CN106085974B - A kind of zika virus pseudovirion and preparation method thereof - Google Patents
A kind of zika virus pseudovirion and preparation method thereof Download PDFInfo
- Publication number
- CN106085974B CN106085974B CN201610398517.XA CN201610398517A CN106085974B CN 106085974 B CN106085974 B CN 106085974B CN 201610398517 A CN201610398517 A CN 201610398517A CN 106085974 B CN106085974 B CN 106085974B
- Authority
- CN
- China
- Prior art keywords
- zika virus
- gene
- bacteriophage
- pseudovirion
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/24011—Flaviviridae
- C12N2770/24111—Flavivirus, e.g. yellow fever virus, dengue, JEV
- C12N2770/24123—Virus like particles [VLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/24011—Flaviviridae
- C12N2770/24111—Flavivirus, e.g. yellow fever virus, dengue, JEV
- C12N2770/24151—Methods of production or purification of viral material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of zika virus pseudovirions and preparation method thereof.The present invention provides zika virus pseudovirions, wrap up the pseudovirion that zika virus NS5 gene is formed for coat protein；The coat protein is made of bacteriophage MS2 maturase and bacteriophage MS2 capsid protein；The nucleotides sequence of the zika virus NS5 gene is classified as sequence 2 19-2727.The experiment proves that, the present invention imports host strain with the recombinant vector of expression phage capsid protein and maturase Protein reconstitution carrier and expression zika virus genome portion segment, culture, is packaged to be zika virus pseudovirion, to obtain zika virus pseudovirion for the first time.
Description
Technical field
The present invention relates to a kind of zika virus pseudovirions and preparation method thereof, belong to field of biotechnology.
Background technique
Zika virus (Zika virus) is a kind of virus by mosquitoes spread, the virus may cause baby suffer from it is " small
Head disease ".The virus belongs to flaviviridae Flavivirus, and single strand RNA virus belongs to homologous of the same clan with dengue fever virus.2015, bar
West has 2700 babies' suspection to suffer from microcephaly, wherein 29 people are dead, is concentrated mainly on northeast, and Brazil in 2014 only has
147 microcephaly cases.Zika virus is found to be in Uganda of the forties in last century for the first time, once flows later in Africa
Row.It spreads after zika virus to the South Pacific Ocean and Asia, has just been spread in the recent period to Latin America.Brazil was at 2015 4
There is first case zika virus in the moon, is then diffused rapidly to 18 provinces.It is extremely urgent to the development of zika virus diagnostic reagent,
The especially development of diagnostic nucleic acid reagent, this just needs to use internal reference reference material.Although use authentic particles as reference material more
Can really reaction diagnostic nucleic acid reagent performance, but due to true zika virus have certain infectiousness, easily cause to give birth to
Object safety problem, and it is not easy to storage and transport.If using exposed RNA as its reference material, due in environment Rnase it is a large amount of
In the presence of being easily degraded so that exposed RNA is unstable.This just needs a kind of RNA with resistance to Rnase characteristic, and armoring RNA is false
Virus is exactly one such.RNA can be wrapped in the capsid protein of MS2 bacteriophage by armoring RNA, and RNA is made to have resistance to RNase
Characteristic, while can be used to simulate the extraction process of authentic specimen, and be able to achieve large-scale production.
Armoring RNA is a kind of pseudovirion for being packaged with exogenous RNA, generally uses MS2 phage packaging system.This is
Controlling is simple for pseudovirion, safety, short preparation period.Mainly known using the capsid protein of bacteriophage and mature zymoprotein
It not and packs the exogenous RNA containing MS2 bacteriophage identification sequence and is assembled, form mature pseudovirion.
Summary of the invention
It is an object of the present invention to provide a kind of zika virus pseudovirions.
Zika virus pseudovirion provided by the invention wraps up the vacation that zika virus NS5 gene is formed for coat protein
Virion；
The coat protein is made of bacteriophage MS2 maturase and bacteriophage MS2 capsid protein；
The nucleotides sequence of the zika virus NS5 gene is classified as sequence 2 19-2727.
Another object of the present invention is to provide a kind of method for preparing above-mentioned zika virus pseudovirion.
Method provided by the invention is to pack zika virus NS5 gene using MS2 phage packaging system, obtains stockaded village's card
Hiv pseudovirus particle；
The nucleotides sequence of the zika virus NS5 gene is classified as sequence 2 19-2727.
