is sick.
8. one kind by the sheep pox described in claim 7P32 recombinations prevent and treat, for preparation, the vaccine that sheep pox is sick, and its feature exists
In, with attenuated salmonella typhimurium as live vector, will coding capripox virus restructuringPThe DNA vaccination plasmid submission of 32 genes arrives
Immune effector cell, this recombiant plasmid can be expressed in immune effector cellP32 albumen.
9. the preparation method of the vaccine preventing and treating sheep pox as claimed in claim 7, it is characterised in that by claim 1 institute
The sheep pox statedP32 recombinations are connected constructed dna vaccine recombiant plasmid pVAX1-with eukaryotic expression vector pVAX1P32, by its electricity
Convert escherichia coli X6212, obtain X6212/ pVAX1-P32, therefrom extract recombiant plasmid, heat shock method converts in Salmonella
Between host X3730, make recombiant plasmid obtain Salmonella typhimurium methylation patterns, then from X3730 bacterium separate restructuring matter
Grain, electricity converts final host bacterium X4550, it is thus achieved that live recombinant vectors DNA vaccination strain X4550/ pVAX1-P32。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610562276.8A CN106086043A (en) | 2016-07-15 | 2016-07-15 | Capripox virus restructuring P32 gene and structure and the application in preparing vaccine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610562276.8A CN106086043A (en) | 2016-07-15 | 2016-07-15 | Capripox virus restructuring P32 gene and structure and the application in preparing vaccine |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106086043A true CN106086043A (en) | 2016-11-09 |
Family
ID=57221370
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610562276.8A Pending CN106086043A (en) | 2016-07-15 | 2016-07-15 | Capripox virus restructuring P32 gene and structure and the application in preparing vaccine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106086043A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108101995A (en) * | 2017-12-27 | 2018-06-01 | 中国动物疫病预防控制中心 | Recombinate capripox virus fusion protein and its application |
| CN108164603A (en) * | 2017-12-27 | 2018-06-15 | 中国动物疫病预防控制中心 | Recombinate the solubility expression method of capripox virus fusion protein and its biomaterial used |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101275140A (en) * | 2007-12-27 | 2008-10-01 | 中国农业科学院兰州兽医研究所 | Cysticercosis cellulosae recombination gene, vaccin and preparation thereof |
| CN102233131A (en) * | 2011-07-07 | 2011-11-09 | 贵州大学 | Goat pox oral vaccine using attenuated salmonella as vector and preparation method |
| CN102266556A (en) * | 2011-07-07 | 2011-12-07 | 贵州大学 | P32 gene based DNA (deoxyribonucleic acid) vaccine for goat pox, and preparation method thereof |
| CN104415350A (en) * | 2013-09-11 | 2015-03-18 | 普莱柯生物工程股份有限公司 | Vaccine composition and preparation method and application thereof |
-
2016
- 2016-07-15 CN CN201610562276.8A patent/CN106086043A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101275140A (en) * | 2007-12-27 | 2008-10-01 | 中国农业科学院兰州兽医研究所 | Cysticercosis cellulosae recombination gene, vaccin and preparation thereof |
| CN102233131A (en) * | 2011-07-07 | 2011-11-09 | 贵州大学 | Goat pox oral vaccine using attenuated salmonella as vector and preparation method |
| CN102266556A (en) * | 2011-07-07 | 2011-12-07 | 贵州大学 | P32 gene based DNA (deoxyribonucleic acid) vaccine for goat pox, and preparation method thereof |
| CN104415350A (en) * | 2013-09-11 | 2015-03-18 | 普莱柯生物工程股份有限公司 | Vaccine composition and preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 谢芳 等: "山羊痘病毒P32基因真核表达载体的构建及表达", 《中国兽医学报》 * |
| 谢芳: "羊痘病毒P32基因的克隆及其在毕赤酵母中的表达", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108101995A (en) * | 2017-12-27 | 2018-06-01 | 中国动物疫病预防控制中心 | Recombinate capripox virus fusion protein and its application |
| CN108164603A (en) * | 2017-12-27 | 2018-06-15 | 中国动物疫病预防控制中心 | Recombinate the solubility expression method of capripox virus fusion protein and its biomaterial used |
| CN108164603B (en) * | 2017-12-27 | 2020-05-08 | 中国动物疫病预防控制中心 | Soluble expression method of recombinant capripoxvirus fusion protein and biological material used by same |
| CN108101995B (en) * | 2017-12-27 | 2020-05-12 | 中国动物疫病预防控制中心 | Recombinant capripoxvirus fusion protein and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104178505B (en) | A kind of expression E 2 gene of Classical Swine Fever recombinant virus and preparation method and application | |
| CN105801707B (en) | A kind of hemorrhagic disease of grass carp oral vaccine and its preparation and application | |
| CN104195116B (en) | A kind of recombinant Newcastle disease virus and its construction method for expressing goose parvovirus VP3 genes | |
| CN102221618B (en) | Method for establishing hog cholera lapinized virus labeled vaccine strain and preparing vaccine | |
| CN110527669A (en) | A kind of porcine pseudorabies virus gene delection strain and its construction method and application | |
| CN114561366B (en) | Goat kuraria virus isolate and application thereof | |
| CN107529534A (en) | A kind of protective antigens of secondary poultry bacillus and its expression and application | |
| CN109136198A (en) | A kind of expression Chicken Infectious Anemia Virus VP1, VP2 genetic recombination bird pox virus live vector vaccine | |
| CN103981192B (en) | Express recombined adhenovirus and its construction method and the application of goat alpha interferon | |
| CN106086043A (en) | Capripox virus restructuring P32 gene and structure and the application in preparing vaccine | |
| CN107345222A (en) | Express recombinant pseudorabies virus and its construction method and the application of Porcine epidemic diarrhea virus S1 albumen | |
| CN106834351A (en) | Duck tembusu virus subunit vaccine based on baculovirus expression system is prepared and applied | |
| Ling et al. | A recombinant adenovirus targeting typical Aeromonas salmonicida induces an antibody-mediated adaptive immune response after immunization of rainbow trout | |
| CN106755087A (en) | The stabilization expression recombinant cell lines of CSFV E 2 protein, preparation method, using and CSFV subunit vaccine | |
| CN106190943B (en) | It is a kind of it is dual-gene missing Bacterium enteritidis, its construction method and contain this it is dual-gene missing Bacterium enteritidis vaccine | |
| CN103614387B (en) | The carrying Cap gene of porcine circovirus type 2 gene optimized and recombinant plasmid and application | |
| CN107523531A (en) | A kind of genetic engineering bacterium containing pMG36e pgsA gp85 recombinant plasmids | |
| CN106794242A (en) | For the broad-spectrum vaccine of birds reovirus | |
| CN112063596A (en) | Pigeon paramyxovirus type 1 PPMV-1/BJ-C strain and application thereof | |
| CN109705223B (en) | Recombinant subunit vaccine of orf virus and production method thereof | |
| CN108265073A (en) | Express enteron aisle M like cells targeting peptides and the recombined bacillus subtilis of Porcine epidemic diarrhea virus S protein | |
| CN110079490A (en) | A kind of building and application thereof of BCG vaccine PhoPR gene overexpression bacterial strain | |
| CN107586788A (en) | A kind of construction method of pMG36e pgsA gp85 recombinant plasmids | |
| CN103834669A (en) | Oral vaccine of streptococcus agalactiae and preparation method thereof | |
| CN109517044B (en) | Porcine epidemic diarrhea virus genetic engineering antigen and antibody |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161109 |