CN106794242A - For the broad-spectrum vaccine of birds reovirus - Google Patents

Abstract

The broad-spectrum vaccine for birds reovirus is disclosed, it is effective that it reduces birds reovirus infection in birds target.The vaccine is comprising from two genotype groups as defined herein：The antigenic substance of 1 and 4 birds reovirus.For all birds reoviruses effectively, the birds reovirus is that homologous or heterologous including recent strong poison breaks through strain to vaccine to the vaccine.

Description

For the broad-spectrum vaccine of birds reovirus

The present invention relates to vaccine veterinary art, more particularly to for reducing birds reovirus（Reovirus）Infection Poultry vaccine.Further relate to the method for preparing the vaccine, and such vaccine medical usage.

Birds reovirus is divided to Reoviridae on taxology（Reoviridae）In just exhaling the lonely disease of intestines Poison（Orthoreovirus）The birds hepato-encephalomyelitis virus kind of category.Virion does not have envelope, but with double-deck protein coat (double-shelled protein capsid).The capsid contains in the presence of 10 double-stranded RNA genomes of section.Can be by Genomic segment is grouped into three size classifications：Greatly（L）, in（M）, and it is small（S）；These sections are encoded with reference to these sections Virus protein is respectively designated as：lambda（λ）、mu（μ）, or sigma（σ）.In Benavente ＆ Martinez-Costas The summary of birds reovirus structure is given in (Virus Res., 2007, the 105-119 pages).

Birds reovirus is to cause serious disease and the commercialization poultry farming business heavy economic losses in birds Important pathogen body；Most chicken, also turkey and other kinds of birds may be affected.Serious disease, or even Death is occurred mainly in immature birds, because to birds reovirus symptom and the age related resistance of infection in birds Just develop from about 4 weeks sizes.Symptom includes especially intestines and respiratory disease, myocarditis and hepatitis.It is most typically viral Property arthritis, causes the tenosynovitis in joint and tendon（Or：Reovirus arthritis）.Caused limping causes to be moved towards to raise It is difficult during case.Or, cause the viral intestinal disease of malabsorption to hinder effective conversion of feed.Two kinds of diseases are for quick Growth and the kind of heavier type, such as broiler chicken（Carnivorous type birds）It is particularly problematic.Equally, with some other viral and bacillary intestines Pathogen is combined, and birds reovirus is so-called ' growth retardation and runting syndrome（runting stunting syndrome）' factor.

All these symptoms cause animal to be subjected to pain and cause the economic loss due to butchering weight reduction and censure poultry Body poor quality.

The main path for controlling birds reovirus infection is the chicken by the directly inoculation very small age, or is passed through Breeder was inoculated with before its laying period（The hen of embryonated egg is produced for offspring）, (egg- is propagated to reduce egg Transmission), the antibody indirect and by maternal source protects chicken.

Birds reovirus can be cultivated in vitro, and for example well be replicated on primary Embryo liver cell. Duplication causes typical cytopathic effect (cpe), the big cell-plasomidum of its display.

Birds reovirus vaccine is usually complete viral vaccine, and it is attenuated live type, or inactivation type.Commodity Change the example of birds reovirus vaccine（MSD AH are all from, Holland）It is：Live vaccine：Nobilis Reo 1133, or Nobilis® Reo 2177；Or inactivation-adjuvanted vaccine, such as Nobilis Reo Inac are (comprising the He of strain 1733 2408).The origin of S1133 vaccine strains trace back to the 1980s early stage (Van der Heide etc., 1983, Avian Dis., volume 27, the 698-706 pages), but it is still using so far.

In the recommendation vaccination regimen of standard, at least twice for birds reovirus inoculation kind fowl：Very small Age utilizes live vaccine primary vaccination（Trigger）, and using inactivated vaccine secondary inoculation after some weeks（Strengthen）.According to field The seriousness of (field infection) pressure is infected, another time can be after a few weeks given and be strengthened, and plant fowl generally about 16-18 week old, that is, receive further booster shot in 4-6 weeks before beginning of laying eggs.In fact, the sense of field birds reovirus Dye pressure is simultaneously not always high, thus can meet many poultry farms masters by giving chicken or breeder and being only once inoculated with.So And in the case of the birds reovirus infection outburst of strong poison, offspring chicken may not fully be protected from field sense Dye.

By effective humoral immune response, exempting from for birds reovirus is obtained for some virus structural proteins Epidemic disease is protected.However, main virus immunity original is outer capsid proteins sigmaB and sigmaC；SigmaB (or：σ B) it is main , and sigmaC (σ C) albumen is secondary outer capsid proteins.SigmaC is attached on host cell in virion and acts as With.It is encoded by 3rd ' area of S1 genomic segments, and about 326 amino acid of size.It was found that sigmaC albumen exists than sigmaB Change in antigenicity it is much bigger (WO 2009/093251, and:Meanger et al., 1995, Avian Pathol., the 24th Volume, the 121-134 pages).

It is generally acknowledged that the effective inoculation for birds reovirus is merely able in birds reovirus vaccine field Obtained by homologous vaccine, thus for from vaccine antigen identical serotype group in virus (Wood etc., 1986, Comp. Pathol., volume 86, the 125-129 pages).Therefore, birds reovirus vaccine has been based on coming for many years From the antigen of different single serotype groups.Standard inoculation program pin is to reovirus serum present in locality group Type；Repeated inoculation then provides solid immunity.

When the birds reovirus of more than one serotype is dominant in a region, such as by using birds ' classics ' vaccine strain of reovirus, such as S1133,1733,2177 or 2408 are applied to trigger and are inoculated with, and using for for example The booster vaccine of ERS strains follows up and replaces these vaccines in initiation and booster shot.For many years, these are fields prevailing The main Types of birds reovirus.

Used as RNA virus, birds reovirus can undergo mutation in its genome.In fact, this causes in field Between accidentally brush against new variant, it can be that virulence is higher or lower.However, the problem of this aspect is effectively to distinguish birds to exhale The difficulty of the lonely virus of intestines, because serological test may show the variability of result.Thus, for being tested by plaque subtrahend （plaque-reduction assay）In middle use polyclonal serum Test Virus and/or by using one group of monoclonal antibody The birds reovirus strains for determining specific binding pattern to identify, referring to 2177 strains (EP 687.728) and ERS poison The sign of strain (EP 1.024.189).

Or, can be by the principal disease symptom of virus induction, such as：Tenosynovitis, malabsorption or neurological symptoms result are come Characterize birds reovirus strains (for example, ERS strains of the inducing neurological symptom as described in EP 1.551.961).So And, due to pathogenic heterogeneity, this is not completely specified.

Recently, on the basis of molecular diagnostics, birds are completed and exhales intestines by comparing viral amino acid or nucleotide sequence The classification of lonely virus.It was found that the comparing of the amino acid sequence of sigmaC albumen is especially useful that in this aspect, because it is fowl The maximum variable of class reovirus protein：Show that only 35% amino acid sequence is same between minimum related birds separation strains One property (J. M. Day, 2009, Inf. Gen. ＆ Evolution, volume 9, the 390-400 pages).

Some scientists have passed through Phylogenetic Analysis, the amino acid sequence identity description based on its sigmaC albumen The packet of birds reovirus separation strains.Due to more and more sigmaC albumen from birds reovirus separation strains Sequence starts to be obtained in public database, so finer analysis becomes possibility.For example：Kant etc. (2003, Vet. Res., volume 34, the 203-212 pages) have been described birds reovirus is divided into 5 main genotype Group.Between serotype group and genotype group, or without discovery correlation between disease group and genotype group：It is all types of Birds reovirus relevant disease may arise from the infection of the birds reovirus from any genotype group.

Using different parameters, the other systems development research based on sigmaC analysis of protein describes another packet： Liu etc. (volume 2003, Virology, 314, the 336-349 pages), defines 6 pedigrees；Lublin etc. (2011, Vaccine, volume 29, the 8683-8688 pages), define 4 genotype groups.

The system of the descriptions such as Kant（It is divided into 5 genotype groups）Seem that receiving most science supports.In the classification In, ' classics ' birds reovirus vaccine strain is each fallen within the genotype group 1 of Kant, and ERS strains fall into the base of Kant Because in type group 5.

Lublin etc. (above) have studied the inoculation for different genotype group.It is main with birds reovirus vaccine The common recognition for carrying out same source protection is consistent, and they have found that the vaccine effectively for all different genotypes of birds reovirus must Must be containing from these respective antigenic substances of genotype group.

In recent years, breakthrough (break-through) the infection quantity of birds reovirus has been increased sharply.From about 2009 - 2013 years, some birds reovirus outbursts are there occurs in Europe and the U.S., thus chicken group occurs in that tenosynovitis, absorbs not It is good, in addition death serious birds reovirus infection symptom；This in chicken although be still suitably vaccinated with commercialization Under the fact that birds reovirus vaccine.This proof has been developed the new birds reovirus strains of strong poison, and passes through Allusion quotation and ERS types vaccine always can not be protected effectively.

Troxler etc. (2013, Vet. Record, volume 172, page 556) analyzes French Liang Ge areas and exists Many outbursts between 2011-2012.Depend on that Kant etc. (above) describes by by the amino acid sequence of SigmaC albumen During row compare and for birds reovirus strains to assign to 5 genotype groups, the outburst that Troxler etc. separates them from France Strain is categorized as the subclass of the genotype group 1 of Kant.

Because present vaccine seems that effectively can not break through strain, Troxler etc. for these modern times is repeated The suggestion of Lublin etc., i.e., extensive cross-protection vaccine needs to mix all genotype groups of birds reovirus.

Therefore, exist in the urgent need to so that the vaccine for birds reovirus can be obtained in home poultry raising field, it is described Vaccine has extensive protectiveness, and it is also effective to break through strain for strong poison in the recent period.

Thus, the shortcoming it is an object of the present invention to overcome prior art, and it is described to adapt to by providing such vaccine This needs in field, the vaccine can reduce wide spectrum birds reovirus, and especially birds reovirus is recent Strong poison breaks through the infection of strain.

Surprisingly it was found that the target can be realized, and therefore can exhale the lonely disease of intestines by providing reduction birds The vaccine of poison infection overcomes the shortcoming of prior art, and thus the vaccine includes birds reovirus antigenic substance, and it is based on The amino acid sequence of viral sigmaC albumen compares only two of five genotype groups from birds reovirus.

It was found that recent breakthrough of the vaccine by almost reducing birds reovirus completely after only single inoculation is separated Strain duplication and broad spectrum protection is provided.

It is between the present inventor has analyzed 1993 to 2013 years and quick-fried from some national birds reoviruses About 150 parts of samples of hair.It is interesting that when the amino acid sequence of its sigmaC albumen is compared, new separate birds exhale intestines Lonely virus belongs to all genotype groups as detailed below.This is extended on the basis of the discovery of Troxler etc., and is shown Show that recent birds reovirus outburst is not as caused by any specific gene type of birds reovirus.But seemingly There is the generally change of virus characteristic, it causes that currently available vaccines, existing vaccines validity is relatively low.Accordingly, it would be desirable to updating birds exhales the lonely disease of intestines Malicious vaccine, and the vaccine for being updated will need to be protected for all existing virogene types.

For the present invention, the amino acid sequence based on its SigmaC albumen divides birds reovirus strains and separation strains It is 5 genotype groups, as defined herein.Effective division of all known strains is these gived, and divides breakthrough poison in the recent period The mode of strain.Equally, it is found that the genotype for being so divided into 5 genotype groups and Kant etc. (above) description divides tight Match somebody with somebody.

Inventor has surprisingly observed that based on two genotype groups from birds reovirus：Genotype group 1 and 4 There is the vaccine of the particular combination of antigenic substance broad spectrum protection to act on.Conversely, exhaling intestines containing the birds from genotype group 1 and 5 The similar vaccine of lonely virus antigen material does not provide the extensive protection.

This new vaccine provides the broad spectrum protection for birds reovirus replication for target birds, because the vaccine Almost can completely reduce the duplication of birds reovirus in target.This be applied to from the antigenic substance that includes in vaccine The birds reovirus of identical genotype group（Homologous birds reovirus）, and from anti-different from what is included in vaccine The birds reovirus of the genotype group of the genotype group belonging to original matter（I.e. heterologous birds reovirus）.The inoculation is imitated Fruit has obtained after single inoculation, and also effective even for the recent strong poison outburst strain of birds reovirus.

Therefore, this broad-spectrum vaccine new for birds reovirus reduces birds in the animal of inoculation and exhales intestines orphan The disease of virus induction.Equally, by reducing virus load, the propagation of virus is which reduced.

This be the failure to expect, and with period this area of the invention in general points of view directly conversely, typically recognizing at that time For birds reovirus vaccine is fully effective only for homologous virus, and can not provide effective for different genotype group Heterologous protection, and be may require that at least twice using just effective by this inoculation of standard.Really, this by Lublin etc. (on Text) confirm, it is based on the antigenic substance from the respective representative of genotype group and tests extensive birds reovirus Vaccine.

Therefore, when the suggestion of this area is followed, exploitation breaks through strain for these modern times of birds reovirus Effective vaccine with extensive protection may require that the antigen thing including the birds reovirus from all genotype groups Matter.

Why this particular combination of the antigenic substance from birds reovirus gene type group 1 and 4 can be provided The effective wide spectrum effect of inoculation is unknown.Although the present inventor is not desired to by any theoretical or mould that may explain these observations Type is fettered, but they speculate that this particular combination of the antigenic substance of the birds reovirus from genotype group 1 and 4 is certain The antigen combination of triggering immune response is presented for the immune system of target birds, the immune response is exhaled for different birds The extensive antigentic specificity that intestines orphan's virogene type group is presented is cross protection.

Thus, on the one hand, the vaccine the present invention is provided to reduce birds reovirus infection, the vaccine is comprising next Come from the birds reovirus antigenic substance from the birds reovirus more than individual gene type group and can pharmaceutically connect The carrier received, wherein the birds reovirus antigenic substance origin is come from from two genotype groups：Genotype group 1 and base Because the antigenic substance of the birds reovirus of each of type group 4 is constituted.

As apparent to those skilled in the art, the broad-spectrum vaccine that can be based on the only antigen of limited quantity provides phase For some clear superiorities of the more extensive combination-vaccine comprising the antigen from all genotype groups.These advantages are essentially consisted in The saving significantly in artificial and capital that can be obtained by this way, this is carrying due to production, storage and quality control Efficiency high and simplification.

It is known that " vaccine " is the composition with inherent medical effect, it includes immunoactive component and pharmaceutically may be used The carrier of receiving.' immunoactive component ' is the antigen molecule recognized by the immune system of target（Combination）, it is described immune System induction protective immune response.The response may originate from the congenital and/or acquired immune system of target, and can Can be cell and/or body fluid type.

For vaccine of the invention, the immune response induced in the target animal of inoculation is with " reducing birds exhales intestines lonely sick The effect of poison infection ".This refer to for example by reducing virus load or shortening host animal in duration of virus replication subtract The level or degree of few infection.

The effect can be by its target organ, such as preventing or reducing birds reovirus production infection in tendon or intestines Foundation or propagation and obtain.Then, this causes the damage that may be caused by virus infection in target animal and clinical sign The reduction of quantity, intensity or seriousness.The vaccine is colloquially called the vaccine of ' being directed to ' birds reovirus, or ' birds exhale Intestines orphan viral vaccine '.

Determine vaccine of the invention for reducing the validity of birds reovirus infection completely in the skill of general doctor Can be interior, and can for example by monitoring immune response after inoculation or after challenge infection, for example by the disease of monitoring objective Sign, Clinical scores, serology parameter, or separating again by pathogen, and compare these results with simulation inoculation animal in The inoculation seen-attack response is completed.

Multiple embodiments, preferably and example of vaccine of the present invention will below be summarized.

" birds reovirus " is known in the art, and is belonging to the virus of birds hepato-encephalomyelitis virus kind.Example Such as in well-known reference book, as：" The Merck veterinary manual " (the 10th edition, 2010, C.M. Kahn is edited, ISBN:091191093X), and：" Diseases of Poultry " (the 12nd edition, 2008, Y.M. Saif is edited, ISBN-10:0813807182) disease of these viruses and its induction is described in.

Birds the reovirus exhibits performance characteristic of its taxon-member, such as morphology, genomics and bioid Learn feature, and biological property, such as physiology, immunology or pathological behavior.As it is known in the art, the classification of microorganism Combination based on these features.The present invention thus also include such birds reovirus, it is thus sub- by any way It is categorized as such as subspecies, strain, separation strains, genotype, variant, hypotype or subgroup etc..

Although it is apparent to the skilled person that, birds reovirus of the invention be classified at present specific kind or Category, but to be taxology divide for this, and as new viewpoint causes to repartition into new or different taxology group, it can be with Change in time.However, because this does not change microorganism in itself, or its antigen repertoire, but only its scientific name or Classification, so the microorganism repartitioned still is within the scope of the present invention.