It is described to use MS2 phage packaging system packaging zika virus NS5 gene for the table in host strain in the above method
It is bitten up to zika virus NS5 gene, bacteriophage MS2 maturation enzyme coding gene and bacteriophage MS2 capsid protein encoding gene, expression
MS2 packaging site on thallus MS2 capsid protein meeting automatic identification NS5 gene, carries out virion under mature role of apoenzyme
Packaging, to obtain being packaged to be zika virus pseudovirion.
Zika virus NS5 gene is expressed in the form of the segment containing zika virus NS5 gene in host strain；Contain stockaded village's card
The segment of virus N S5 gene identifies that segment and the zika virus NS5 gene form by MS2 phage packaging site.
The nucleotides sequence of the zika virus NS5 gene is classified as sequence 2 19-2727.
The above method includes the following steps:
1) by the segment containing zika virus NS5 gene, bacteriophage MS2 maturation enzyme coding gene and bacteriophage MS2 capsid
Protein coding gene imports in host strain, obtains recombinant bacterium；
The segment containing zika virus NS5 gene identifies segment and stockaded village's card disease by MS2 phage packaging site
Malicious NS5 gene composition；
2) recombinant bacterium described in Fiber differentiation to get arrive zika virus pseudovirion.
In the above method,
The segment containing zika virus NS5 gene is imported in host strain by recombinant vector A,
The recombinant vector A is the carrier for obtaining the fragment inserting expressioning carrier containing zika virus NS5 gene；
The segment containing zika virus NS5 gene is following 1) -3) in it is any:
1) code area is DNA molecular shown in sequence 2 in sequence table；
2) hybridize under strict conditions with the DNA sequence dna 1) limited and encode the DNA molecular with identical function protein；
3) at least have 70% with the DNA sequence dna 1) limited, at least have 75%, at least having with 80%, at least
85%, at least with 90%, at least with 95%, at least with 96%, at least with 97%, at least have 98% or at least have
There is 99% homology and coding has the DNA molecular of identical function protein；
Above-mentioned stringent condition can hybridize at 65 DEG C in 6 × SSC, the solution of 0.5%SDS, then with 2 × SSC,
It is primary that 0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film.
The bacteriophage MS2 maturation enzyme coding gene and bacteriophage MS2 capsid protein encoding gene are led by recombinant vector B
Enter in host strain,
The recombinant vector B is that will encode base containing bacteriophage MS2 maturation enzyme coding gene and bacteriophage MS2 capsid protein
The carrier that the fragment inserting expressioning carrier of cause obtains；
The segment containing bacteriophage MS2 maturation enzyme coding gene and bacteriophage MS2 capsid protein encoding gene is such as
Lower 1) -3) any in:
1) code area is DNA molecular shown in sequence 1 in sequence table；
2) hybridize under strict conditions with the DNA sequence dna 1) limited and encode the DNA molecular with identical function protein；
3) at least have 70% with the DNA sequence dna 1) limited, at least have 75%, at least having with 80%, at least
85%, at least with 90%, at least with 95%, at least with 96%, at least with 97%, at least have 98% or at least have
There is 99% homology and coding has the DNA molecular of identical function protein.
In the above method,
The expression vector in expression vector and the recombinant vector B in the recombinant vector A is identical or different.
In the above method,
Expression vector in the recombinant vector B is pET-30a+；
Expression vector in the recombinant vector A is pACYCDuet-1；
The host strain is Escherichia coli.
In the above method,
Further include following steps after the Fiber differentiation in the step 2): by the bacterial cell disruption after the Fiber differentiation,
Breakdown products supernatant is collected, zika virus pseudovirion is obtained.
Above-mentioned zika virus pseudovirion or above-mentioned method preparation zika virus pseudovirion as with
Application in the control reference product in zika virus nucleic acid detection reagent is also the scope of protection of the invention；
Or prepared by the zika virus pseudovirion of above-mentioned zika virus pseudovirion or the preparation of above-mentioned method
It is also the scope of protection of the invention for the application in zika virus nucleic acid detection reagent.
The zika virus pseudovirion of above method preparation is also the scope of protection of the invention.
The experiment proves that the present invention expression phage capsid protein and maturase Protein reconstitution carrier and expression
The recombinant vector of zika virus genome portion segment imports host strain, and culture is packaged to be zika virus pseudovirion, is
Zika virus pseudovirion is obtained for the first time.
Detailed description of the invention
Fig. 1 is recombinant plasmid pET-30a-MS2 positive clone identification.
Fig. 2 is the positive clone identification of recombinant plasmid pACYCD-NS5.
Fig. 3 is RT-PCR and the PCR real-time fluorescence quantitative PCR of zika virus plate armour RNA pseudovirion.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Strain, plasmid and the reagent used in following examples is as follows:
Plasmid pACYCDuet-1 is purchased from Novagen company.
Plasmid pET-30a+ is purchased from Novagen company.
Product bacterial strain BL21 (DE3), Top10 are purchased from Tiangen company.
Restriction enzyme, DNA polymerase are purchased from NEB company.
T4 DNA ligase, AMV reverse transcriptase is purchased from Promega company.
The small extraction reagent kit of plasmid, virus RNA extraction kit are purchased from Tiangen company.
Embodiment 1, the recombinant vector pET-30a- for expressing MS2 phage capsid protein gene and maturase protein gene
The building of MS2
One, the amplification of MS2 phage capsid protein and maturase protein gene sequence
By plasmid pMS27 (plasmid purchased from Department of Biomedical Molecular Biology,
GhentUniversity, article No.: LMBP05349) it is template, PCR is carried out with following MS2 upstream primer and MS2 downstream primer
Amplification, obtains PCR product, obtains the DNA fragmentation of the capsid protein gene containing MS2 bacteriophage and maturase protein gene.
MS2 upstream primer: 5 '-catgCCATGGtgcgagcttttagtacccttgatag-3’
MS2 downstream primer: 5 '-gcgcAAGCTTtggccggcgtctattagtagatgc-3’
Amplification system: 50 μ l systems amplification, 4 pipe, 10 μ l of 5*Buffer, 0.5 1 μ l of μ l, dNTP of archaeal dna polymerase, upstream is drawn
1 35.5 μ l of μ l, ddH2O of 1 μ l of object, downstream primer 1 μ l, template pMS27
Amplification program: 98 DEG C of 5min；98 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 60s；It repeats step 2-440 to recycle, 72 DEG C
10min, 12 DEG C of 5min.
PCR product is subjected to agarose gel electrophoresis, size 1611bp is consistent with expection.Recycle purpose band.
PCR product is sent into sequencing, which has nucleotide shown in sequence 1 in sequence table.
DNA molecular shown in sequence 1 is by MS2 bacteriophage maturase protein coding gene (1-1182 cores in sequence table
Thuja acid) and MS2 phage capsid protein encoding gene (1183-1611 nucleotide) composition.
Two, the building of recombinant vector pET-30a-MS2
The PCR product and carrier pET- of above-mentioned preparation are expanded using restriction enzyme BamH I and III double digestion of Hind
30a+, 37 DEG C digestion 2 hours, reaction system: BamH I 2 μ l, Hind III 2 μ l, Buffer 4 μ l, the PCR of an above-mentioned preparation are produced
32 μ l of object (or carrier pET-30a+).
Digestion products are purified, the target fragment of purifying and carrier are subjected to enzyme by following system and even reacted: T4DNA
0.5 μ l, T4DNA Ligase Buffer of Ligase, 1 μ l, 5.5 μ l, pET-30a+3 μ l of target fragment；22 DEG C of connection 2h.Take 5
μ l connection product mixes gently on ice with 50 μ l Top10 competent cells, ice bath 30min, and 42 DEG C of heat shock 90s are immediately placed on
3min on ice, be added 800 μ l non-resistants LB culture medium, 37 DEG C, 150rpm be incubated for 60min, by product 5000rpm after incubation from
Heart 4min abandons 600 μ l supernatants, and remaining supernatant and bacterial sediment are mixed, LB solid plate of the coating containing kan resistance, and 37 DEG C,
Inversion is incubated overnight.As a result: growing the single colonie of bacterium on plate, meet expection.