" include as the term is employed herein（comprising）”（And variation, such as " include（comprise）", " include （comprises）" and " include（comprised）”）Refer to all key elements, and be possibly used for any possible combination of the invention In, it is wherein covered or is included therein using the textual portions of the term, paragraph, claims etc., even if not bright Really quote such key element or combination；And not refer to any such key element of exclusion or combination.Therefore, any such textual portions, Paragraph, claims etc. relate to one or more embodiments, wherein the term " is included（comprising）” （Or its variation）By term as " by ... constitute（consist of）", " by ... constitute（consisting of）" or " substantially By ... constitute（consist essentially of）" replaced.

" antigenic substance " of the invention can be derived from any types of birds reovirus of the invention in principle Material, as long as it can be with inducing protective immunity response（By itself or together with adjuvant）.Therefore antigenic substance must have Have such size, structure, form or quality, thus its inoculation target birds in induce immune response have it is enough Intensity is can reduce the infection of birds reovirus.

Antigenic substance of the invention can be the birds reovirus of science（I.e. ' living（life）' birds exhale intestines Lonely virus）；Inactivation（' kill '）Birds reovirus；Or the part of birds reovirus, such as subunit, extract, Fraction, homogenate or ultrasonic thing.

When antigenic substance of the invention is the part of birds reovirus, it can be protein, lipoprotein, sugared egg In vain, the combination of nucleic acid molecules or one or more in these.Antigenic substance can be with biogenetic derivation or synthesis source, and can Directly or indirectly to derive from birds reovirus of the invention.

For the present invention, " protein " refers to the strand of amino acid.Protein does not have specific length, structure or shape, And when needing, can in vivo or in vitro for example by glycosylation, amidatioon, carboxylation, phosphorylation, Pegylation, or sky Between fold change and be modified.Protein can be natural or maturation albumen, preceding albumen or former albumen, or albumen portion Point.Protein can be biogenetic derivation or synthesis source.Especially, polypeptide and peptide are included in this definition of protein.

For the present invention, antigenic substance " deriving from " birds reovirus of the invention, if it is obtained by any way Derive from birds reovirus or part thereof.For the antigenic substance that the present invention is obtained can advantageously be included in carrier, such as buffer In liquid, and preferably will be liquid form, to allow to use or operate antigenic substance of the invention.Technical staff is fully able to choosing Select and use suitable carrier for the purpose.

The example for deriving the mode of antigenic substance of the present invention from birds reovirus can be in suitable host cell Middle propagation birds reovirus of the invention, can collect thereafter virus, and enter by standard technique known in the art Row is separated.Collected duplicating virus can be used in the case of with or without host cell or part thereof.

, such as using heat, radiation, or chemicals can also be utilized by using any suitable technology, such as formalin, β- Propiolactone, binary ethylenimine (binary ethyleneimine) or β-ethanolamine treatment science birds reovirus are obtained The birds reovirus of the invention of deactivated form.

In addition, from birds reovirus of the present invention antigenic substance can be birds reovirus part, Such as subunit, extract, fraction, homogenate or ultrasonic thing.These can be prepared by standard technique known in the art, and And can be from duplicating virus or since the virus of inactivation.The virus for being used can derive from viral cultures, such as originate In cell-sediment, culture supernatant or complete culture.

Can also be derived by the expression birds reovirus gene in the cell of recombinant dna expression system of the invention Antigenic substance：For example by centrifugation or can filter, be optionally followed by concentrating collect and purify these cells, supernatant or complete Whole culture.Or, when expressed albumen stay in expression system it is intracellular when, these cells, and albumen can be collected Matter can be produced as subunit, extract, fraction, homogenate or the ultrasonic thing of these cells.These are in the art well-known 's.Easily expression system comes from bacterium, yeast, insect, plant or mammal source；For example：Escherichia coli （Escherichia coli）, bacillus subtilis（Bacillus subtilis）, genus lactubacillus kind（Lactobacillus sp.）, or crescent shank bacterium（Caulobacter crescentus）；Saccharomyces cerevisiae（Sacharomyces cereviseae）、 Pichia pastoris（Pichia pastoris）；Insect Cell/Baculovrius Expresion System, fruit bat；Tobacco；Or Hela or Chinese hamster ovary celI.

Method and material needed for obtaining birds reovirus antigenic substance of the invention be virology, biochemistry and Standard technique in molecular biology, it is known to technical staff.For example, being obtained from birds reovirus of the invention Viral RNA is to prepare cDNA and operate molecule-biology techniques and material that it is used for expression as known in the art, and example Such as it is described extensively in well-known reference book, such as：Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989); Basic Methods in Molecular Biology, Elsevier Science Publishing Co., Inc., N.Y. (1986)；With：Sambrook ＆ Russell, 2001, in: ‘Molecular cloning:A laboratory manual ', the 3rd edition New York, USA: Cold Spring Harbour Laboratory Press。

" genotype group " in the context of birds reovirus of the invention refers to many birds reoviruses point From strain, the comparison result of its amino acid sequence that can be based on their Sigma C proteins is grouped together, as described herein. Member in the group is related by having the amino acid sequence identity of its Sigma C protein of a certain minimum level.So Define 5 genotype groups of birds reovirus.

The amino acid sequence identity be relatively well-known method determine the evolution affiliation between albumen or ' systematic growth '.It is expressed as when relevant position between comparing amino acid sequence identical amino acid relative to compare albumen with The percentage of the length of amino acid number meter.Note：This can not obscure with sequence similarity, the different but phase in the similitude As amino acid be also counted.

Preferably using computer program carries out the comparison to be automated（It is multiple）Pairing is compared.

In order to set up the purpose of birds reovirus gene type group of the invention, decisive test is by using calculating Machine program：" SEQUENCES of BLAST 2 ", it can be obtained on NCBI webpages（By selecting " bl2seq ", and subprogram: " blastP ", it can see： http://blast.ncbi.nlm.nih.gov/Blast.cgi）, the ginseng given tacit consent to using it Number is set.The mode that program optimization two sequences are compared, and illustrate identical match between overlapping region, and amino acid Number and percentage.

For the present invention, amino acid alignment is carried out on the amino acid/11-277 of sigmaC albumen, wherein from rise The methionine of beginning codon is counted as first amino acid.

The comparison score list of birds reovirus is presented in institute's subordinate list in multiple genotype groups.

In order to represent the evolutionary relationship in genotype group and between genotype group, comparison result can be rendered as systematic growth Tree.This can also for example (for example can be from network address using program PHYLIP:Www.phylogeny.fr is obtained) or MEGA (Tamura etc., 2013, Mol. Biol. and Evol., volume 30, the 2725-2729 pages;Latest edition: MEGA6) completed by computer.It is expressed as the phylogenetic tree of the genotype group of the birds reovirus that the present invention is analyzed Figure be presented in institute's accompanying drawing.

In public database such as GenBank or EMBL, sigmaC albumen at present can be from more than 200 amino acid sequences Obtained in various birds reovirus separation strains.This allows being compared property to compare, and by disclosed birds reovirus Strain is divided in genotype group as defined herein.

In addition to a large amount of common sequence information, the present inventor can obtain the sigmaC albumen of many recent outburst strains Amino acid sequence.Detailed description is in Examples below part；In brief：Tissue sample is homogenized, and is cultivated to expand Any virus.Viral RNA is extracted, and the primer (Liu etc., above) that SigmaC is special, amplification coding are used in RT-PCR The birds reovirus gene group part of SigmaC albumen, uses standard technique.It is then determined that the nucleotide sequence of the cDNA, And DNA sequence dna translates into the amino acid sequence of supposition.Then this is compared with other SigmaC sequences, it is quick-fried for determining Send out the genotype group of separation strains.As described, identifying the representative of all 5 genotype groups in separation strains are broken out.

The many representative SigmaC protein amino acid sequences for breaking through separation strains from all 5 genotype groups are presented on In appended sequence table.

Found from these analyses, when science birds reovirus contains the heredity letter of the such SigmaC albumen of coding During breath, birds reovirus of the invention is divided and belongs to genotype group 1, and the SigmaC albumen has and SEQ ID NO. 1 （The amino acid sequence of the SigmaC albumen of birds reovirus separation strains SL11A0823-2 BE）Amino acid sequence have At least amino acid sequence of 57% amino acid sequence identity.

Similarly, when science birds reovirus contains the hereditary information of the such SigmaC albumen of coding, this The birds reovirus of invention is divided and belongs to genotype group 4, and the SigmaC albumen has and SEQ ID NO. 4（Separation strains Nr. the amino acid sequence of SL11A0823-1 BE）Amino acid sequence have at least 66% amino acid sequence identity amino Acid sequence.

Term " science " be used for refer to replicate birds reovirus, it is as science, non-inactivation or ' living ' virus.So, using the antigenic substance from birds reovirus, the birds exhale intestines lonely to vaccine of the invention Virus is science on some time points, and then has the SigmaC eggs of illustrated level of sequence identity containing coding White hereditary information.However, this is not offered as antigenic substance still needing in itself completely containing the hereditary information or complete.

" pharmaceutically acceptable carrier " be the immunocompetence compound in vaccine preparation, storage or apply in help Agent, it does not come to the health care belt of the target animal applied（Serious）Side effect.The carrier may, for example, be sterilized water, or physiology Salt solution or phosphate buffered saline.The more complicated form of carrier may, for example, be buffer solution, and it can include other additives, Such as stabilizer or preservative.Details and example are for example described in well-known reference book, such as " Remington: the science and practice of pharmacy” (2000, Lippincot, USA, ISBN:683306472), and: " Veterinary vaccinology " (P. Pastoret etc. are edited, 1997, Elsevier, Amsterdam, ISBN 0444819681) in.

Belong to the birds reovirus of genotype group 1 or 4 therefore can be used for preparing vaccine of the invention.Such birds Reovirus is described in detail in embodiment part herein, and equally they are also known in the art, and can be by skill Art personnel be readily available.

For example, birds reovirus can be used from the birds reovirus sample that can openly obtain；These may Divide already and belong to genotype group 1 or 4, or can be easily divided with as described herein.Such sample can from many universities and （Poultry）Research institution, and storing mechanism such as ATCC (Manassas, VA, USA), CNCM (Institut Pasteur, Paris, France), or ECACC (Porton Down, UK) acquisitions.

Or, can be from the clinical sign of displaying birds reovirus infection, such as viral arthritis or malabsorption The field sample of chicken obtain the birds reovirus of genotype group 1 and 4.Can from the organ of infected birds, such as from： Tendon, gambrel, liver, spleen or intestines such as jejunum obtain sample.Virus can in vitro be cultivated and for example can trained in cell In supporting birds reovirus is accredited as from its typical cpe or using birds reovirus specific antibody.Can also lead to RT-PCR is crossed, document or Primer Analysis viral RNA described herein is used.The computer of next step sigmaC amino acid sequences Analyze the genotype group by sample is indicated.

Using these methods, the present inventor is separated and analyzes a large amount of birds reovirus separation strains.The present invention Two kinds from these of vaccine in prepare, its 2011 from Belgium different chicken farm birds reovirus break through Strain is separated；Separation strains title is：SL11A0823-2BE and SL11A0823-1BE.These are respectively divided and belong to as defined herein Genotype group 1 and 4.The amino acid sequence of its SigmaC albumen is presented in SEQ ID NO respectively:In 1 and 4.

Vaccine is prepared using standardization program, in brief：Virus, and plaque purification have been expanded from the sample of field （plaque purified）Three times.Next step, in dimension Lip river（Vero）Virus is cultivated on cell, is gone out using formalin It is living, and concentrate, virus antigen material light mineral oil and emulsifying agent are then formulated as water-in-oil emulsion.

Single dose vaccine is applied to the SPF laying hens of different disposal group by intramuscular administration.Received since after inoculation 5 weeks Collect the fertile egg of these inoculation chickens.By these egg incubations, and the lonely disease of intestines is exhaled using the science birds from different genotype group Poison gives offspring chicken and attacks inoculation.After the challenge virus in the blood sample obtained for 3 days after detecting attack inoculation determines The vaccine efficacy in generation.

Describe inoculation result in detail in embodiment part, but only observe and contain the fowl from genotype group 1 and 4 The vaccine of class reovirus antigen has effective broad spectrum protection：From the chicken of repeatedly homologous or Heterologous Challenge inoculation is received Almost it is not separated to challenge virus.

Conversely, receiving the chicken group of the vaccine of the antigenic substance containing the single separation strains for being only from birds reovirus Protected only for homologous challenge strain；Nonvaccinated control is all positive to the challenge virus in all samples；And Combination-vaccine with the birds reovirus antigen from genotype group 1 and 5 is only for attacking from genotype group 1 or 2 Virus is hit to be protected, it is identical with the vaccine of multivalent genetic type 1.

In preferred embodiments, the birds reovirus for belonging to genotype group 1 of the invention contains coding SigmaC albumen（Science）Hereditary information, the sigmaC albumen has and has with the amino acid sequence of SEQ ID NO. 1 The amino acid sequence of at least 58% amino acid sequence identity.More preferably：With preferred sequence, the ammonia with SEQ ID NO. 1 Base acid sequence have 59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79, 80th, the amino of 81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99 or even 100 % Acid sequence identity.

In preferred embodiments, the birds reovirus for belonging to genotype group 4 of the invention contains coding SigmaC albumen（Science）Hereditary information, the sigmaC albumen has and has with the amino acid sequence of SEQ ID NO. 1 The amino acid sequence of at least 67% amino acid sequence identity.More preferably：With preferred sequence, the ammonia with SEQ ID NO. 4 Base acid sequence have 68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88, 89th, the amino acid sequence identity of 90,91,92,93,94,95,96,97,98,99 or even 100 %.

In the embodiment of vaccine of the present invention, birds reovirus antigenic substance origin comes from two kinds of birds and exhales intestines lonely The antigenic substance composition of virus；The first is science birds reovirus, its heredity letter for containing coding sigmaC albumen Breath, the sigmaC albumen has the amino acid sequence identity for having at least 57% with the amino acid sequence of SEQ ID NO. 1 Amino acid sequence；And second is science birds reovirus, its hereditary information for containing coding sigmaC albumen, The sigmaC albumen has the ammonia of the amino acid sequence identity for having at least 66% with the amino acid sequence of SEQ ID NO. 4 Base acid sequence.

For the present invention, indicate " first " and " second " be only used for it is convenient refer to, do not illustrate any numerical order or from Category relation.

In preferred embodiments, the first birds reovirus contains coding sigmaC albumen（Science）Lose Biography information, the sigmaC albumen has has at least 58% amino acid sequence same with the amino acid sequence of SEQ ID NO. 1 The amino acid sequence of one property.More preferably：With preferred sequence, have 59 with the amino acid sequence of SEQ ID NO. 1,60,61, 62、63、64、65、66、67、68、69、70、71、72、73、74、75、76、77、78、79、80、81、82、83、84、85、86、 87th, the amino acid sequence identity of 88,89,90,91,92,93,94,95,96,97,98,99 or even 100 %.

In preferred embodiments, second birds reovirus contains coding sigmaC albumen（Science）Lose Biography information, the sigmaC albumen has has at least 67% amino acid sequence same with the amino acid sequence of SEQ ID NO. 4 The amino acid sequence of one property.More preferably：With preferred sequence, have 68 with the amino acid sequence of SEQ ID NO. 4,69,70, 71、72、73、74、75、76、77、78、79、80、81、82、83、84、85、86、87、88、89、90、91、92、93、94、95、 96th, the amino acid sequence identity of 97,98 or even 100 %.

In the analysis of the recent breakthrough strain of birds reovirus, the inventors discovered that being divided into genotype group 1（Such as Define herein）Most of separation strains actually form such genotype subgroup, it is sufficiently different from and falls within genotype The classical vaccine type strain of group 1.The discovery of this with Troxler etc. (above) is also consistent.The present inventor is thus by classical fowl The genotype group of class reovirus vaccine strain is appointed as genotype subgroup 1A, and will break through the gene of this part of separation strains Type group is appointed as genotype subgroup 1B.

Thus, in the embodiment of vaccine of the present invention, from the antigen thing of the birds reovirus of genotype group 1 Birds reovirus of the matter from genotype subgroup 1B.

It is of the invention when the birds reovirus of science contains the hereditary information of the such sigmaC albumen of coding Birds reovirus is divided and belongs to genotype subgroup 1B, and the sigmaC albumen has the amino acid sequence with SEQ ID NO. 1 Row have the amino acid sequence of at least 78% amino acid sequence identity.

In other embodiments, the birds reovirus for belonging to genotype subgroup 1B of the invention contains coding so SigmaC albumen（Science）Hereditary information, the sigmaC albumen has and has with the amino acid sequence of SEQ ID NO. 1 There is the amino acid sequence of at least 79% amino acid sequence identity.More preferably：With preferred sequence, with SEQ ID NO.'s 1 Amino acid sequence has 80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99 or very To the amino acid sequence identity of 100 %.