Single colonie on picking plate is resuspended in the physiological saline of 20 μ l, is carried out bacterium colony PCR and is verified positive colony；
Amplification system: 20 μ l systems amplification, 8 pipe, 1 μ l, Taq archaeal dna polymerase of 10*Buffer, 0.5 1.2 μ of μ l, MgCl2
1 μ l of l, dNTP, 0.5 μ l of upstream primer, 0.5 μ l of downstream primer, 1 13.3 μ l of μ l, ddH2O of single colonie re-suspension liquid
Amplification program: 95 DEG C of 5min；95 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 60s；It repeats step 2-4 40 to recycle, 72 DEG C
10min, 12 DEG C of 5min.
The agarose gel electrophoresis that amplified production is carried out to 0.8%, as a result as shown in Figure 1, amplifying the expansion of purpose band
The company, Song Qing section for increasing purpose band out is sequenced, and correctly to construct successful positive colony, which is connect for sequencing
Kind is in the LB liquid medium of the Kan resistance of 10ml, and 37 DEG C, 220rpm is incubated overnight.By the bacterium solution of culture collect to 1.5ml from
In heart pipe, 12000rpm is centrifuged 2min, abandons supernatant, collects bacterial sediment, carries out matter by the small extraction reagent kit of the plasmid of Tiangeng company
Grain extracts to arrive recombinant vector pET-30a-MS2.Recombinant plasmid is stored in -20 DEG C, fungi preservation is in -80 DEG C.
Recombinant vector pET-30a-MS2 is sent into sequencing, is carried to replace DNA molecular shown in sequence 1 in sequence table
DNA fragmentation between III restriction enzyme site of BamH I and Hind of body pET-30a+, obtained carrier.
Embodiment 2, express zika virus NS5 gene recombinant vector pACYCD-NS5 carrier building
One, the amplification of enteron aisle matrix protein gene sequence
With containing enteron aisle stromatin cloning vector pUC-NS5 (plasmid make a living work biotech firm synthesis, choose sequence
Gi | 226377833 |) it is template, PCR amplification is carried out with following NS5 upstream primer and NS5 downstream primer, is obtained containing stockaded village's card
The segment of virus N S5 gene.
NS5 upstream primer: 5 '-cccAAGCTTccggaggatcaccacgggAGGTGGGACGGGAGAGACTCTG-3’
NS5 downstream primer: 5 '-cccCTCGAGccggaggatcaccacgggCTCGTCTGAATCAGATGTCGGCC-3’
Amplification system: 50 μ l systems amplification, 4 pipe, 10 μ l of 5*Buffer, 0.5 1 μ l of μ l, dNTP of archaeal dna polymerase, upstream is drawn
1 μ l of object, 1 μ l of downstream primer, 1 35.5 μ l of μ l, ddH2O of template
Amplification program: 98 DEG C of 5min；98 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 60s；It repeats step 2-440 to recycle, 72 DEG C
10min, 12 DEG C of 5min.
PCR product is subjected to agarose gel electrophoresis, size 2727bp is consistent with expection.Recycle purpose band.
PCR product is sent into sequencing, which has nucleotide shown in sequence 2 in sequence table.
Segment containing zika virus NS5 gene shown in sequence 2 identifies segment (sequence 2 by MS2 phage packaging site
1-18) and zika virus NS5 gene (sequence 2 19-2727).
Two, the building of recombinant vector pACYCD-NS5
The PCR product of the above-mentioned preparation expanded using restriction enzyme Hind III and I double digestion of Xho (contains stockaded village's card
The segment of virus N S5 gene) and carrier pACYCDuet-1 (being purchased from Novagen company, catalog number (Cat.No.): 71147-3), 37 DEG C of digestions 2
Hour, reaction system: Hind III 2 μ l, Xho I 2 μ l, Buffer 4 μ l, 32 μ l. of PCR product (or carrier pACYCDuet-1)
Digestion products are purified, the target fragment of purifying and carrier are subjected to enzyme by following system and even reacted: T4DNA
0.5 μ l, T4DNA Ligase Buffer of Ligase, 1 μ l, 5.5 3 μ l of μ l, pACYCDuet-1 of target fragment；22 DEG C of connections
2h.5 μ l connection products are taken to mix gently on ice with 50 μ l Top10 competent cells, ice bath 30min, 42 DEG C of heat shock 90s are stood
It is placed in 3min on ice, the LB culture medium of 800 μ l non-resistants is added, 37 DEG C, 150rpm is incubated for 60min, by product after incubation
5000rpm is centrifuged 4min, abandons 600 μ l supernatants, and remaining supernatant and bacterial sediment are mixed, and LB solid of the coating containing Cm resistance is flat
Plate, 37 DEG C, inversion is incubated overnight.As a result: growing the single colonie of bacterium on plate, meet expection.
Single colonie on picking plate is resuspended in the physiological saline of 20 μ l, is carried out bacterium colony PCR and is verified positive colony；It adopts
It is identified with segmented, same bacterial strain is respectively adopted two pairs of primers and carries out bacterium colony PCR.
Amplification system: 20 μ l systems amplification, 8 pipe, 2 μ l, Taq archaeal dna polymerase of 10*Buffer, 0.5 1.2 μ of μ l, MgCl2
1 μ l of l, dNTP, 0.5 μ l of upstream primer, 0.5 μ l of downstream primer, 1 13.3 μ l of μ l, ddH2O of single colonie re-suspension liquid
Amplification program: 95 DEG C of 5min；95 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 60s；It repeats step 2-440 to recycle, 72 DEG C
10min, 12 DEG C of 5min.
The agarose gel electrophoresis that amplified production is carried out to 0.8%, as a result as shown in Fig. 2, two pairs of primer amplification bands are big
Small is respectively 1700bp and 1200bp, as a result meets expection.Company, purpose band Song Qing section will be amplified to be sequenced, sequencing is just
True is the successful positive colony of building, which is inoculated in the LB liquid medium of the Cm resistance of 10ml, 37 DEG C,
220rpm is incubated overnight.The bacterium solution of culture is collected into 1.5ml centrifuge tube, 12000rpm is centrifuged 2min, abandons supernatant, collects bacterium
Body precipitating carries out plasmid extraction by the small extraction reagent kit of the plasmid of Tiangeng company to get recombinant vector pACYCD-NS5 is arrived.It will recombination
Plasmid is stored in -20 DEG C, and fungi preservation is in -80 DEG C.
Recombinant vector pACYCD-NS5 is sent into sequencing, for zika virus NS5 will be contained shown in sequence 2 in sequence table
The carrier that DNA fragmentation between I restriction enzyme site of Hind III and Xho of the segment replacement carrier pACYCDuet-1 of gene obtains.
Embodiment 3, packaging zika virus pseudovirus
One, the building of recombinant bacterium
Constructed recombinant plasmid pET-30a-MS2 and pACYCD-NS5 press 5 μ l+ in difference Example 1 and embodiment 2
The volume of 5 μ l mixes, and takes 5 μ l to be added in the competent cell of BL21 (DE3) of 50 μ l, mixing is gently blown and beaten with rifle, is placed in
On ice, ice bath 30min, 42 DEG C of heat shock 90s are immediately placed on 3min on ice, and the LB culture medium of 800 μ l non-resistants, 37 DEG C of perseverances are added
Warm concussion and cultivate case, 150rpm are incubated for 60min, and product 5000rpm after incubation is centrifuged 4min, abandons 600 μ l supernatants, will be in residue
It is mixed with bacterial sediment clearly, is coated with the LB solid plate containing Cm and Kan resistance, 37 DEG C, inversion is incubated overnight.As a result: plate
On grow the single colonie of bacterium, meet expection.
Single colonie on picking plate is resuspended in the physiological saline of 20 μ l, is carried out bacterium colony PCR and is verified positive colony, together
When to MS2 gene (primer be MS2 upstream primer and MS2 downstream primer, amplified production size be 1611bp) and NS5 gene (draw
Object is NS5 upstream primer and NS5 downstream primer, and amplified production size is expanded for 2727bp) sequence.
Amplification system: 20 μ l systems amplification, 8 pipe, 2 μ l, Taq archaeal dna polymerase of 10*Buffer, 0.5 1.2 μ of μ l, MgCl2
1 μ l of l, dNTP, 0.5 μ l of upstream primer, 0.5 μ l of downstream primer, 1 13.3 μ l of μ l, ddH2O of single colonie re-suspension liquid
Amplification program: 95 DEG C of 5min；95 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 60s；It repeats step 2-4 40 to recycle, 72 DEG C
10min, 12 DEG C of 5min.