In order to correctly characterize other genotype groups of birds reovirus used herein, these can also be by it SigmaC albumen is defined relative to the amino acid sequence identity level of reference amino acid sequence：

When the birds reovirus of science contains the hereditary information of the such sigmaC albumen of coding, birds of the invention Reovirus is divided and belongs to genotype subgroup 1A, and the sigmaC albumen has and GenBank accession number AAB61607 (fowl Class reovirus strains 1733) middle amino acid of the amino acid sequence for representing with least 79% amino acid sequence identity Sequence.More preferably：With in preferred sequence, with GenBank accession number AAB61607 represent amino acid sequence have 80,81, 82nd, the amino acid sequence of 83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99 or even 100 % Homogeneity.

It is of the invention when the birds reovirus of science contains the hereditary information of the such sigmaC albumen of coding Birds reovirus is divided and belongs to genotype group 2, and the sigmaC albumen is with (birds exhale intestines lonely with SEQ ID NO. 2 The amino acid sequence of the SigmaC albumen of virus isolated strain SL11A0294-12 FR) amino acid sequence have at least 58% The amino acid sequence of amino acid sequence identity.More preferably：With preferred sequence, the amino acid sequence with SEQ ID NO. 2 has Have 59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83, 84th, the amino acid sequence identity of 85,86,87,88,89,90,91,92,93,94,95,96,97,98,99 or even 100 %.

It is of the invention when the birds reovirus of science contains the hereditary information of the such sigmaC albumen of coding Birds reovirus is divided and belongs to genotype group 3, and the sigmaC albumen is with (birds exhale the lonely disease of intestines with SEQ ID NO. 3 The amino acid sequence of the SigmaC albumen of malicious separation strains SL10A1581-32 ES) amino acid sequence have at least 57% ammonia The amino acid sequence of base acid sequence identity.More preferably：With preferred sequence, the amino acid sequence with SEQ ID NO. 3 has 58、59、60、61、62、63、64、65、66、67、68、69、70、71、72、73、74、75、76、77、78、79、80、81、82、 83rd, the amino acid sequence of 84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99 or even 100 % is same Property.

It is of the invention when the birds reovirus of science contains the hereditary information of the such sigmaC albumen of coding Birds reovirus is divided and belongs to genotype group 5, and the sigmaC albumen is with (birds exhale intestines lonely with SEQ ID NO. 5 The amino acid sequence of the SigmaC albumen of virus stain ERS) amino acid sequence have at least 65% amino acid sequence it is same The amino acid sequence of property.More preferably：With preferred sequence, have 66 with the amino acid sequence of SEQ ID NO. 5,67,68,69, 70、71、72、73、74、75、76、77、78、79、80、81、82、83、84、85、86、87、88、89、90、91、92、93、94、 95th, the amino acid sequence identity of 96,97,98,99 or even 100 %.

In embodiments, the antigenic substance of the invention from birds reovirus is：Science birds exhale intestines Lonely virus, the birds reovirus of inactivation, or birds reovirus part, such as the subunit of birds reovirus, carry Take thing, fraction, homogenate or ultrasonic thing.The birds reovirus for more preferably inactivating.

When antigenic substance be inactivation birds reovirus, or birds reovirus part when, the antigen Material still contains the birds reovirus for facilitating immune response（All）Component.

When antigenic substance be inactivation birds reovirus, or birds reovirus part when, epidemic disease of the present invention The amount of the birds reovirus antigenic substance included in seedling is between the μ g/ animal dosage of about 1- about 1000.Birds exhale the lonely disease of intestines The preferred amounts of malicious antigenic substance are between the μ g/ dosage of about 10- about 500；More preferably between 10-250 μ g/ dosage, and 25- Between 100 μ g/ animal dosage.

For the present invention, the preferred amounts of birds reovirus antigenic substance/animal dosage can respectively with from two Genotype group 1 is related to the amount of 4 respective antigenic substances, or both combination amount it is related.Equally, from a kind of genotype group The amount of antigenic substance/animal dosage need not be identical with the amount of the antigenic substance of other genotype groups.The last embodiment Allow further to optimize vaccine efficacy of the invention by adjusting the amount of antigen in absolute and relative meaning.

When the antigenic substance from birds reovirus of the invention be inactivation birds reovirus form or During the part of birds reovirus, then may be referred to for inactivating or extracting, being classified separation (fractionation), even The amount of the duplicating virus of slurry etc. is come the amount of expression/animal dosage.Or, can be with Biochemical Nomenclature, the glairy amount of example, or Relative to known standard, with the arbitrary Elisa units amount of expression/animal dosage.It is all these be technical staff institute it is ripe Know.

When the antigenic substance from birds reovirus of the invention is science birds reovirus, then Viral amount/animal the dosage of vaccine of the invention is based on tight when the birds reovirus or its subunit of inactivation less as vaccine Lattice.Because science birds reovirus will breed the up to biological viremia virusemia that can be born in target birds （vireamia）Level.However, it is necessary to give minimum dose to realize effective ' acquisition ' of ' work ' vaccine.In this aspect, exist Different modes quantifies science birds reovirus；It is expedient to such one kind, it titrates real in such as tissue cultures Test, or permissive cell layer on Plaque determination in count actual live virus particle.Birds reovirus of the invention Amount and then the units or plaque forming unit (pfu) that can be expressed as in terms of TCID 50% (TCID50). Equally, effective inoculum dosage is constituted to depend on being used for the vigor of specific reovirus of the invention and replicate intensity.

When the antigenic substance from birds reovirus of the invention is science birds reovirus, this hair The preferred amounts of the science birds reovirus of bright vaccine with this preferred sequence, in the fowl of about 10- about 1x10^7 TCID50 Between class reovirus/animal dosage, more preferably 1x10^2-1x10^6,1x10^2-1x10^5,1x10^2-1x10^4 it Between, or even between 500-5000 TCID50/ dosage.

Vaccine of the invention can be applied with the acceptable volume of target animal, and volume can be for example in about 0.1- about Between 10ml.Preferably, a kind of dosage is the volume between about 0.2- about 3ml.

In embodiments, vaccine of the invention additionally includes stabilizer.This can act on the degradable component of protection, And/or the storage period of enhancing vaccine.Usually, such stabilizer is the macromolecular of HMW, such as lipid, carbohydrate or Protein；Such as milk powder, gelatin, seralbumin, sorbierite, sucrose, trehalose, spermidine, NZ amine, glucan or polyethylene Pyrrolidones and buffer solution, such as alkali metal phosphate.

Preferably, stabilizer does not have the compound of animal origin, or even：Chemically determine, such as WO 2006/ Disclosed in 094.974.

Preservative, such as thimerosal (thimerosal), thimerosal (merthiolate), phenols chemical combination can equally be added Thing and/or gentamicin.

General technology and method in vaccinology be it is known in the art and be for example described in governmental regulation, such as In Pharmacopoeia, and well-known reference book such as " Remington " and " Veterinary vaccinology " (above) in.

For vaccine of the present invention target animal be easily by birds reovirus infection birds.Preferred birds target It is the avian species relevant with people or veterinary applications, for example：Chicken, turkey, duck, goose, francolin, peacock, quail, pigeon, pheasant, pearl Chicken, sparrow, crow, parakeet, parrot (parrot), parrot (ara), macaw, corella, sparrow, falcon, hawk, emu, Casuarius casuarius or ostrich.

Preferably it is selected from：Chicken, turkey, the birds target species of duck and goose.More preferably：Chicken, because for the fowl Class target species, the economic impact of birds reovirus infection and disease is most significant.

For the present invention, birds can be with any types, kind or mutation, such as：Laying hen, breeder, broiler chicken, bulk variety, or The parental line of any this veriety.Preferred type is：Broiler chicken, breeder and laying hen.Most preferably breeder, because for such The birds of type, its inoculation causes their offspring to be protected, and the offspring is most easily infected by birds reovirus.

For the present invention, as the birds kind that the birds species of vaccination target therefrom need not separate with birds reovirus Class is identical, and the birds reovirus is used to derive antigenic substance for vaccine of the invention.

In preferred embodiments, the birds reovirus for from chicken separate is used for vaccine of the invention.

Vaccine of the invention can be used as it is effective trigger inoculation, it can be after a while booster shot and be reinforced inoculation and put Greatly.

Target animal for vaccine of the present invention can be in principle health or sick, and birds are exhaled with the lonely disease of intestines The presence of poison, or can be positive or feminine gender for the antibody for birds reovirus.Equally, the target can be with It is to being inoculated with susceptible any age.However, inoculation health, the target of uninfection and as early as possible be inoculated against appointing What field infection is substantially favourable.

Therefore vaccine of the invention can be used as preventative or therapeutic treatment, or both, because its interference birds exhales intestines lonely The foundation of virus infection and progress.

In this aspect, other advantageous effects that vaccine of the present invention reduces virus load are to prevent from or reduce coming off and thus preventing Only or reduce the vertical diffusion to offspring and level in colony or population and in geographic area of virus.Therefore, vaccine of the present invention Use cause the reduction prevailing of birds reovirus.

Thus, other aspects of the present invention are：

- vaccine of the invention is used to reduce the purposes prevailing of birds reovirus in population or geographic area, and

- vaccine of the invention, it is used to reducing the prevailing of birds reovirus in population or geographic area.

For that using the scheme of vaccine of the invention can be single or multiple dosage to target birds, its can with it is pre- Phase dosage and the compatible mode of preparation, and effective such amount will simultaneously, parallel or continuously be given in immunology.

Showing for other vaccines that target birds may need will be ideally incorporated into for applying the scheme of vaccine of the present invention Have in vaccine program, labour cost stress simultaneously be reduced to birds to reduce.

In principle can be by different application approaches, and to give birds target of the invention difference in its life Birds reovirus vaccine, as long as the vaccine applied can set up effective immune response.

In embodiments, in day of hatch or thereafter soon, i.e. 1-3 days ages apply vaccine of the invention to chicken. Or, (in ovo) applies vaccine of the invention in egg shortly before hatching；For chicken, this is the pact of embryonic development 18th day.

It is preferred that applying vaccine of the invention no more than 4 circumferential birds target animals before expected beginning of laying eggs.

So, offspring can effectively undergo the protection of maternal source antibody, and/or reduce or prevent by vertical transmission Infection.

It is using the optimization approach of vaccine of the present invention to target birds：It is used as parenteral applications by injecting, for example intramuscular Or it is subcutaneous；By thick drops (coarse drop), such as spray, eye drops or mouth and nose application；Or by diet approach.

Preferred application approach is by intramuscular or hypodermic injection；It is preferred that the intramuscular injection in leg muscle or chest muscle, or In neck hypodermic injection.This applies equally to be duplicating virus, go out when the antigenic substance of birds reovirus of the invention When live virus or subunit.

Natural is the tool that optimal application approach will depend on the specific bacterin preparation and target birds for being used Body characteristicses.

Further optimize vaccine of the invention complete in the technical scope of technical staff.Usually, this is related to vaccine to imitate Can fine-tune, so as to its enough immunoprotection of offer.This can be by adjusting vaccine dose, or by using another kind The vaccine of form or preparation, or by adjusting the other compositions of vaccine（Such as stabilizer or adjuvant）, or by through different approaches Application complete.

Vaccine can extraly include other compounds, such as adjuvant, extra antigen, cell factor.Or, the present invention Vaccine can favorably and drug component, such as antibiotic, hormone, anti-inflammatory drug or anti-parasitic medicine combination.

In embodiments, vaccine of the invention includes adjuvant.

This is applied especially to when the antigenic substance for deriving from birds reovirus of the invention is the virus form of inactivation, Or birds reovirus of the present invention part when.Used as non-replicating, this quasi-antigen substance generally needs extra being immunized Stimulate that effective wide spectrum can be induced to be inoculated with.

" adjuvant " is well-known vaccine composition, and it is usually with the immune response of non specific manner stimulation target Material.Many different adjuvants are known in the art.The example of adjuvant be Freund completely and Freund's incomplete adjuvant, vitamin E, aluminium group Compound, such as aluminum phosphate or aluminium hydroxide, non-ionic block polymer and polyamines, such as dextran sulfate, Carbopol, pyrans, Saponin(e, such as Quil A or Q-vac.Saponin(e and vaccine component can be combined to (EP 109.942, EP in ISCOM 180.564、EP 242.380)。

Additionally, peptide such as muramyl dipeptide, dimethylglycine, tuftsin are commonly used as adjuvant, and oil-emulsion, make With mineral oil such as Bayol or Markol, Montanide or light mineral（Paraffin）Oil；Or non-mineral oil, such as spiny dogfish Alkene, saualane, or vegetable oil, such as ethyl oleate.Equally, it may be advantageous to use the combination product such as ISA from Seppic , or DiluvacForte.Emulsion can be Water-In-Oil (w/o), oil-in-water (o/w), W/O/W (w/o/w), or Double oil emulsions (double oil-emulsion, DOE) etc..

In preferred embodiments, vaccine of the invention includes water-in-oil emulsion.

Such emulsion provides the storage effect of slow released antigen in animal is inoculated with, and thus provides target immune system Extension stimulate.

In preferred embodiments, the oil phase of water-in-oil emulsion includes mineral oil or ethyl oleate.

In the embodiment of vaccine of the present invention, antigenic substance is that the birds of the inactivation prepared in water-in-oil emulsion exhale Intestines are lonely viral, and thus the oil phase of water-in-oil emulsion includes mineral oil or ethyl oleate.

It is axiomatic that it is adjuvated, addition medium compounds or diluent, emulsify or stablize vaccine of the invention Other modes are also within the scope of the present invention.

In embodiments, vaccine of the invention additionally includes oligodeoxynucleotide, and it is immunostimulation containing non-first The oligodeoxynucleotide (INO) of base CpG.Preferred INO is the activator of birds Toll-like receptor (TLR) 21, such as WO In 2012/089.800 (X4 families), WO 2012/160.183 (X43 families) or WO 2012/160.184 (X23 families) It is described.

Vaccine of the invention favorably can be combined into combination-vaccine with other antigenic substances.However, it is not necessary to derive from fowl Other antigenic substances of class reovirus.

Thus, in the embodiment of vaccine of the present invention, the vaccine is comprising to the pathogenic microorganism of birds The additional antigens material of non-birds reovirus.

" extra antigenic substance " itself can be science or deactivated form or subunit, and can have or not have There is adjuvant.Extra antigenic substance is from other microorganisms caused a disease to target birds.It for example can be comprising biological or conjunction Into molecule, such as nucleic acid of protein, carbohydrate, lipopolysaccharides, encoding protein antigens.Equally, host cell includes the core Acid, or it is probably the side that nucleic acid or additional antigens material are delivered to target birds that recombinant vector microorganism living contains the nucleic acid Formula.Or, extra antigenic substance can include the microorganism of inactivation, such as parasitic animal and plant, bacterium or virus.

Or, vaccine of the invention can be added in vaccine itself.

The advantageous effects of combination-vaccine of the invention be its not only for birds reovirus, also directed to target birds Other pathogens induce immune response, while only needing single treatment target animal for being inoculated with, thus reduce the discomfort of target And time and labour cost.

The present invention " microorganism caused a disease to birds " is known in the art.Extra antigenic substance thus in principle can be with From any virus caused a disease to birds（Except birds reovirus）, it is bacterium, parasitic animal and plant, fungi, Richettsia, primary Animal and/or parasitic animal and plant, the birds are also the target for reducing the vaccine of birds reovirus infection of the invention.

In preferred embodiments, the virus that birds are caused a disease is selected from：IBV, Newcastle Disease Poison, aviadenovirus, fowl astrovirus, fowl paramyxovirus, Egg Drop syndrome virus, FAV, IBDV, chicken anaemia virus, Avian encephalomyclitis virus, bird pox virus, TRT virus, duck plague virus, virulent duck enteritis virus, pigeon avipoxvirus, Horse Garrick（Marek）Sick virus, avian leukosis viruses (avian leucosis virus), ILTV, Fowl metapneumovirus, avian influenza virus and goose parvovirus.

In preferred embodiments, the bacterium that birds are caused a disease is belonged to selected from bacterium：Escherichia （Escherichia）, Salmonella（Salmonella）, bird Bacillus（Ornithobacterium）, hemophilus （Haemophilus）, Pasteurella（Pasteurella）, Bordetella（Bordetella）, erysipelothrix （Erysipelothrix）, Mycoplasma（Mycoplasma）, campylobacter（Campylobacter）, Borrelia Category（Borrelia）, enterococcus spp（Enterococcus）, fowl Bacillus（Avibacterium）, Richter scale Bacillus （Riemerella）, listeria（Listeria）, shigella（Shigella）, streptococcus （Streptococcus）, staphylococcus（Staphylococcus）, Mycobacterium（Mycobacterium）, chlamydiaceae （Chlamydia）And fusobacterium（Clostridium）.