Amplified production is carried out to 0.8% agarose gel electrophoresis, as a result as shown in Fig.1 and Fig.2, Fig. 1 is the MS2 of identification
Positive colony, Fig. 2 are the NS5 positive colony of identification.Amplifying purpose band is the successful positive colony of building, by the single bacterium
The LB liquid medium for being inoculated in Cm the and Kan resistance of 10ml is fallen, 37 DEG C, 220rpm is cultivated.Thallus is saved, which is named as
PET-30a-MS2-ACYCD-NS5, as containing the recombinant bacterium of complex carries.
Two, inducing expression is packaged to be zika virus pseudovirion
The recombinant bacterium pET-30a-MS2-ACYCD-NS5 containing complex carries that above-mentioned one prepares is subjected to plate streaking, is made
It grows single colonie, and picking single colonie is inoculated in the LB liquid medium that Cm adds Kan resistance, and 37 DEG C, 220rpm constant temperature oscillation is trained
Feeding case is incubated overnight.The bacterium solution being incubated overnight is inoculated in the LB Liquid Culture that new Cm adds Kan resistance in the ratio of 1:100
Base, 37 DEG C, 220rpm constant-temperature shaking incubator to OD600=0.4-0.6 is added the IPTG to final concentration of 1mM of 0.5M, and 22
DEG C, 200rpm cultivates 6h, collects thallus；
Thallus is resuspended with lysate (100mM Tris-HCl (pH8.0), 10% glycerol, 1%Triton X-10), is placed in
In mixture of ice and water, mixture of ice and water is made not have bacteria suspension liquid level, thallus is carried out to bacteria suspension using ultrasonic cell disruption instrument
It is broken；Ultrasonication parameter are as follows: ultrasonic 3s stops 4s, and being crushed the time is 15min, is crushed 60% that power is general power；It will break
Solution after broken is centrifuged 5min in 12000rpm, collects supernatant, obtains zika virus pseudovirion.
Three, the verifying of pseudovirion
The zika virus pseudovirion that above-mentioned two are prepared carries out nucleic acid extraction (daily root virus RNA extraction kit
Extract), obtain RNA.
Using RNA as template, RT-PCR and PCR verifying (7500real time PCR) is carried out with following primer.
Primer are as follows: ZK-NS5-F:AGGCATGGGGGAGGATTAGT
ZK-NS5-R:CCCATCCAATGGTCCTCGTT
RT-PCR system: the amplification of 20 μ l systems, 2 0.5 μ l, Taq archaeal dna polymerase of μ l, AMV-RT of 10*Buffer, 0.5 μ
L, MgCl2 1.2 μ l, dNTP 1 μ l, 0.5 μ l of upstream primer, 0.5 μ l of downstream primer, template 2 μ l, EvaGreen 0.6 μ l, ROX
0.2 11 μ l of μ l, ddH2O
PCR amplification program: 50 DEG C of 30min, 95 DEG C of 5min；95 DEG C of 15s, 58 DEG C of 30s, 68 DEG C of 20s；Repeat step 3-5 32
A circulation, 68 DEG C of 10min, 12 DEG C of 5min.
PCR system: the amplification of 20 μ l systems, 2 μ l, Taq archaeal dna polymerase of 10*Buffer 0.5 μ l, MgCl21.2 μ l, dNTP
1 μ l, 0.5 μ l of upstream primer, 0.5 μ l of downstream primer, 2 0.6 0.2 11.5 μ l of μ l, ddH2O of μ l, ROX of μ l, EvaGreen of template
RT-PCR amplification program: 95 DEG C of 5min；95 DEG C of 15s, 58 DEG C of 30s, 68 DEG C of 20s；Step 3-5 32 circulations are repeated,
68 DEG C of 10min, 12 DEG C of 5min.
Amplification is fig. 3, it is shown that obtain zika virus NS5 segment, it was demonstrated that obtained pseudovirion is
Zika virus pseudovirion.
Claims (10)
1. a kind of zika virus pseudovirion wraps up the pseudovirion that zika virus NS5 gene is formed for coat protein；
The coat protein is made of bacteriophage MS2 maturase and bacteriophage MS2 capsid protein；
The nucleotides sequence of the zika virus NS5 gene is classified as sequence 2 19-2727.
2. a kind of method for preparing zika virus pseudovirion described in claim 1 is using MS2 phage packaging system packet
Zika virus NS5 gene is filled, zika virus pseudovirion is obtained；
The nucleotides sequence of the zika virus NS5 gene is classified as sequence 2 19-2727.
3. according to the method described in claim 2, it is characterized by: described using MS2 phage packaging system packaging stockaded village's card disease
Malicious NS5 gene be in host strain express bacteriophage MS2 maturation enzyme coding gene, bacteriophage MS2 capsid protein encoding gene and
Zika virus NS5 gene is packaged to be the zika virus pseudovirion containing zika virus NS5 gene；
The nucleotides sequence of the zika virus NS5 gene is classified as sequence 2 19-2727.
4. according to the method in claim 2 or 3, it is characterised in that:
Described method includes following steps:
1) by the segment containing zika virus NS5 gene, bacteriophage MS2 maturation enzyme coding gene and bacteriophage MS2 capsid protein
Encoding gene imports in host strain, obtains recombinant bacterium；
The segment containing zika virus NS5 gene identifies segment and the zika virus NS5 by MS2 phage packaging site
Gene composition；
2) recombinant bacterium described in Fiber differentiation to get arrive zika virus pseudovirion.
5. according to the method described in claim 4, it is characterized by:
The segment containing zika virus NS5 gene is imported in host strain by recombinant vector A,
The recombinant vector A is the carrier for obtaining the fragment inserting expressioning carrier containing zika virus NS5 gene；
The segment containing zika virus NS5 gene is DNA molecular shown in sequence 2 in sequence table；
The bacteriophage MS2 maturation enzyme coding gene and bacteriophage MS2 capsid protein encoding gene pass through recombinant vector B importing place
In main bacterium,
The recombinant vector B is will be containing bacteriophage MS2 maturation enzyme coding gene and bacteriophage MS2 capsid protein encoding gene
The carrier that fragment inserting expressioning carrier obtains；
The segment containing bacteriophage MS2 maturation enzyme coding gene and bacteriophage MS2 capsid protein encoding gene is sequence table
DNA molecular shown in middle sequence 1.
6. according to the method described in claim 5, it is characterized by:
The expression vector in expression vector and the recombinant vector B in the recombinant vector A is identical or different.
7. method according to claim 5 or 6, it is characterised in that:
Expression vector in the recombinant vector B is pET-30a+；
Expression vector in the recombinant vector A is pACYCDuet-1；
The host strain is Escherichia coli.
8. method according to claim 5 or 6, it is characterised in that:
Further include following steps after the Fiber differentiation in the step 2: the bacterial cell disruption after the Fiber differentiation is collected
Breakdown products supernatant obtains zika virus pseudovirion.
9. the stockaded village of any method preparation in zika virus pseudovirion described in claim 1 or claim 2-8
Card hiv pseudovirus particle is as the application in the control reference product in zika virus nucleic acid detection reagent；
Or the stockaded village that in zika virus pseudovirion described in claim 1 or claim 2-8 prepared by any method
Card hiv pseudovirus particle is in preparation for the application in zika virus nucleic acid detection reagent.
10. the zika virus pseudovirion obtained by any the method for claim 2-8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610398517.XA CN106085974B (en) | 2016-06-07 | 2016-06-07 | A kind of zika virus pseudovirion and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610398517.XA CN106085974B (en) | 2016-06-07 | 2016-06-07 | A kind of zika virus pseudovirion and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106085974A CN106085974A (en) | 2016-11-09 |
| CN106085974B true CN106085974B (en) | 2019-08-09 |
Family
ID=57227880
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610398517.XA Active CN106085974B (en) | 2016-06-07 | 2016-06-07 | A kind of zika virus pseudovirion and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106085974B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MX357202B (en) | 2012-02-16 | 2018-06-28 | Vlp Therapeutics Llc | Virus like particle composition. |
| TWI676636B (en) | 2013-07-12 | 2019-11-11 | Ｖｌｐ醫療股份有限公司 | Virus like particle comprising pd-1 antigen or pd-1 ligand antigen |
| WO2016021209A1 (en) | 2014-08-08 | 2016-02-11 | Vlp Therapeutics, Llc | Virus like particle comprising modified envelope protein e3 |