In preferred embodiments, the parasitic animal and plant that birds are caused a disease is belonged to selected from parasitic animal and plant：Eimeria（Eimeria） And Cryptosporidium（Cryptosporidium）.

In preferred embodiments, fungi is selected to the fungi that birds are caused a disease：Aspergillus（Aspergillus）And thought Pearl Pseudomonas（Candida）.

In other respects, the method the present invention relates to be used to prepare vaccine of the present invention.

Such method causes the availability of vaccine of the present invention, and the vaccine has birds reovirus sense in reduction birds The advantageous effect of dye, as described above.

" preparation " of vaccine of the present invention is carried out by the method known to technical staff.Such manufacture method generally comprises mixed The antigenic substance and pharmaceutically acceptable excipient from birds reovirus of the present invention are closed and prepared, is then assigned to Step in appropriately sized container.Multiple stages of manufacturing process need to be monitored by appropriate test, such as by being used for The quality of antigen and the immunoassay of quantity；By the aseptic for adventitious agents (extraneous agents) and do not deposit Microorganism testing；With vaccine efficacy and security are determined eventually through external or experiment in vivo.All these is technology Known to personnel, and it is described in reference book and governmental regulation such as Pharmacopoeia.

Vaccine of the invention can be prepared into be suitable for birds target apply and with desired application approach and phase The form of the effect matching of prestige.

Preferably, by vaccine formulation of the invention into injectable liquids, such as：Suspension, solution, dispersion liquid, or emulsion. Generally such vaccine is prepared as aseptic.

In embodiments, the birds reovirus antigenic substance from inactivation prepares vaccine of the invention.Now can be with The birds reovirus vaccine of this inactivation of the invention is manufactured using widely-known technique.

Thus, in other respects, the method the present invention relates to be used to prepare vaccine of the invention, it includes inactivation from two Individual genotype group：The step of genotype group 1 and each a kind of birds reovirus of genotype group 4.

Can in many ways, for example by using host animal, and it is multiple that virus completion is collected from blood and/or organ Make birds reovirus of the invention.However, it is preferable that using the body to the susceptible host cell of birds reovirus Outer culture systems.The culture systems can preferably be monitored and control than production in vivo, and can optimize viral yield.It is logical Often, vitro culture system using blake bottle and（Half）Defined medium.Host cell can derive from animal, produce primary thin Born of the same parents, or can be immortality cell, cell line of the Tathagata from foundation.On small-scale, blake bottle can be boiling flask or roller bottle Flask；For large-scale culture, blake bottle can be fermentation tank, and some strict of culture is monitored and adjusted when it also allows appropriate Parameter, and this can even automate.Technology, material and facility for the vitro culture system of any scale of the invention are Well-known and can be easily from many bioscience industries commercial suppliers are obtained.

In embodiments, the method for preparation of the invention is comprised the following steps：

A. propagating avian reovirus in cell culture in vitro,

B. the birds reovirus is collected and inactivates, and

C. the birds reovirus of the inactivation is made to mix with pharmaceutically acceptable carrier.

In other embodiments, preparation method of the invention is included the birds reovirus antigen of present invention definition The step of material mixes with adjuvant.

In other respects, the present invention relates to vaccine of the present invention or birds reovirus antigenic substance of the present invention Different medical usages.These materials and method produce the advantageous effects that birds reovirus infection is reduced in birds, such as It is upper described.

Thus, in other respects, the present invention relates to：

- come from from two kinds of genotype groups comprising origin：Each a kind of birds of genotype group 1 and genotype group 4 exhale the lonely disease of intestines The composition of the birds reovirus antigenic substance of the antigenic substance composition of poison, it is used for vaccine for reducing fowl in birds The infection of class reovirus.

- origin is come from from two kinds of genotype groups：Each a kind of birds of genotype group 1 and genotype group 4 exhale the lonely disease of intestines The birds reovirus antigenic substance of the antigenic substance composition of poison is used to manufacture the reduction birds reovirus sense in birds The purposes of the vaccine of dye.

- vaccine of the invention, its infection for being used to reduce birds reovirus in birds.

- vaccine of the present invention or the vaccine as obtained by the inventive method are used to reduce birds reovirus in birds The purposes of infection.

- the method for reducing birds reovirus infection in birds, it includes applying vaccine of the invention to birds Or as obtained by the inventive method vaccine.

The present invention will be further described below by following non-limiting example now.

Embodiment

1. birds reovirus is separated and sample preparation

It is homogenized by the cultured tissue on Embryo liver cell (CEL) and birds reovirus is separated from chicken organ.In brief：From （May）Infected chicken is organized, such as tendon, liver, jejunum and blood.By centrifugal blood and collect serum.Cut out tissue sample Product.These are placed in the bead containing about 0.5 cc diameters about 1mm and 1 ml phosphate buffered saline (PBS)s (PBS)（It contains anti- The mixture of raw element and antifungal compound）6ml test tubes in.By the vibration 20 in Mixer Mill ball mills (Retsch) Minute, by sample homogenization, is then clarified by centrifugation.Collect supernatant and can by its frozen for storage in -70 DEG C in case After use.

According to standard scheme, using it is preceding it is fresh prepare primary CEL cells, in brief：The SPF chicken embryos in 14-16 days ages are used In acquisition liver.Liver is washed twice in PBS to remove blood, is then incubated, while trypsase/PBS is molten at 37 DEG C Stirred 15 minutes in liquid.With in FCS and trypsase, and the mixture of Trypsin Induced is centrifuged 10 minutes under 600xg. By pellet resuspended in standard growing media（Comprising antibiotic and 5% hyclone（FCS）Mixture）In.Filtered Once to remove Declotting, then count CEL cells and directly use.

The CEL in 5ml growth mediums (5 % FCS) is inoculated into T25 blake bottles with 1.5 x 10^6 cells/ml, And in 37 DEG C and 5 % CO in incubator is humidified₂Middle overnight incubation, to allow to set up individual layer.Second day, by comprising 2 % The culture medium of FCS replaces culture medium, and utilizes viral sample such as 50 μ l serum or tissue supernatant flasks, then will Flask is incubated 4-7 days.

After the first round is incubated, CEL cellular layers often seem by debris damage, so that invisible obvious cytopathy effect Answer (cpe), then generally give second pass generation：It is individual layer to prepare fresh CEL, be inoculated with and be incubated, and then inoculation is from the The 50 μ l culture supernatants for once passing on.It is incubated 4 days, birds can be clearly observed in flask thereafter and exhales intestines lonely The special cpe of virus（CEL cells seem blackening and are in granular form, with translucent blast（blast）Sample vesicles）.For Cpe feminine gender flasks, can give third time passage.Finally, collect the culture supernatant of second or third time passage and freeze Storage (- 70 DEG C) is for future use.

Separation strains are named and counted, thus SL represents ' service type laboratory ', be followed by separating time, age separation strains numbering Two numerals, and for separate donor material 2 national alphanumeric codes.

The viral sample of separation is used directly for RNA separation, RT-PCR and sequence analysis.Give and use in zoopery Separation strains further process：Directly from third round amplification separation strains expand for attack inoculation sample, with by according to Secondary bigger culture vessel, (15 ml are trained the T75 in the flat Tissue Culture Flasks of such as Cellstar (Greiner Bio-One) Support) or T175 (25 ml cultures) or 490 cm²Roller bottle flask (150 ml cultures) (Corning, Fischer Scientific breed on the CEL of CEF cells to obtain potency and bigger volume higher in), it is all in standard training In foster base and under Standard culture conditions.So, inoculum is attacked by following preparation：

- SL11A823-2 BE (genotype group 1): 7.95 Log10 TCID50/ml

- SL11A294-12 FR (genotype group 2): 6.32 Log10 TCID50/ml

- SL10A1581-32 ES (genotype group 3): 5.95 Log10 TCID50/ml

- SL11A823-1 BE (genotype group 4): 7.70 Log10 TCID50/ml

It is as described below that the sample that separation strains are broken through for preparing the birds reovirus of vaccine is carried out into plaque purification 3 first It is secondary, then expanded in a similar way.

2. the virulence of virus isolated strain is verified in target animal

Hypothesis with Koch is consistent, the pathogenic of birds reovirus separation strains is demonstrated in chicken experimental infection and is divided again From.From no-special pathogen（SPF）Parent, or from reovirus inoculation parent using 1 day age chicken.These latter Test in chicken（Its antibody (MDA+) to the maternal source for hepato-encephalomyelitis virus strain is positive）For verifying Inoculation-the penetrating ability of these virus isolated strains.Virus for attacking inoculation is separation strains：SL11A823-1BE、 SL11A823-2BE, SL11A0294-12 FR and SL10A1581-32 ES, it is separated and is expanded as described above.Orally should With inoculation simulating natural route of infection, or by intramuscular route, it is much effective attack-inoculation that it has been observed that Approach.

2.1 experimental designs

Use wing band（wingbands）The SPF chickens in Combination other 200 day age are marked, and is placed on 20 chickens/group In single negative pressure isolator.Chicken is Bai Laihang laying hens, can arbitrarily obtain feed and water, and is not included substantially weak or small Chicken.Additionally, 10 hatching spouse's bloodletting are come into test antibody state to provide blood serum sample.

Apply to attack on the day of placement and be inoculated with, and totally 10 isolators are used for the different group of stable breeding：2 isolators are used for Using the respective inoculum of birds reovirus separation strains, a group receives per oral inoculation, and another group receives intramuscular inoculation. As positive control, an isolator is added, wherein chicken receives to lead to using attenuation reovirus vaccine strain 1133 living Cross the control inoculation of intramuscular route.Equally, an isolator stable breeding receives only to simulate the negative control group of inoculation.

For oral and intramuscular route, all inoculations are with 0.1 ml dosage/chicken and 4.5 Log10 TCID50/ chickens Give.Fresh preparation and before administration preparation virus-inoculum dilution in 1 hour, and hold it on ice until making With.Remaining inoculum is used for back titration, to verify the inoculum dosage applied.

Observe clinical sign or other abnormal generations of all chicken diseases daily in the experimentation of competent person. The animal of display pain or discomfort carries out euthanasia and carries out ptomatopsia.

Obtaining within 3 days and 10 days selected chicken after inoculation is used to sample, and thus collects blood and tissue sample.From blood Serum is obtained, its half is used for virus and separates again, and half is used for TPPA.Various Tissues（Tendon, liver and jejunum）For being homogenized Separated again with virus.

The result of 2.2 virulence confirmatory experiments

Negative control chicken, or any its sample, and do not shown and reality from the serum that the 0th day hatches young (hatchmates) Test any disease of correlation or the sign of infection.Equally, the positive control of the vaccine strain of birds SV 12 virus 133 inoculation The expected virus-positive tissue of group displaying（Tendon, liver）And blood serum sample（10 days p.i.）, so experiment is effective.

Be inoculated with sample back titration show it is all be seeded in expected 4.5 Log10 TCID50 dosage/chicken ± In 0.2 Log10 TCID50.

2.2.1 overview

- the virus for carrying out autoblood is separated only in 3 days p.i. again, and is not positive in 10 days p.i.

- detection serum response proved feminine gender for field separation strains in 3 or 10 days p.i., and only separation strains 1133 are seeded in 10 days P.i. Reo antibody positives are become really.Obviously, antibody titer is still not high enough at this moment allows to be detected by business test Birds reovirus antibody (IDEXX REO antibody Elisa) used.

- for all tested virus isolated strains and in 3 and 10 days p.i., intramuscular inoculation causes many than per oral inoculation Samples for viral much is separated and is positive again

- it is strong poison by the oral and all field separation strains of intramuscular route.Observed clinical sign is depressed and raw Length is slow, and inoculation leg is walked lamely, or completely motionless.Equally, enteritis and hepatonecrosis are frequently observed.By accident in animal is tested very It is dead to observing：For SL11A823-2 BE (the genotype group 1) separation strains by peroral route, and by intramuscular route SL10A1581-32 ES (genotype group 3) separation strains.

Although-strain 1133 shows the preference to tendon, field separation has been separated again with maximum amount from liver or jejunum Strain；For each field separation strains, whole highests are obtained from jejunum in 7 days p.i. and is separated again.

3. nucleic acid is separated, expanded and DNA sequencing

The culture supernatant for separating passage from second and third time is used to separate total viral birds reovirus RNA. This is used to prepare and expand cDNA, and then it can be used for DNA sequencing.Standard method and condition are applied to all programs, and it is used Commercial kit and the laboratory equipment of automation.

In brief：Using MagNA Pure 96 (Roche) viral RNA is carried out on 200 μ l culture supernatant samples Separate.The equipment application uses Beads enrichment nucleic acid in lysate sample.Next step, according to the explanation of manufacturer's book, utilizes Be used for for the nucleic acid of wash-out by reverse transcription preparing by SuperScript III the first chains synthetic agent box (Invitrogen) First chain cDNA.

The primer to birds reovirus SigmaC gene specifics is：

REO FW1: 5’- AGTATTTGTGAGTACGATTG - 3’ (SEQ ID NO: 19)

REO REV5: 5’- GGCGCCACACCTTAGGT - 3’ (SEQ ID NO: 20)

Thus the upstream of primer REO FW1 combinations SigmaC genes（Big position approximate on birds reovirus S1 genomic segments Put：Nucleotides 533-552）, and primer REO REV5 combination SigmaC genes 3 ' ends（General S1 section positions：1621 - 1605）；This causes not can determine that the nucleotides of SigmaC downstream of gene penultimates.Primer REO FW1 are used for the first chain Synthesis, and two primers Fs W1 and REV5 are used for PCR amplifications and sequencing reaction.These primers can be used for from all genes The birds reovirus sample of type group, however, reverse primer is accidentally not enough effectively, so for some birds reoviruses Sample, designs and uses extra primer, with further amplicon virus nucleic acid.

After cDNA synthesis, by PCR, 0.4 μM of FW1 of final concentration in the 50 μ l samples with 2 μ l cDNA is used With REV5 primers, Phusion High-Fidelity archaeal dna polymerases and main mixture (Thermo Scientific) are used Amplification sample.PCR conditions used are：60 seconds, 98 DEG C；10 seconds, 98 DEG C, 30 seconds, 58 DEG C, and 30 seconds, 72 DEG C, totally 35 are followed Ring；Then 10 minutes at 72 DEG C.

By passing through agarose gel-electrophoreses on 1% Ago-Gel (Hispanagar) containing ethidium bromide, and CDNA prepared products are verified by comparing with Smartladder (Eurogentec) 200-10.000 bp mark swimming lanes. The conventional gel-tape for obtaining about 1.1 kbp, illustrates successful birds reovirus SigmaC gene magnifications.

The PCR samples being positive to 1088bp bands are purified using QIAquick PCR purification kits (Qiagen). Next step, the measurement DNA concentration in NanoDrop spectrophotometers (Thermo Scientific).Generally, 10-40 is obtained The viral cDNA of ng/ μ l.

Determined dna sequence completed using automation cycle sequencing equipment and assembled using computer software, compared and analyze Sequence reads, all specifications all in accordance with manufacturer.In brief：In 20 μ l/ reactions, using 20-70 ng viruses cDNA （The PCR amplicon virus cDNA samples of typically 1 or 2 μ l purifying）, and 0.5 μM of FW1 or REV5 primers, use Big Dye Terminator cycle sequencings kit (Applied Biosystems) carries out first cycle sequencing PCR.Sequencing PCR programs It is：10 seconds, 96 DEG C, 5 seconds, 50 DEG C, and 2 minutes, 60 DEG C, totally 25 circulations.Next step, 15 DEG C are maintained at until dividing by sample Analysis.

Next step, uses Dye Ex Spin kits (Qiagen), the specification purifying sequencing-PCR according to manufacturer Sample, and sample is stored in 4 DEG C until sequencing operation starts.

By Capillary Electrophoresis, the Genetic Analyzer of ABI 3500 and corresponding software (Applied are used Biosystems DNA sequencing) is carried out.Then using Sequencher, v.54 software (Gene Codes Corp.) analyzes sequence Column data.

In Assembly sequences one can be solved with the interior zone hybridization of SigmaC genes by using extra primer Mispronounce, read with providing extra overlap.

4. sequence alignment and systematic growth

The birds reovirus of SigmaC albumen is analyzed from the field separation strains and public database of sequencing as described above Amino acid sequence.Using the combination aligned amino acid sequence of program, described program is such as：SIAS (http:// Imed.med.ucm.es/Tools/sias.html) it is used for multiplex paring sequence alignment, and MEGA6 (above) is used to collect knot Fruit and systematic growth.Compared using the one-to-one comparison of BlastP (above), and the score from the program is by base Played a decisive role because type group is attributed in virus sequence.

In some birds reoviruses outburst separation strains, about rear the 30 of 3rd ' area of the gene of SigmaC albumen are encoded Individual nucleic acid can not be determined credibly, because these bases directly follow downstream PCR primer.Equally, for from common data Some sequences in storehouse, what the information on the C-terminal of SigmaC albumen was missing from.So in order to optimize the overlap in comparing, at this The C-terminal of SigmaC protein amino acid sequences is not used in a little analyses.However, this seems not influence the accuracy of packet, such as Kant etc. (above) also has been proposed that：Reliable point still can be provided using less than complete S igmaC protein amino acid sequences Group.Similarly, accidental sequence mispronounces without prejudice to analysis.

Compared using the amino acid/11-277 of SigmaC albumen when possible；Short many sequences are not included in analysis. Slightly short sequence such as ISR-5223 is still included, because this is provided and contacting that prior art type genotype is grouped.

Compare score and be rounded to integer, it is consistent with the scores that blast program is provided.However, this represents these Numerical value is accurately up to 0.49%, and it corresponds to 2 amino acid on 277 amino acid lengths.

The table for describing a plurality of sequence and its packet analyzed is given in matrix section below, and five are presented in figure The phylogenetic figure of individual genotype group is represented.From many field samples tested, selected quantity has only been regenerated herein Correlation and representative sample：Table 1 describes maximally related these field samples, and institute is presented in for its full length amino acid sequence Those in attached sequence table are further selected, referring to table 2.Listed in table 3 it is maximally related it is public obtain sequence, and Its corresponding database login number, and its previous genotype packet.

If table 4 presents the birds reovirus SigmaC amino acid sequences pairing of different genotype group in stem portion The result of multiple alignment；The amino acid sequence of the Reference strains of genotype group and listed sequence alignment.These results are percentage Amino acid sequence identity, and for genotype（It is sub-）The representative member of group and the Reference strains of other genotype groups are in It is existing.From these comparisons, cutoff is deducted, it acts on sign different genotype group defined herein.

5. the plaque purification of field separation strains

Strain is broken through for two birds reoviruses, plaque is carried out and is separated to obtain clone's pure (clonally pure) Virus isolated strain is used for inoculation study.These are separation strains：SL11A823-1BE and：SL11A823-2BE, it is belonging respectively to base Because of type group：4 and 1.This standard in tissue culture dishes under agar on CEL cells using virus plaques separates to complete.Letter Yan Zhi：Prepare two parts of dilutions of virus isolated strain, up to 1x10^-8.Next step, using 1 ml of 5x10^6 cells/ml CEL cells, 1 ml viral dilutions liquid and the 3 ml standard growing medias with FCS and antibiotic are inoculated with the cell of 6cm diameters Culture dish.Ware described in night incubation.Second day, supernatant media is removed, and using PBS washings individual layer twice.Next step, gives Bacto agar in giving culture dish to be dissolved in distilled water with 2.25 % at 49 DEG C and at 37 DEG C 2x culture mediums 1：1 mixing The 5ml agaroses covering of thing.Culture dish is incubated 4 days, and uses neutral red staining：Give 0.04 % v/ in each culture dish PBS The 2ml solution of v dimethyl diaminophenazine chlorides.It is incubated 6 hours, virus plaques are visible thereafter.

It is some from the culture dish picking with the clear separate plaque from highly diluted liquid for each virus isolated strain Single plaque.By in the molten PBS to 0.5ml of plaque.Next step, gives each plaque point on CEL cells in T25 blake bottles Taken turns from strain one and expanded.

Plaque is separated using the 0.1 ml plaques amplified matter from previous round repeats two-wheeled, reach three-wheel plaque altogether Purifying；Also negative control culture dish and flask are included always.

Then plaque purification is taken turns in amplification the 3rd on primary CEF (CEF) in larger tissue culture flasks Birds reovirus separation strains；Basic to prepare CEF cells with CEL cell identical modes, exception is that whole embryo is used for pancreas Protease digestion.The virus stock solution useds of a large amount of titration high of amplification generation are used to further use；7-8 Log10 can routinely be obtained The titre of TCID50/ml.

6. prepared by vaccine

Further the birds reovirus separation strains of amplification plaque purification are used for productive experiment vaccine.For the purpose, Propagative viruses on Vero cells, collects culture supernatant, using formalin-inactivated, and the viral antigen of inactivation is used to utilize mineral Oily adjuvant emulsion is into water-in-oil emulsion vaccine.In brief：The Vero cell suspending liquids of 1x10^5 cells/ml are inoculated into be had 1750 cm of the 500ml standard growing medias of FCS and antibiotic²In roller bottle.The plaque purification birds expanded with 1ml exhale intestines Lonely virus isolated strain SL11A823-1BE or SL11A823-2BE inoculation roller bottles, and in 37 DEG C of incubations while rolling.

100% cpe is observed after 5-6 days, and collects culture supernatant.The formalin of dilution is added to culture supernatant Liquid to 0.2% v/v final concentration.The mixture is placed at 37 DEG C to inactivate 48 hours, while stirring at 200 rpm.

After inactivation, birds reovirus antigen is concentrated about 20 times by ultrafiltration.On a laboratory scale, this uses tool There are Centriprep centrifugal filters equipment (Millipore) of 10 kDa cut film to carry out：By the sample of 15ml volumes 3000xg is centrifuged 40 minutes at 20 DEG C.By the viral antigen of concentration in 2-8 DEG C of refrigerator storage until further using.

By combining birds reovirus antigenic substance adjuvated vaccine is prepared with oil phase.By aseptic stirring Water for injection is prepared for water phase with the viral antigen of concentration.Oil phase contains atoleine as mineral oil and emulsifying agent,（In experiment In the scale of room）The emulsifying agent is homogenized with oil using Ultra Turrax (IKA), next step passes through 0.2 μm Ultipor NFs (Pall) aseptic filtration oil phase.Then the oil phase and water phase, fortune are emulsified using Ultra Turrax Row a few minutes are avoiding heating mixture more than 40 DEG C.Then light microscopy homogeney is passed through.Repeat until institute There is bubble to be less than 3 μm.

Next step, ready vaccine is aseptically distributed into the aseptic bottle of mark, by bottle nitro rubber Plug closing, and sealed with the aluminium lid of coding.By final vaccine product refrigerator storage until using.

Birds reovirus vaccine of the invention is prepared in this way.For the vaccine dose of 0.5ml/ chickens, epidemic disease Seedling is prepared as the SL11A823-1BE containing 1 % v/v/ml (relative to the final volume of emulsification vaccine) (with 8.32 Log10 TCID50/ml) viral antigen and 2% v/v SL11A823-2BE (with 6.45 Log10 TCID50/ml).It is right According to vaccine do not contain viral antigen or containing both viral antigens in it is only a kind of.

Similar vaccine is prepared to serve as comparable example, it contains other birds reovirus antigens：' classics ' vaccine Strain 1733 and 2408, as many body single-gene type group vaccines；Or the combination of strain 1733,2408 and ERS, it contains from base Because of type group 1（Twice）Antigen with 5.Amount for the antigen of these comparing vaccines is identical with current commercial vaccine, and pin The reference of known standard is measured with any Elisa units.

7. inoculation-attack experiment

The water-in-oil vaccine for preparing as described above is used in animal inoculation pvaccination-challenge trial.In a series of experiments, based on from base Because of the birds reovirus antigenic substance of type group 1 and 4, with vaccine inoculation laying hen of the invention, and their offspring is by attacking The severe infections that inoculation undergoes the birds reovirus from different genotype group are hit, to prove such vaccine to homologous and different The broad spectrum protection and cross protection property of source challenge virus infection.

7.1 experimental designs

7.1.1 parental generation inoculation

Normal healthy SPF laying hens are assigned in 8 groups, every group 12.Chicken is Bai Laihang laying hens, about 32 week old, and to every group 12 hens in add a cock.

With the above-mentioned water-in-oil vaccine of dose (0.5 ml) hen is inoculated with through intramuscular in right chest muscle.Cock is not inoculated with to carry For negative control sera sample.From after inoculation 5 weeks, egg is collected daily for the follow-on attack-inoculation experiments to offspring.By chicken Egg is stored in 4 DEG C until using.

The all of chicken of stable breeding in the safeguard with Hepa filtering air inlet and outlet.Standard can arbitrarily be obtained Chicken feed and running water.

With chicken, (came to hand) distributes into group them to hand, although providing a public affairs to every group of hen Chicken.Use wing band (wing-bands) or drop (swift-tags) separate marking chicken.

Place all of chicken before inoculation is used to adapt to for one week, and observes disease daily by competent person in experimentation Sick clinical sign or other abnormal generations.

Parental generation vaccine program：

Group 1：Vaccine：SL11A823-1BE antigens

Group 2：Vaccine：SL11A823-2BE antigens

Group 3：Vaccine：SL11A823-1BE antigens and SL11A823-2BE antigens

Group 4：Vaccine：Simulating vaccine（Without birds reovirus antigen）

Group 5：' classics ' birds reovirus vaccine：' the antigen of strain 1733 and 2408

（The vaccine similar with commercialized vaccine Nobilis Reo Inac）

Group 6：' classics ' birds reovirus vaccine（The antigen of strain 1733 and 2408）, with strain ERS antigens

Cock：Without vaccine

7.1.2 offspring attacks inoculation

The experiment acts on the protection in offspring of the test from inoculation parental generation, and it overcomes serious birds reovirus infection Ability, or even when challenge virus is from genotype group different from vaccine virus.Due to scale and size, this connects twice Carried out in continuous experiment, once test is using separation strains SL11A294-12 FR (genotype group 2) and SL10A1581-32 ES The attack inoculation of (genotype group 3), and use separation strains on the newborn offspring from identical parental generation after two weeks： Another series of SL11A823-1 BE (genotype group 4) and SL11A823-2 BE (genotype group 1) attacks inoculation.

Tested twice for this, from the egg that parental generation inoculation experiments are collected（Separated by its parental generation treatment group）In standard It is incubated in hatching incubator until hatching at the 21st day.Concentrate the chicken in an age（Mixing sex）And bring rower into using wing Note.Substantially weak or small chicken is not included.By 10 chicken bloodletting from each parental generation treatment group providing serum sample The product MDA state initial to test chicken.Then chicken is separated in the negative pressure separator of separation by being placed on, then each parent There is a separator for treatment group, contain 24-30 chicken.Feed and water can arbitrarily be obtained.

Apply to attack on the day of placing and be inoculated with：Each separator uses a type of challenge virus, thus half Chicken receives attack by peroral route, and remaining half is received by intramuscular route.Chicken is put in 3 or 10 days p.i. Blood is used to collect blood sample.

Each for four kinds of challenge viruses being tested, with 4.5 Log10 TCID50/ chickens, 0.1ml dosage is given Give attack to be inoculated with, and be inoculated with by intramuscular (i.m.) approach.It is fresh to prepare and prepare challenge virus in one hour before administration Dilution, and hold it on ice until using.Remaining inoculum is used for back titration, to verify the inoculum applied Dosage.

Observe all chicken Disease Clinical signs or other abnormal generations daily by competent person in experimentation.Will The animal euthanasia of display pain or discomfort simultaneously carries out ptomatopsia.

7.2 sample analysis

2 weeks and 4 weeks after inoculation, and be inoculated with first 1 week（0th day）Blood sample is obtained from parental generation.Start and 3 or 10 in experiment Its p.i. obtains blood sample from offspring.

Blood sample is transported to laboratory at room temperature.After solidifying at room temperature, serum is collected.For offspring：By half Serum is stored in -70 DEG C for virus purification；Remaining blood serum sample heat inactivation 30 minutes at 56 DEG C, be then stored in- 20 DEG C until use.

Using IDEXX REO antibody Elisa, the specification according to manufacturer completes birds reovirus antibody in serum Detection.

Based on being directed in the 0th day sample and negative control sample, missing of the antibody of birds reovirus in parental generation is true The validity of fixed experiment.

According to the treatment of its parental generation, the offspring of the hen from inoculation is MDA+ for birds reovirus.

Obtained for the serum that again separate of virus after blood sample solidification, and do not processed further In the case of be frozen in -70 DEG C.When these samples are tested, by CEL cells with 2 ml/hole and 1x10^6 cells/ml It is seeded in 6 hole tissue culturing plates during there is the standard medium of 5% FCS and antibiotic.By its night incubation forming individual layer. Second day, remove culture supernatant and replaced with the 4ml standard mediums without FCS.With 40 μ l test seras inoculation holes and incubate Educate 5 days.The supernatant in 100 μ l holes is seeded in the hole of new 6 orifice plate with CEL individual layers, and is incubated 5 days again.It is next Step, the specific cpe of birds reovirus is judged by light microscope.Even if because negative sample is after third time is passed on Feminine gender is remained in that, so passage is used as standard twice.

7.3 inoculations-attack the result tested

7.3.1 compare

Due to all positive and negative control samples score as expected, it is thus regarded that experiment is effective.

7.3.2 the method for assessment result

In the experimental result that the inoculation of assessment parental generation and offspring attack, many samples collected in experimentation are analyzed and compared Product.Obtain serum and test antibody and virus are separated again；For serology, it is found that 3-10 days test periods fall short of to provide clearly Positive findings.Positive-virus from serum separate again be live-bird class reovirus viremia virusemia instruction, and it was found that Separate the clear explanation for giving different disposal effect again from the virus in the serum collected for 3 days after intramuscular inoculation.It is possible thereby to Determine which parental generation inoculation can reduce the infection of birds reovirus challenge virus in offspring.

For the treatment group for receiving intramuscular attack, and the 3 days serum of p.i. collections, from every group of 5 chickens（One group only has 4）Serum can be used for virus separate again.As cut-off, it is believed that had in the serum of p.i. acquisitions at 3 days and virus is separated again The 3 or many groups of animal being positive do not show the reduction of challenge virus infection；Think that 2 animal positives are not can determine that 's；And think 0 or 1 positive display infection reduction of animal.Result is shown in Table 5, and shows the different vaccination of parental generation and is （YES）Or it is no（NO）The infection for attacking strain induction of birds reovirus in offspring is reduced.Indicated by being surveyed in bracket The basis that the quantity of the overall chicken of examination is drawn a conclusion, for which, such as reads cpe after being passed on twice on CEL cells Determined, the blood serum sample obtained in 3 d. p.i. is positive to birds reovirus.

7.3.3 discussion of results

As presented in table 5, for all chickens from simulation inoculation parental generation（Inoculation test group 4）, can be from after inoculation Birds reovirus is separated again in the serum that 3rd day obtains, and the challenge virus of all applications is such case.This table Show that challenge virus is unobstructed replicated in chicken, therefore the chicken be not subject to from it（Simulation inoculation）Parental generation turns The protection of the factor of shifting.Clinical sign is not fairly obvious, because chicken used herein is laying hen type, it is not so good as heavier type Chicken such as broiler chicken it is sensitive.However, observing notable difference in inoculation efficiency.

Using containing two strains from ' classics ' birds reovirus：The antigenic substance of strain 1733 and 2408 Vaccine gives the parental generation single inoculation in test group 5, to simulate the extensive vaccine of genotype group 1.The vaccine is induced in offspring The infection of the birds reovirus challenge virus for belonging to genotype group defined herein 1 or 2 is substantially reduced.However, not having Induction is reduced for the infection of the birds reovirus challenge virus of genotype group 3 or 4.

It is apparent that the parental generation of test group 6 is not for its offspring is provided compared to the genotype group 1 for being such as used to be inoculated with test group 5 The protection that antigenic substance is provided widely is protected.There is extra birds reovirus to resist to be used in the vaccine of group 6 Original matter：From ERS strains（Belong to the ERS strains of genotype group 5 as defined herein）, it is also such.This is represented from making Do not have significantly with the protection obtained containing the vaccine from the birds reovirus antigenic substance more than individual gene type group Automatic broadening.

For the vaccine of test group 1 or 2（Respectively）It is anti-containing the birds reovirus from genotype group 1 or 4 Original matter.Parental generation from these test groups is directed to in behind exhales the lonely disease of intestines with the birds of vaccine strain identical genotype The duplication of malicious challenge virus provides Global Macros.However, wide spectrum or heterologous protection are not induced, because these vaccines are not reduced coming From the birds reovirus infection of the genotype group different from its own genotype group.

Surprisingly however it was found that will be obtained after the birds reovirus antigenic substance combination from genotype group 1 and 4 Obtained strong synergy：The parental generation of the vaccine of acceptance test group 3, its combination comes from birds reovirus gene type group 1 and 4 （As defined herein）Antigenic substance, really for its offspring provides broad spectrum protection：Chicken from these parental generations can significantly subtract Few all birds reoviruses tested attack the infection of strain, the attack strain be to the vaccine applied it is homologous and Heterologous, and after single inoculation.

Table

Table 1：Break out the list of separation strains in the birds reovirus field referred in embodiment

Table 2：The sequence description presented in sequence table

Table 3：The birds reovirus list from prior art referred in embodiment

Table 4：The pairing multiple alignment of birds reovirus SigmaC amino acid sequences.

Table 4（It is continuous）：The pairing multiple alignment of birds reovirus SigmaC amino acid sequences

Table 4（It is continuous）：The pairing multiple alignment of birds reovirus SigmaC amino acid sequences

Table 4（It is continuous）：The pairing multiple alignment of birds reovirus SigmaC amino acid sequences

Table 4（It is continuous）：The pairing multiple alignment of birds reovirus SigmaC amino acid sequences

Table 4（It is continuous）：The pairing multiple alignment of birds reovirus SigmaC amino acid sequences

Brief description of the drawings

Fig. 1-6：The all genotype analyzed in embodiment and compared（It is sub-）The representative birds reovirus of group The phylogenetic tree of the amino acid alignment of SigmaC albumen.Drawn using MEGA6 and set, compared by calculating pairing first Point, then using adjacent method draw unrooted tree (Saitou N. ＆ Nei M., 1987, Mol. Biol. and Evol., Volume 4, the 406-425 pages).Scale represents Relative Hereditary distance.

Fig. 1:The A of genotype subgroup 1

Fig. 2:The B of genotype subgroup 1

Fig. 3:Genotype group 2

Fig. 4:Genotype group 3

Fig. 5:Genotype group 4

Fig. 6:Genotype group 5

Sequence table

<110> Intervet International BV

<120>For the broad-spectrum vaccine of birds reovirus

<130> 23842

<160> 20

<170>PatentIn version 3s .5

<210> 1

<211> 315

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<220>

<221>Still unclassified feature

<222> (168)..(168)

<223>Xaa can be any naturally occurring amino acid

<400> 1

Met Ala Gly Leu Asn Pro Leu Gln Arg Arg Glu Val Val Ser Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Asn Val Thr Thr Asn Pro Gly Asp Leu Lys Ser

20 25 30

Ile His Glu Arg Leu Thr Ser Leu Glu Ala Ser Thr Glu Ser Leu His

35 40 45

Gln Ser Val Ser Gly Met Ser Ala Thr Leu Ser Gly Leu Ser Ala Asp

50 55 60

Leu Gln Asp Thr Thr Arg Thr Leu Asp Asp Val Thr Val Thr Leu Asn

65 70 75 80

Gly Leu Ser Ala Thr Ile Ala Ala Leu Gln Asn Ser Leu Thr Thr Leu

85 90 95

Ser Ala Thr Val Asp Glu Leu Ala Asn Thr Ser Ser Ala His Ser Gly

100 105 110

Met Leu Ser Ser Leu Gln Thr Ala Val Asn Gly Asn Ser Ser Asp Ile

115 120 125

Ala Asn Leu Arg Ser Asp Val Ser Ala Asn Gly Leu Asn Ile Thr Asp

130 135 140

Leu Gln Asn Arg Ile Lys Ser Leu Glu Ser Asp Thr Ser His Cys Leu

145 150 155 160

Ser Phe Ser Pro Pro Leu Ser Xaa Ala Asp Gly Val Val Ser Leu Asp

165 170 175

Met Asp Pro Tyr Phe Cys Ser Gln Arg Val Ser Leu Thr Ser Tyr Ser

180 185 190

Ala Glu Ala Gln Leu Met Gln Phe Gln Trp Val Ala Lys Gly Thr Ser

195 200 205

Gly Ser Ser Asp Thr Ile Asp Met Ile Val Asn Ala His Cys His Gly

210 215 220

Arg Arg Thr Asp Tyr Ile Met Ser Ser Thr Gly Ser Leu Thr Val Thr

225 230 235 240

Ser Asn Ala Val Ser Leu Thr Phe Asp Leu Ser Tyr Ile Thr Asn Met

245 250 255

Pro Ser Asp Leu Ser Arg Leu Ile Pro Ser Ala Gly Phe Gln Val Ala

260 265 270

Ser Phe Pro Val Asp Val Ser Phe Thr Arg Glu Ser Ser Thr His Thr

275 280 285

Tyr Gln Ser Tyr Gly Ala Tyr Ser Ser Ala Arg Val Phe Thr Ile Thr

290 295 300

Phe Pro Thr Gly Gly Asn Gly Thr Ser Asn Ile

305 310 315

<210> 2

<211> 309

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<220>

<221>Still unclassified feature

<222> (137)..(137)

<223>Xaa can be any naturally occurring amino acid

<400> 2

Met Ala Gly Leu Thr Pro Ser Gln Arg Arg Glu Val Val Gly Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Ser Ala Thr Thr Ser Cys Gly Asp Leu Thr Ala

20 25 30

Ile Asn Glu Arg Leu Leu Lys Leu Asp Ser Ser Val Glu Ser Leu Thr

35 40 45

Ile Ser Val Gly Asp Leu Ser Arg Arg Phe Ser Glu Leu Glu Val Asp

50 55 60

Leu Gln Asn Val Asp Ser Ser Leu Arg Gln Leu Thr Ser Ser Leu Asn

65 70 75 80

Thr Leu Ser Glu Glu Val Arg Gln Leu Arg Ser Ala Val Ser Asp Asn

85 90 95

Thr Val Ser Ile Ser Gly Leu Ser Ala Thr Val Ala Asp His Gln Gln

100 105 110

Val Leu Thr Asp Leu Gln Thr Ser Val Asn Ala Asn Val Thr Asp Ile

115 120 125

Thr Asn Leu Lys Gly Ser Val Thr Xaa Leu Ser Leu Thr Val Ala Asp

130 135 140

Leu Glu Lys Arg Leu Lys Val Val Glu Ser Gly Ser Ser Ser Thr Leu

145 150 155 160

Glu Phe Thr Ser Pro Leu Ser Leu Thr Asn Gly Val Val Ser Leu Asn

165 170 175

Met Asp Pro Tyr Phe Cys Ser Asp Asn His Ala Leu Thr Ser Tyr Ser

180 185 190

Ser Asp Ala Gln Leu Met Gln Phe Gln Trp Leu Ala Arg Gly Asp Asp

195 200 205

Gly Ser Ser Asp Ser Val Glu Met Leu Val Asn Ala His Cys His Gly

210 215 220

Arg Arg Thr Asp Tyr Met Met Ser Thr Thr Glu Asn Leu Thr Val Thr

225 230 235 240

Gly Asn Ser Thr Ser Leu Val Phe Ser Leu Glu Tyr Ile Thr Lys Pro

245 250 255

Pro Ser Asp Met Ser Arg Leu Val Pro Arg Ala Gly Phe Gln Ala Ala

260 265 270

Ser Phe Pro Val Asp Val Ser Phe Thr Arg Asp Thr Ala Thr His Ala

275 280 285

Tyr Gln Val Tyr Gly Ala Phe Thr Ser Pro Arg Val Phe Lys Ile Thr

290 295 300

Phe Leu Thr Gly Gly

305

<210> 3

<211> 313

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<400> 3

Met Ala Gly Leu Thr Pro Ser Gln Arg Arg Glu Val Val Gly Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Asn Ala Ser Ile Asn Pro Gly Asp Leu Ala Pro

20 25 30

Ile Tyr Ser Arg Leu Thr Ala Leu Glu Val Ala Arg Asp Glu Leu Asn

35 40 45

Lys Ser Leu Thr Glu Leu Ser Ser Ala Met Ser Ala Phe Ser Ile Arg

50 55 60

Phe Asp Asp Ala Leu Met Lys Leu Asn Ser Val Thr Ala Asp Leu Thr

65 70 75 80

Val Ile Lys Ser Asp Ile Ser Thr Leu Asn Ser Ser Val Ser Ala Val

85 90 95

Thr Ser Ser Thr Ala Gly Leu Ser Gln Ser Val Ser Ser His Glu Ser

100 105 110

Gln Leu Ala Thr Leu Ser Ser Ser Leu Thr Thr Leu Ser Ser Gln Met

115 120 125

Ala Ala Leu Gln Arg Asp Val Ser Thr Ser Glu Leu Lys Leu Thr Asp

130 135 140

Leu Gln His Arg Val Thr Ala Leu Glu Ser Ser Gly Gly Ala Ser Leu

145 150 155 160

Gln Phe Leu Pro Pro Leu Lys Thr Asp Gly Thr Ser Val Ser Leu Glu

165 170 175

Leu Asp Pro Tyr Phe Cys Ser Glu Arg His Asn Leu Thr Ser Tyr Ser

180 185 190

Ala Ala Ala Gln Leu Leu Gln Phe Gln Trp Leu Ile Arg Ser Glu Asn

195 200 205

Gly Ala Ser Asp Ser Phe Asp Met Asn Val Val Ala His Cys His Gly

210 215 220

Arg Arg Thr Asp Tyr Leu Met Ser Thr Pro Ser Ser Leu Thr Val Thr

225 230 235 240

Ser Asn Ser Val Ser Leu Val Phe Asp Leu Ser Phe Ile Thr Thr Pro

245 250 255

Gln Val Asp Leu Ala Arg Leu Val Pro Cys His Gly Phe Gln Gln Ala

260 265 270

Thr Phe Pro Val Asp Val Ser Tyr Thr Arg Gly Asp Thr Thr His Ser

275 280 285

Tyr Gln Val Tyr Gly Ser Phe Asp Thr Pro Arg Ile Phe Lys Ile Thr

290 295 300

Phe Ser Thr Gly Gly Thr Gly Thr Ala

305 310

<210> 4

<211> 315

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<400> 4

Met Glu Gly Leu Thr Gln Ser Gln Arg Arg Glu Val Val Gly Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Ser Val Thr Thr Ser Thr Gly Asp Leu Ala Gln

20 25 30

Ile Arg Ser Arg Leu Ser Ala Leu Glu Ser Ser Asn Ala Leu Leu Ser

35 40 45

Glu Thr Val Asn Gly Ala Leu Ser Gln Leu Val Ala Leu Ser Ser Arg

50 55 60

Leu Asp Asn Leu Ala Ala Thr Val Ala Asp Gly Gln Leu Glu Leu Arg

65 70 75 80

Ser Leu Thr Thr Asp Val Lys Asn Ile Arg Ser Leu Leu Asp Asp Ile

85 90 95

Ser Thr Thr Val Ala Ser Leu Ser Ala Ser Val His Lys His Asp Leu

100 105 110

Ser Ile Ser Asp Leu Ala Arg Gln Phe Gly Leu Leu Thr Thr Asp Thr

115 120 125

Ala Asn Leu Lys Thr Asp Val Ala Thr Gln Ser Leu Gln Ile Thr Ser

130 135 140

Leu Glu Gln Arg Val Thr Ala Leu Glu Ser Gly Thr Gly Ser Leu Pro

145 150 155 160

Ser Phe Ser Ala Pro Leu Lys Leu Asp Asp Gly Thr Val Ser Leu Asp

165 170 175

Leu Asp Pro Tyr Phe Cys Ser Val Asp His Asn Leu Thr Ser Tyr Ser

180 185 190

Ala Ser Ala Gln Leu Met Gln Phe Gln Trp Leu Val Arg Gly Glu Gly

195 200 205

Gly Ser Ser Asp Ser Ile Asp Met Asn Val Thr Ala His Cys His Gly

210 215 220

Arg Arg Thr Asp Tyr Met Met Ser Thr Thr Gln Ser Leu Thr Val Thr

225 230 235 240

Gly Thr Ser Val Ser Leu Val Phe Asn Leu Asp Thr Leu Ile Thr Ser

245 250 255

Pro Ser Asp Tyr Ser Arg Leu Ile Pro Cys His Gly Phe Gln Gln Ala

260 265 270

Thr Phe Pro Val Asp Leu Ser Phe Lys Arg Asp Glu Val Thr His Ser

275 280 285

Tyr Gln Val Tyr Gly Ser Tyr Ser Thr Pro Arg Val Phe Lys Val Thr

290 295 300

Phe Ser Pro Gly Ala Pro Val Pro Ala Val Ile

305 310 315

<210> 5

<211> 316

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<400> 5

Met Ala Gly Leu Asn Pro Ser Gln Arg Arg Glu Val Val Ser Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Ser Thr Thr Thr Ser Pro Gly Asp Leu Ile Gln

20 25 30

Ile Arg Glu Arg Leu Ser Ala Leu Glu Ser Ala Asn Ala Leu Leu Asn

35 40 45

Glu Ser Val Asn Thr Ala Leu Ser Lys Leu Gly Asp Phe Ser Val Ala

50 55 60

Leu Asp Asn Met Ala Val Asn Val Ala Glu Thr Lys Val Glu Leu Ala

65 70 75 80

Ser Leu Ala Ser Asp Val Gln Ser Leu Arg Thr Ser Leu Asp Ser Thr

85 90 95

Ala Ser Glu Val Ala Ser Leu Ser Leu Leu Val His Gly His Gly Ser

100 105 110

Ser Ile Ser Asp Leu Gln Gln Lys Gly Tyr Ala Leu Ser Gly Glu Val

115 120 125

Asp Asn Leu Lys Ser Ser Val Ser Ser Gln Gly Leu Thr Ile Ser Gly

130 135 140

Leu Glu Ser Gln Val Gln Ala Leu Glu Ser Gly Ser Gly Thr Asp Leu

145 150 155 160

Leu Phe Ala Asp Pro Leu Lys Leu Glu Ala Gly Thr Val Ser Leu Asp

165 170 175

Leu Asp Pro Tyr Phe Cys Ser Val Ser Arg Asn Leu Thr Ser Tyr Ser

180 185 190

Ala Ser Ala Gln Leu Met Gln Phe Gln Trp Ser Val Lys Gly Glu Asp

195 200 205

Gly Ala Ala Asn Ser Ile Asp Met Asp Val Asn Ala His Cys His Gly

210 215 220

Pro Arg Thr Asp Tyr Leu Met Ser Thr Lys Gln Ser Leu Thr Val Thr

225 230 235 240

Thr Ser Pro Ala Thr Leu Val Phe Glu Leu Asp Arg Ile Val Thr Leu

245 250 255

Pro Pro Asp Leu Ser Arg Leu Ile Pro Cys His Ala Phe Gln Gln Ala

260 265 270

Thr Phe Pro Val Asp Ile Ser Phe Gln Arg Glu Gly Val Ser His Thr

275 280 285

Tyr Gln Val Tyr Gly Thr Tyr Thr Ser Ser Arg Val Phe Arg Ile Thr

290 295 300

Phe Ser Pro Gly Ser Pro Gly Pro Thr Val Ile Gln

305 310 315

<210> 6

<211> 309

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<400> 6

Met Ala Gly Leu Asn Pro Ser Gln Arg Arg Glu Val Val Ser Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Asn Val Thr Ile Ser His Gly Asp Leu Thr Pro

20 25 30

Ile Tyr Glu Arg Leu Thr Asn Leu Glu Ala Ser Thr Glu Leu Leu His

35 40 45

Arg Ser Ile Ser Asp Ile Ser Thr Thr Val Ser Asn Ile Ser Ala Asn

50 55 60

Leu Gln Asp Met Thr His Thr Leu Asp Asp Val Thr Ala Asn Leu Asp

65 70 75 80

Gly Leu Arg Thr Thr Val Thr Ala Leu Gln Asp Ser Val Ser Ile Leu

85 90 95

Ser Thr Asn Val Thr Asp Leu Thr Asn Thr Ser Ser Ala His Ala Ala

100 105 110

Thr Leu Ser Ser Leu Gln Thr Thr Val Asp Glu Asn Ser Thr Ala Ile

115 120 125

Ser Asn Leu Lys Ser Asp Val Ser Ser Asn Gly Leu Ala Ile Thr Asp

130 135 140

Leu Gln Asp Arg Val Lys Ser Leu Glu Ser Thr Ala Ser His Gly Leu

145 150 155 160

Ser Phe Ser Pro Pro Leu Ser Val Ala Asp Gly Val Val Ser Leu Asp

165 170 175

Met Asp Pro Tyr Phe Cys Ser Gln Arg Val Ser Leu Thr Ser Tyr Ser

180 185 190

Ala Glu Ala Gln Leu Met Gln Phe Arg Trp Met Ala Arg Gly Thr Asn

195 200 205

Gly Ser Ser Asp Thr Ile Asp Met Thr Val Asn Ala His Cys His Gly

210 215 220

Arg Arg Thr Asp Tyr Met Met Ser Ser Thr Gly Asn Leu Thr Val Thr

225 230 235 240

Ser Asn Val Val Leu Leu Thr Phe Asp Leu Ser Tyr Ile Thr Pro Ile

245 250 255

Pro Ser Asp Leu Ala Arg Leu Val Ser Gln Cys Gly Ile Pro Ser Cys

260 265 270

Val Val Pro Cys Gly Arg Ile Ile His Pro Arg Phe Cys Asp Ser Cys

275 280 285

Val Pro Ser Val Trp Gly Val Leu Glu Leu Thr Cys Leu His Asn Tyr

290 295 300

Phe Pro Asn Arg Arg

305

<210> 7

<211> 314

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<400> 7

Met Ala Gly Leu Asn Pro Leu Gln Arg Arg Glu Val Val Ser Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Asn Val Asn Thr Asn Pro Gly Asp Leu Thr Ser

20 25 30

Val Tyr Glu Arg Leu Thr Gly Leu Glu Ala Ser Thr Glu Ser Leu His

35 40 45

Gln Ser Val Ser Ser Met Ala Ala Thr Val Ser Asp Ile Ser Ala Asp

50 55 60

Leu Gln Gly Thr Thr Arg Ala Leu Asp Asp Val Thr Val Thr Leu Lys

65 70 75 80

Ser Leu Ser Thr Ser Ile Thr Thr Leu Gln Asn Ser Val Thr Thr Leu

85 90 95

Ser Ala Thr Val Ala Glu Leu Thr Asp Thr Ser Ser Ala His Ser Gly

100 105 110

Thr Leu Ser Ser Leu Gln Thr Thr Val Ser Gly Asn Ser Asn Ala Ile

115 120 125

Ala Ser Leu Lys Ser Asp Val Ser Ala Asn Ser Leu Ser Ile Thr Asp

130 135 140

Leu Gln Asn Arg Val Lys Ser Leu Glu Ser Gly Thr Ser His Gly Leu

145 150 155 160

Ser Phe Ser Pro Pro Leu Asn Ile Ala Asn Gly Val Val Ser Leu Asp

165 170 175

Met Asp Pro Tyr Phe Cys Ser Gln Arg Val Ser Leu Thr Ser Tyr Ser

180 185 190

Ala Glu Ala Gln Leu Met Gln Phe Gln Trp Val Ala Arg Gly Thr Thr

195 200 205

Gly Ser Ser Asp Thr Ile Asp Met Thr Val Asn Ala His Cys His Gly

210 215 220

Arg Arg Thr Asp Tyr Met Met Ser Ser Thr Gly Gly Leu Thr Val Ala

225 230 235 240

Ser Asn Ala Val Ser Leu Thr Phe Asp Leu Asp Tyr Ile Thr Asn Met

245 250 255

Pro Pro Asp Leu Ser Arg Leu Ile Pro Ser Ala Gly Phe Gln Ala Ala

260 265 270

Ser Phe Pro Val Asp Ile Ser Phe Thr Arg Asp Ser Ser Thr His Thr

275 280 285

Tyr Gln Val Tyr Gly Val Tyr Ser Ser Ser Arg Val Phe Thr Ile Thr

290 295 300

Phe Pro Thr Gly Gly Asn Gly Thr Thr Asn

305 310

<210> 8

<211> 314

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<220>

<221>Still unclassified feature

<222> (61)..(61)

<223>Xaa can be any naturally occurring amino acid

<220>

<221>Still unclassified feature

<222> (66)..(66)

<223>Xaa can be any naturally occurring amino acid

<220>

<221>Still unclassified feature

<222> (130)..(130)

<223>Xaa can be any naturally occurring amino acid

<220>

<221>Still unclassified feature

<222> (286)..(286)

<223>Xaa can be any naturally occurring amino acid

<220>

<221>Still unclassified feature

<222> (308)..(308)

<223>Xaa can be any naturally occurring amino acid

<220>

<221>Still unclassified feature

<222> (310)..(310)

<223>Xaa can be any naturally occurring amino acid

<400> 8

Met Ala Gly Leu Asn Pro Leu Gln Arg Arg Glu Val Val Gly Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Asn Val Thr Thr Asn Pro Gly Asp Leu Lys Ser

20 25 30

Ile His Glu Arg Leu Thr Ser Leu Glu Ala Ser Thr Glu Ser Leu His

35 40 45

Gln Ser Val Ser Ser Met Ser Ala Thr Leu Ser Asp Xaa Ser Ala Asp

50 55 60

Leu Xaa Asp Thr Thr Arg Ala Leu Asp Asp Val Thr Val Thr Met Asn

65 70 75 80

Ser Leu Ser Ala Thr Ile Ala Ala Leu Gln Asn Ser Leu Thr Thr Leu

85 90 95

Ser Ala Thr Val Asp Glu Leu Thr Asp Thr Ser Ser Ala His Ser Gly

100 105 110

Met Leu Ser Ser Leu Gln Thr Thr Val Asn Gly Asn Ser Ser Ala Ile

115 120 125

Ser Xaa Leu Arg Ser Asp Val Ser Ala Asn Gly Leu Asn Ile Thr Asp

130 135 140

Leu Gln Asn Arg Val Lys Ser Leu Glu Ser Asp Thr Ser His Gly Leu

145 150 155 160

Ser Phe Ser Pro Pro Leu Ser Val Ala Asp Gly Val Val Ser Leu Ser

165 170 175

Met Asp Pro Tyr Phe Cys Ser Gln Arg Val Ser Leu Thr Ser Tyr Ser

180 185 190

Ala Glu Ala Gln Leu Met Gln Phe Gln Trp Val Ala Lys Gly Thr Ser

195 200 205

Gly Ser Ser Asp Thr Ile Asp Met Thr Val Asn Ala His Cys His Gly

210 215 220

Arg Arg Thr Asp Tyr Met Met Ser Ser Thr Gly Gly Leu Thr Val Thr

225 230 235 240

Ser Asn Ala Val Ser Leu Thr Phe Asp Leu Asn Tyr Ile Thr Asn Met

245 250 255

Pro Ser Asp Leu Ser Arg Leu Ile Pro Ser Ala Gly Phe Gln Val Ala

260 265 270

Ser Phe Pro Val Asp Val Ser Phe Thr Arg Glu Ser Ser Xaa His Thr

275 280 285

Tyr Gln Val Tyr Gly Ala Tyr Ser Ser Ala Arg Val Phe Thr Ile Thr

290 295 300

Phe Pro Thr Xaa Val Xaa His Ile Lys His

305 310

<210> 9

<211> 314

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<400> 9

Met Ala Gly Leu Thr Pro Leu Gln Arg Arg Glu Val Val Gly Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Ser Gly Asn Thr Asn Cys Gly Asp Leu Thr Pro

20 25 30

Ile Tyr Asp Arg Leu Ser Ser Leu Glu Ser Ala Val Ala Ser Leu Asn

35 40 45

Gly Ser Val Asn Gly Leu Leu Gln Lys Val Pro Asp Leu Glu Thr Asp

50 55 60

Leu Gln Asn Val Val Ser Ser Leu Asp Gln Thr Asn Ser Thr Leu Ala

65 70 75 80

Glu Leu Ser Lys Glu Leu Arg Gln Leu Ser Ser Ser Val Asp Asn Val

85 90 95

Val Thr Ser Ile Ser Asp Ile Ser Thr Thr Val Ser Gly His Gln Asp

100 105 110

Ala Ile Thr Ala Ile Gln Ile Ser Val His Ala Asn Thr Thr Ala Ile

115 120 125

Thr Asn Leu Lys Ser Ser Ala Ser Thr Ala Ser Leu Lys Ile Thr Asp

130 135 140

Leu Glu Arg Arg Val Glu Ala Ile Glu Ser Gly Ser Asp Ser Asn Leu

145 150 155 160

Arg Phe Val Ser Pro Leu Ser Leu Ser Gln Gly Val Val Ser Leu Val

165 170 175

Met Asp Pro Tyr Phe Cys Ser Asp Asn Gln Ala Leu Thr Ser Tyr Ser

180 185 190

Thr Asp Ala Gln Leu Met Gln Phe Gln Trp Leu Ala Arg Gly Asp Asp

195 200 205

Gly Ser Ser Ser Ser Val Asp Met Leu Val Asn Ala His Cys His Gly

210 215 220

Arg Arg Thr Asp Tyr Met Met Ser Thr Thr Glu Ser Phe Thr Val Thr

225 230 235 240

Gly Asn Ser Val Ser Leu Val Phe Asn Leu Asp Tyr Ile Thr Lys Pro

245 250 255

Pro Thr Glu Met Ser Arg Leu Ile Pro Arg Ala Gly Phe Arg Ala Ala

260 265 270

Ser Phe Pro Val Asp Val Ser Phe Thr Arg Asp Thr Thr Thr His Ala

275 280 285

Tyr Gln Val Tyr Gly Ala Phe Ser Ser Ala Arg Val Phe Lys Ile Thr

290 295 300

Phe Leu Thr Gly Ala Leu Gly Arg Gln Phe

305 310

<210> 10

<211> 312

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<400> 10

Met Ala Gly Leu Thr Pro Leu Gln Arg Arg Glu Val Val Gly Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Ser Gly Asn Thr Asn Cys Gly Asp Leu Thr Pro

20 25 30

Ile Tyr Asp Arg Leu Ser Ser Leu Glu Ser Ala Val Ala Ser Leu Asn

35 40 45

Gly Ser Val Asn Gly Leu Leu Gln Lys Val Pro Asp Leu Glu Thr Asp

50 55 60

Leu Gln Asn Val Val Ser Ser Leu Asp Gln Thr Asn Ser Thr Leu Ala

65 70 75 80

Glu Leu Ser Lys Glu Leu Arg Gln Leu Ser Ser Ser Val Asp Asn Val

85 90 95

Val Thr Ser Ile Ser Gly Ile Ser Thr Thr Val Ser Gly His Gln Asp

100 105 110

Ala Ile Thr Ala Ile Gln Ile Ser Val His Ala Asn Thr Thr Ala Ile

115 120 125

Thr Asn Leu Lys Ser Ser Ala Ser Thr Ala Ser Leu Lys Ile Thr Asp

130 135 140

Leu Glu Arg Arg Leu Glu Ala Val Glu Ser Gly Ser Asp Ser Asn Leu

145 150 155 160

Arg Phe Val Ser Pro Leu Ser Leu Ser Gln Gly Val Val Ser Leu Val

165 170 175

Met Asp Pro Tyr Phe Cys Ser Asp Asn Gln Ala Leu Thr Ser Tyr Ser

180 185 190

Thr Asp Ala Gln Leu Met Gln Phe Gln Trp Leu Ala Arg Gly Asp Asp

195 200 205

Gly Ser Ser Ser Ser Val Asp Met Leu Val Asn Ala His Cys His Gly

210 215 220

Arg Arg Thr Asp Tyr Met Met Ser Thr Thr Glu Ser Phe Thr Val Thr

225 230 235 240

Gly Asn Ser Val Ser Leu Val Phe Asn Leu Asp Tyr Ile Thr Lys Pro

245 250 255

Pro Thr Asp Met Ser Arg Leu Ile Pro Arg Ala Gly Phe Arg Ala Ala

260 265 270

Ser Phe Pro Val Asp Val Ser Phe Thr Arg Asp Thr Thr Thr His Ala

275 280 285

Tyr Gln Val Tyr Gly Ala Phe Ser Ser Ala Arg Val Phe Lys Ile Thr

290 295 300

Phe Leu Thr Gly Gly Thr Gly Thr

305 310

<210> 11

<211> 315

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<400> 11

Met Ala Gly Leu Thr Pro Leu Gln Arg Arg Glu Val Val Gly Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Asn Ala Thr Thr Asn Cys Gly Asp Leu Thr Ala

20 25 30

Ile Tyr Asn Arg Leu Leu Lys Leu Asp Ser Ser Val Glu Ser Leu Thr

35 40 45

Thr Ser Val Gly Glu Leu Ser Lys Gln Phe Leu Ala Leu Glu Ser Gly

50 55 60

Phe Gln Asn Val Glu Ser Ser Ile Gly Gln Leu Asn Thr Ser Phe Asp

65 70 75 80

Thr Leu Ser Glu Glu Ala Arg Gln Leu Gln Ser Ser Val Thr Asp Ile

85 90 95

Thr Asn Ser Ile Ser Ser Leu Ser Ala Thr Val Ser Glu His Gln Asn

100 105 110

Ser Leu Ala Ala Leu Gln Thr Ser Val Gln Thr Asn Ile Thr Asp Ile

115 120 125

Ala Asn Leu Lys Ser Ser Val Thr Thr Leu Ser Leu Thr Ala Thr Asp

130 135 140

Leu Glu Arg Arg Leu Lys Val Ile Glu Ser Gly Ser Ser Ser Ser Leu

145 150 155 160

Thr Phe Ser Ser Pro Leu Ser Leu Ser Asn Gly Val Val Ser Leu Asn

165 170 175

Met Asp Pro Tyr Phe Cys Ser Asp Asn Tyr Ala Leu Thr Ser Tyr Ser

180 185 190

Ser Asp Ala Gln Leu Met Gln Phe Gln Trp Leu Ala Arg Gly Gly Asp

195 200 205

Gly Ser Ser Gly Ser Val Glu Met Leu Val Asn Ala His Cys His Gly

210 215 220

Arg Arg Thr Asp Tyr Met Met Ser Thr Thr Glu Asn Leu Thr Val Thr

225 230 235 240

Gly Asn Ser Thr Ser Leu Val Phe Ser Leu Glu Tyr Ile Thr Lys Pro

245 250 255

Pro Ser Asp Met Ser Arg Leu Ile Pro Arg Ala Gly Phe Gln Ala Ala

260 265 270

Ser Phe Pro Val Asp Val Ser Phe Thr Arg Asp Thr Ala Thr His Ala

275 280 285

Tyr Gln Val Tyr Gly Val Phe Thr Thr Pro Arg Ile Phe Lys Ile Thr

290 295 300

Phe Leu Thr Gly Gly Thr Gly Ala Ala Lys Phe

305 310 315

<210> 12

<211> 306

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<220>

<221>Still unclassified feature

<222> (303)..(303)

<223>Xaa can be any naturally occurring amino acid

<400> 12

Met Glu Gly Leu Thr Pro Leu Gln Arg Arg Glu Val Val Gly Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Ser Val Ser Ile Ser Pro Gly Asp Leu Ile Pro

20 25 30

Leu Tyr Glu Arg Leu Ser Ala Val Glu Glu Thr Cys Ala Thr Val Asn

35 40 45

Asp Ser Leu Gly Arg Leu Thr Ser Leu Val Ser Glu Ile Ser Ala Arg

50 55 60

Ile Asp Asp Leu Ala Arg Thr Leu Gln Asp Thr Ala Ala Gly Leu Asp

65 70 75 80

Gly Val Gln Gly His Val Thr Thr Leu Gln Ser Ser Phe Asp Asp Leu

85 90 95

Phe Ser Arg Val Ala Thr Leu Ser Ser Ser Val Ser Asn Gln Glu Ser

100 105 110

His Leu Thr Thr Ile Ser Ala Ser Val Ser Thr Leu Ser Thr His Val

115 120 125

Ser Asn Leu Gln His Asp Val Ser Ser Thr Ala Leu Thr Val Thr Ser

130 135 140

Leu Glu His Arg Val Glu Ala Leu Glu Ser Gly Ala Gly Ser Asp Leu

145 150 155 160

Thr Phe Met Ala Pro Leu Lys Val Asp Gly Lys Ser Val Ser Leu Asp

165 170 175

Leu Asp Pro Tyr Phe Cys Ser Glu Arg Thr Asn Leu Thr Ser Tyr Ser

180 185 190

Ala Asn Ala Gln Leu Leu Gln Phe Gln Trp Leu Val Arg Ser Glu Gly

195 200 205

Gly Ser Ser Asp Ser Ile Asp Met Asn Val Val Ala His Cys His Gly

210 215 220

Arg Arg Thr Asp Tyr Leu Met Ser Thr His Asp Ser Leu Thr Val Val

225 230 235 240

Gly Asn Ser Val Thr Leu Ile Phe Asn Leu Asp Phe Ile Thr Thr Gln

245 250 255

Gly Val Asp Tyr Ala Arg Leu Val Pro Cys His Gly Phe Gln Gln Ala

260 265 270

Thr Phe Pro Val Asp Ile Ser Phe Thr Lys Gly Thr Ala Thr Gln Ser

275 280 285

Tyr Gln Val Tyr Gly Ala Phe Asp Gly Pro Arg Ile Phe Lys Xaa Thr

290 295 300

Phe Ser

305

<210> 13

<211> 313

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<400> 13

Met Ala Gly Leu Thr Pro Ser Gln Arg Arg Glu Val Val Gly Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Asn Thr Ser Ile Asn Pro Gly Asp Leu Ala Pro

20 25 30

Ile Tyr Ser Arg Leu Thr Ala Leu Glu Val Ala Arg Asp Glu Leu Asn

35 40 45

Glu Ser Leu Ser Glu Leu Ser Ser Ala Val Ser Ala Leu Ser Thr Arg

50 55 60

Phe Asp Asp Ala Ser Met Lys Leu Asn Ser Ile Thr Ala Asp Leu Thr

65 70 75 80

Val Ile Lys Ser Asp Ile Ser Val Leu Asn Ser Ser Val Ser Gly Val

85 90 95

Thr Ser Ser Met Ala Ala Leu Ser Gln Ser Val Ser Asn His Glu Ser

100 105 110

Gln Leu Ala Thr Leu Ser Ser Ser Leu Ala Thr Leu Ser Ser Gln Val

115 120 125

Ala Ala Leu Gln Arg Asp Val Ser Ala Ser Glu Leu Lys Leu Thr Asp

130 135 140

Leu Gln His Arg Val Thr Ala Leu Glu Ser Ser Gly Gly Thr Ser Leu

145 150 155 160

Arg Phe Leu Pro Pro Phe Lys Thr Asp Gly Ala Ser Val Ser Leu Glu

165 170 175

Leu Asp Pro Tyr Phe Cys Ser Glu Arg His Asn Leu Thr Ser Tyr Ser

180 185 190

Ala Ala Ala Gln Leu Leu Gln Phe Gln Trp Leu Val Lys Gly Glu Ser

195 200 205

Gly Val Ser Asp Ser Phe Asp Met Asn Val Val Ala His Cys His Gly

210 215 220

Arg Arg Thr Asp Tyr Leu Met Phe Thr Pro Ser Ser Leu Thr Val Thr

225 230 235 240

Ser Asn Ser Val Ser Leu Val Phe Asp Leu Ser Phe Ile Ile Thr Pro

245 250 255

Gln Ile Asp Leu Ala Arg Leu Val Pro Cys Tyr Gly Phe Gln Gln Ala

260 265 270

Thr Phe Pro Val Asp Val Ser Tyr Thr Arg Gly Glu Asp Thr His Ser

275 280 285

Tyr Gln Val Tyr Gly Ser Phe Asp Thr Pro Arg Ile Phe Lys Ile Thr

290 295 300

Phe Ser Thr Gly Gly Thr Gly Thr Ala

305 310

<210> 14

<211> 276

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<400> 14

Met Asp Gly Leu Thr Gln Ser Gln Arg Arg Glu Val Val Gly Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Asn Val Thr Ile Asn Pro Gly Asp Leu Leu Gln

20 25 30

Leu Arg Asn Arg Val Ser Ala Leu Glu Ser Ala Thr Ala Ser Leu Asn

35 40 45

Glu Thr Val Lys Ala Thr Leu Asp Gln Leu Val Asp Leu Ser Gln Lys

50 55 60

Leu Ser Asn Ala Ala Ala Ala Val Val Glu Ile Arg Arg Asp Leu Ser

65 70 75 80

Ser Leu Thr Gly Asp Val Gln Val Val Gln Ser Ser Leu Glu Ser Leu

85 90 95

Thr Asp Asp Met Ser Asp Leu Ser Asn Gln Val Asn Val Ser Ala Ser

100 105 110

Ser Ile Thr Ser Leu Thr Ser Arg Val Asp Gly Leu Thr Val Asp Val

115 120 125

Thr Asn Leu Lys Ser Asp Val Ser Lys Gln Gly Leu Lys Leu Asn Gly

130 135 140

Leu Glu Gln Arg Val Ala Asn Leu Glu Asn Asp Thr Gly Ser Ala Tyr

145 150 155 160

Thr Phe Ala Ala Pro Leu Lys Leu Asp Asn Gly Thr Val Ser Leu Asp

165 170 175

Leu Asp Pro Tyr Phe Cys Ser Val Asp Arg Asn Leu Thr Ser Tyr Ser

180 185 190

Ala Ser Ala Leu Leu Met Asn Phe Gln Trp Leu Val Arg Gly Glu Gly

195 200 205

Gly Ser Ser Asp Ser Ile Asp Met Asn Val Thr Ala His Ser His Gly

210 215 220

Gln Arg Thr Asp Tyr Met Met Ser Thr Thr Gln Ser Leu Thr Val Thr

225 230 235 240

Gly Asn Ser Val Ser Leu Val Phe Asp Leu Asp Ala Leu Met Ser Pro

245 250 255

Pro Thr Asp Tyr Ser Arg Leu Ile Pro Cys His Gly Phe Gln Gln Ala

260 265 270

Thr Phe Pro Ser

275

<210> 15

<211> 315

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<400> 15

Met Asp Gly Leu Thr Gln Ser Gln Arg Arg Glu Val Val Gly Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Asn Val Thr Ile Asn Pro Gly Asp Leu Leu Gln

20 25 30

Leu Arg Asn Arg Val Ser Val Leu Glu Ser Ala Thr Ala Ser Leu Asn

35 40 45

Glu Thr Val Arg Ala Thr Leu Asp Gln Leu Val Asp Leu Ser Gln Lys

50 55 60

Leu Ser Asn Ala Ala Ala Ala Val Val Glu Ile Arg Arg Asp Leu Ser

65 70 75 80

Ser Leu Thr Gly Asp Val Gln Val Val Gln Ser Ser Leu Glu Ser Leu

85 90 95

Thr Asp Asp Thr Ser Asp Leu Ser Asn Gln Met Asn Val Ser Ala Ser

100 105 110

Ser Ile Thr Ser Leu Thr Ser Arg Val Asp Gly Leu Thr Val Asp Val

115 120 125

Thr Asn Leu Lys Ser Asp Val Ser Lys Gln Gly Leu Thr Leu Ser Gly

130 135 140

Leu Glu Gln Arg Val Val Asn Leu Glu Asn Asp Thr Gly Ser Ala His

145 150 155 160

Thr Phe Ala Ala Pro Leu Lys Leu Asp Asn Gly Thr Val Ser Leu Asp

165 170 175

Leu Asp Pro Tyr Phe Cys Ser Val Asp His Asn Leu Thr Ser Tyr Ser

180 185 190

Ala Ser Ala Leu Leu Met Asn Phe Gln Trp Leu Val Arg Gly Glu Gly

195 200 205

Gly Ser Ser Asp Ser Ile Asp Met Asn Val Thr Ala His Ser His Gly

210 215 220

Gln Arg Thr Asp Tyr Met Met Ser Thr Thr Gln Ser Leu Thr Val Thr

225 230 235 240

Gly Asn Ser Val Ser Leu Val Phe Asp Leu Asp Ala Leu Ile Ser Pro

245 250 255

Pro Thr Asp Tyr Ser Arg Leu Ile Pro Cys His Gly Phe Gln Gln Ala

260 265 270

Thr Phe Pro Val Asp Leu Ser Phe Lys Arg Asp Asp Ala Ala Tyr Ser

275 280 285

Tyr Gln Val Tyr Gly Ser Phe Thr Ser Pro Arg Val Phe Lys Ile Thr

290 295 300

Phe Ser Pro Gly Asn Ser Val Pro Ala Val Ile

305 310 315

<210> 16

<211> 318

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<400> 16

Met Asp Gly Leu Thr Gln Ser Gln Arg Arg Glu Val Val Arg Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Asn Val Thr Ile Asn Pro Gly Asp Leu Thr Gln

20 25 30

Leu Arg Glu Arg Val Ser Ala Leu Glu Ser Ala Asn Ala Ser Leu Asn

35 40 45

Glu Thr Ile Arg Ala Val Leu Asp Gln Leu Val Asp Leu Ser Gln Gln

50 55 60

Leu Gly His Ala Val Ala Ala Val Val Glu Met Arg Arg Asp Leu Asn

65 70 75 80

Ser Leu Thr Gly Asp Val Gln Thr Val Gln Ser Ser Leu Gly Pro Leu

85 90 95

Thr Asp Ser Val Ser Asp Leu Ser Ser Arg Val Thr Glu Ser Ser Ser

100 105 110

Ser Ile Thr Asn Leu Leu Gly Arg Val Asp Arg Leu Thr Thr Asp Val

115 120 125

Thr Asn Leu Lys Ser Asp Val Ser Asp Gln Gly Leu Lys Val Ser Ser

130 135 140

Leu Glu Gln Arg Val Thr Asn Leu Glu Thr Gly Thr Gly Ser Val Tyr

145 150 155 160

Thr Phe Ala Ala Pro Leu Lys Leu Asp Gly Gly Thr Val Ser Leu Asp

165 170 175

Leu Asp Pro Tyr Phe Cys Ser Val Asp His Asn Leu Thr Ser Tyr Ser

180 185 190

Ala Ser Ala Gln Leu Met Asn Phe Gln Trp Leu Val Arg Gly Glu Gly

195 200 205

Gly Ser Ser Asp Ser Ile Asp Met Asn Val Thr Ala His Ser His Gly

210 215 220

Gln Arg Thr Asp Tyr Met Met Ser Thr Thr Gln Ser Leu Thr Val Thr

225 230 235 240

Gly Asn Pro Val Ser Leu Val Phe Asp Leu Asn Ala Leu Thr Ser Pro

245 250 255

Pro Ser Asp Tyr Ser Arg Leu Ile Pro Cys His Gly Phe Gln Gln Ala

260 265 270

Thr Phe Pro Val Asp Leu Ser Phe Lys Arg Asp Asp Val Thr Tyr Ser

275 280 285

Tyr Gln Val Tyr Gly Ser Tyr Thr Ser Pro Arg Val Phe Lys Ile Thr

290 295 300

Phe Ser Pro Gly Asn Pro Val Pro Ala Ile Ile Arg Phe Ile

305 310 315

<210> 17

<211> 314

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<400> 17

Met Asp Gly Leu Thr Gln Gln Gln Arg Arg Glu Val Val Gly Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Ser Val Thr Ile Asn Pro Gly Asp Leu Thr Gln

20 25 30

Ile Arg Glu Arg Leu Ser Ala Leu Glu Ser Ser Asn Ala Ser Leu Ser

35 40 45

Glu Ser Val Gly Ala Val Ser Ser Lys Leu Ala Asp Leu Ser Val Val

50 55 60

Leu Asp Asn Met Ala Val Ser Val Ala Glu Thr Arg Leu Glu Leu Ser

65 70 75 80

Ser Val Ile Ser Asp Val Gln Ser Leu Arg Ser Ser Leu Asp Ser Ser

85 90 95

Ile Ser Glu Leu Ala Ser Ile Ser Ser Leu Val His Asp His Ser Ser

100 105 110

Ser Ile Ser Gly Leu Gln Arg Asp Asn Gly Ala Leu Ser Asn Glu Val

115 120 125

Gly Asn Leu Lys Ser Ser Val Ser Ser Gln Gly Leu Thr Val Ser Ser

130 135 140

Leu Glu Arg Arg Val Gln Ser Leu Glu Gly Ser Ser Ser Met Asn Leu

145 150 155 160

Ser Phe Ala Asp Pro Leu Lys Leu Glu Asn Gly Thr Val Ser Leu Glu

165 170 175

Leu Asp Pro Tyr Phe Cys Ser Val Ser Arg Asn Leu Thr Ser Tyr Ser

180 185 190

Ala Asp Ala Gln Leu Met Gln Phe Gln Trp Ser Val Lys Gly Glu Asp

195 200 205

Gly Ala Gly Asn Ser Ile Asp Met Asp Val Asn Ala His Cys His Gly

210 215 220

Ser Arg Thr Asp Tyr Leu Met Ser Thr Lys Gln Ser Leu Thr Val Thr

225 230 235 240

Thr Ser Pro Ala Thr Leu Val Phe Glu Leu Asp Arg Ile Val Ser Leu

245 250 255

Pro Ser Asp Leu Ser Arg Leu Val Pro Cys Tyr Gly Phe Gln Gln Ala

260 265 270

Thr Phe Pro Val Asp Ile Ser Phe Gln Arg Asp Gly Val Ser His Thr

275 280 285

Tyr Gln Val Tyr Gly Thr Tyr Thr Ser Ser Arg Val Phe Lys Ile Thr

290 295 300

Phe Ser Pro Gly Thr Pro Gly Pro Thr Gly

305 310

<210> 18

<211> 315

<212> PRT

<213>Birds hepato-encephalomyelitis virus

<220>

<221>Still unclassified feature

<222> (314)..(314)

<223>Xaa can be any naturally occurring amino acid

<400> 18

Met Asp Gly Leu Thr Gln Gln Gln Arg Arg Glu Val Val Gly Leu Ile

1 5 10 15

Leu Ser Leu Thr Ser Ser Val Thr Ile Asn Pro Gly Asp Leu Ile Gln

20 25 30

Ile Arg Glu Arg Leu Ser Ala Leu Glu Ser Ala Asn Val Ser Leu Asn

35 40 45

Glu Ser Val Asp Met Val Leu Ser Lys Leu Ser Asp Leu Ser Val Ala

50 55 60

Leu Asp Asn Met Ala Val Ser Val Ala Glu Met Arg Val Gly Leu Ser

65 70 75 80

Ser Leu Thr Ser Asp Val Gln Gly Leu Arg Ala Ser Leu Asp Ser Ser

85 90 95

Ala Ser Glu Leu Thr Ser Leu Ser Leu Ser Val Gln Gly His Ser Ser

100 105 110

Leu Ile Ser Asp Leu Gln Arg Glu Gly Arg Ala Leu Ser Val Glu Val

115 120 125

Asp Asn Leu Lys Ser Ser Val Ser Ser His Gly Leu Thr Ile Ser Ser

130 135 140

Leu Glu Gln Arg Val Gln Ala Leu Glu Val Gly Ser Ser Ala Ser Leu

145 150 155 160

Ser Phe Thr Asp Pro Leu Lys Leu Glu Ala Gly Thr Val Ser Leu Asp

165 170 175

Leu Asp Pro Tyr Phe Cys Ser Val Asn Arg Asn Leu Thr Ser Tyr Ser

180 185 190

Ala Ser Ala Gln Leu Met Ser Phe Gln Trp Ser Val Lys Gly Glu Asp

195 200 205

Gly Ala Ser Asn Ser Ile Asp Met Asp Val Asn Ala His Cys His Gly

210 215 220

Ser Arg Thr Asp Tyr Leu Met Ser Thr Lys Gln Ser Leu Thr Val Leu

225 230 235 240

Thr Ser Pro Ala Thr Leu Val Phe Glu Leu Asp Arg Ile Ile Asn Ile

245 250 255

Pro Ser Asp Leu Ser Arg Leu Ile Pro Cys His Gly Phe Arg Gln Ala

260 265 270

Thr Phe Pro Val Asp Ile Ser Phe Gln Arg Asp Gly Ala Ser His Thr

275 280 285

Tyr Gln Val Tyr Gly Thr Phe Thr Ser Ser Arg Ala Phe Lys Ile Thr

290 295 300

Phe Ser Pro Gly Ser Ser Gly Pro Ala Xaa Phe

305 310 315

<210> 19

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<223>PCR primer

<400> 19

agtatttgtg agtacgattg 20

<210> 20

<211> 17

<212> DNA

<213>Artificial sequence

<220>

<223>PCR primer

<400> 20

ggcgccacac cttaggt 17

Claims (11)

1. it is used to reduce the vaccine of birds reovirus infection, the vaccine is comprising from from more than individual gene type group Birds reovirus birds reovirus antigenic substance and pharmaceutically acceptable carrier, wherein the birds exhale intestines Lonely virus antigen material origin is come from from two genotype groups：The birds of each of genotype group 1 and genotype group 4 exhale intestines The antigenic substance composition of lonely virus.

2. the vaccine of claim 1, wherein the antigenic substance from the birds reovirus from genotype group 1 is derived from Birds reovirus from genotype subgroup 1B.

3. the vaccine of claim 1 or 2, exhales intestines lonely sick wherein the birds reovirus antigenic substance includes the birds for inactivating Poison.

4. the vaccine of any one of claim 1-3, wherein the vaccine includes adjuvant.

5. the vaccine of any one of claim 1-4, wherein the vaccine includes additional antigens material, the additional antigens material From the microorganism caused a disease to birds, rather than from birds reovirus.

6. the preparation method of the vaccine of any one of claim 3-5, it includes inactivation from two genotype groups：Genotype group 1 and the step of the birds reovirus of each of genotype group 4.

7. the preparation method of the vaccine of any one of claim 1-5, it includes for the birds defined in claim 1-5 exhaling intestines The step of lonely virus antigen material mixes with adjuvant.

8. the composition of birds reovirus antigenic substance is included, and the birds reovirus antigenic substance origin comes to be come From two genotype groups：The antigenic substance composition of the birds reovirus of each of genotype group 1 and genotype group 4, institute Composition is stated in the vaccine for reducing birds reovirus infection in birds.

9. origin is come from from two genotype groups：The birds reovirus of each of genotype group 1 and genotype group 4 The birds reovirus antigenic substance of antigenic substance composition is used to manufacture the epidemic disease for reducing birds reovirus infection in birds The purposes of seedling.

10. the vaccine of any one of claim 1-5 or the vaccine that can be obtained by the method for claim 6 or 7 are used to reduce The purposes of birds reovirus infection in birds.

11. method for reducing birds reovirus infection in birds, it includes appointing in applying claim 1-5 to birds The vaccine of one or the vaccine that can be obtained by the method for claim 6 or 7.