| US10385101B2 (en) | 2014-08-08 | 2019-08-20 | Vlp Therapeutics, Llc | Virus like particle comprising modified envelope protein E3 |
| CA2960102C (en) | 2014-09-11 | 2023-10-24 | Vlp Therapeutics, Llc | Flavivirus virus like particle |
| WO2017150683A1 (en) * | 2016-03-04 | 2017-09-08 | Vlp Therapeutics, Llc | Zika virus virus like particle |
| CN108239652B (en) * | 2016-12-27 | 2020-03-17 | 天津大学 | Zika virus capsid protein rigid fusion expression vector and construction and application thereof |
| CN107988239B (en) * | 2017-11-29 | 2021-03-19 | 南方医科大学 | Recombinant gene of Zika virus and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559731A (en) * | 2011-12-27 | 2012-07-11 | 中国检验检疫科学研究院 | Pseudovirion vector and preparation method and application thereof |
| CN104774974A (en) * | 2015-05-07 | 2015-07-15 | 山东出入境检验检疫局检验检疫技术中心 | Coliphage MS2 standard sample and preparing method thereof |
-
2016
- 2016-06-07 CN CN201610398517.XA patent/CN106085974B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559731A (en) * | 2011-12-27 | 2012-07-11 | 中国检验检疫科学研究院 | Pseudovirion vector and preparation method and application thereof |
| CN104774974A (en) * | 2015-05-07 | 2015-07-15 | 山东出入境检验检疫局检验检疫技术中心 | Coliphage MS2 standard sample and preparing method thereof |
Non-Patent Citations (1)
| Title |
|---|
| A report on the outbreak of Zika virus on Easter Island, South Pacific, 2014;J. Tognarelli et al.;《Arch Virol》;20151126(第161期);第665–668页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106085974A (en) | 2016-11-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106085974B (en) | A kind of zika virus pseudovirion and preparation method thereof | |
| CN103668472B (en) | Method for constructing eukaryon gene knockout library by using CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system | |
| CN104846010B (en) | A kind of method for deleting transgenic paddy rice riddled basins | |
| CN108546716A (en) | A kind of genome edit methods | |
| CN107502608A (en) | Construction method and application for sgRNA, ALDH2 gene delection cell line for knocking out people's ALDH2 genes | |
| CN105593367A (en) | CRISPR-Cas9 specificity pig SLA-1 gene knockout method and sgRNA used for specific targeting SLA-1 gene | |
| CN107630018A (en) | A kind of kit for being used to editing or repairing HBB gene | |
| CN106414740A (en) | Method for specific knockout of swine SLA-3 gene using CRISPR-Cas9 specificity, and sgRNA used for specifically targeting sla-3 gene | |
| CN103343120A (en) | Wheat genome site-specific modification method | |
| CN104755618A (en) | Digital to biological converter | |
| CN111849979B (en) | sgRNA for targeted knockout of RPSA gene and construction method of RPSA gene knockout cell line | |
| CN109750035A (en) | Target and guide the sgRNA of Cas9 albumen high efficiency cutting TCR and B2M locus | |
| CN109706148A (en) | A kind of gRNA, gRNA composition and electric shifting method for knocking out BCL11A gene or BCL11A genetic enhancer | |
| CN104109666A (en) | Chromosome specific marker of elytrigia elongata in wheat background and use thereof | |
| CN110055273A (en) | The application of GhMAH1 albumen and its encoding gene in regulation cotton fiber length | |
| CN105969786B (en) | A kind of plasmid for expressing MS2 phage capsid protein and maturase | |
| CN103215299B (en) | Plasmid for expressing plutella xylostella arginine kinase genes dsRNA (double-stranded ribonucleic acid) and application | |
| CN106755033A (en) | A kind of Escherichia coli bacterial ghost carrier pPBA1100 DLS ES and preparation method thereof | |
| CN106754946A (en) | A kind of artificial constructed Araneus ventricosus dragline silk protein and its construction method | |
| CN107056908A (en) | Soybean salt-tolerance gene GmCHS5 and its application | |
| JP2017029159A (en) | Compositions and methods for creating altered and improved cells and organisms | |
| CN106497958A (en) | A kind of method of rapid build recombiant plasmid | |
| CN113736806B (en) | Gene for improving oil synthesis of marine nannochloropsis and application thereof | |
| CN102433330A (en) | Recombinant plasmid for genetic transformation of pleurotus eryngii and application thereof | |
| CN109486856A (en) | Moso bamboo protoplast circular rna is overexpressed system construction method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |