CN106047903A - Grape vvacs1 gene and application thereof - Google Patents

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a grape VvACS1 gene and application thereof. The gene can be acquired by cloning in Thomson seedless grape, specific expression of the gene in fruit stem of the Thomson seedless grape is highly related to release of ethylene of the fruit stem; maturing time of fruit can be affected by using the gene to convert other plants and by over-expression, for example, after the gene is used to convert tomato and is over-expressed, maturing time of tomato can be prolonged. Further development and application of the gene have high practical value in storage and preservation of fresh fruit products and lay a good foundation for development of new plant varieties.

Description

Fructus Vitis viniferae VvACS1 gene and application thereof

Technical field

The invention belongs to gene engineering technology field, be specifically related to a kind of Fructus Vitis viniferaeVvThe patent Shen of ACS1 gene and application thereof Please.

Background technology

Fructus Vitis viniferae (Vitis viniferaL.) it is second-biggest-in-the-world fruit tree crop, is widely used in wine brewing, eats raw, make Juice, system are dry.China's vinegrowing gross area 6,280,000 mu in 2014, Fructus Vitis viniferae total output 6,270,000 tons, cultivated area occupies the world the 4th, Wherein 70% eat raw.Grape pomace is thin, and fruit juice enriches, and sugar content is high, the serious shadow such as the rotting of storage transportation, stick, brown stain Ring product quality, storage length and shelf life.It is reported, China every year owing to gathering, packing, the technical reason such as storage causes Fructus Vitis viniferae rots to lose and accounts for more than the 20 ~ 30% of total output.Therefore the molecular regulation machine that during further investigation Grape During Storage, fringe stalk is old and feeble Reason, has important theory and practice meaning for extending the shelf life of Fructus Vitis viniferae with the storage quality improving fruit.

For a long time, grape maturity and preservation and freshness have been carried out widely studied by people, and result shows, grape fruit belongs to exhales Inhaling non-transition type, respiratory intensity is the most weak, and the respiratory intensity of carpopodium and cob is about 10 times of fruit grain, and occurs breathing height Peak, breathes for transition type.Further study show that, grape ear stalk weight only accounts for the 26% of grape fruit ear, but the water of loss in storage Point but account for the 49 ~ 66% of the whole fruit ear of Fructus Vitis viniferae, and Grape During Storage is wilted, brown stain and rotting first from the beginning of carpopodium, therefore, Portugal Grape fringe stalk is not only the physiologically active position of Fructus Vitis viniferae postharvest storage respiratory metabolism, is also the main portions of material consumption.Grind Study carefully and show, the keeping quality of Fructus Vitis viniferae and fruit brush and organizational structure, type of respiration and the fruit grain of fringe stalk, carpopodium, the hormone of cob The factor such as content and balance all has relation.Therefore, reduce the respiratory intensity after grape harvest, the breathing speed of suppression carpopodium and cob Rate, controls the synthesis of ethylene, postpones the arrival of respiratory climacteric, is to improve Grape During Storage quality and extend the root in Grape During Storage life-span This measure.

Ethylene is the endogenous hormones starting and promoting fruit and vegerable ripe and old and feeble, and its correlational study always is that post-harvest fruits grinds The focus studied carefully.For a long time, research worker to ethylene in the life of transition type fruit such as Fructus Lycopersici esculenti, Fructus Mali pumilae, Fructus Persicae, Fructus actinidiae chinensis, Fructus Musae etc. Long growing and in storage, effect has carried out substantial amounts of research, result shows, ethylene is to the ripening and senscence of transition type fruit the most extremely Close important effect.Owing to the non-transition type fruit ethylene as produced during the ripening and senscence of Fructus Vitis viniferae, Citrus, Fructus Fragariae Ananssae etc. is the lowest In transition type fruit, the effect that ethylene is considered to play at the ripening and senscence of non-transition type fruit all the time is very limited, makes Obtain ethylene to fail effectively to be carried out with the aging of non-transition type fruit and the research of storage quality change.But, in recent years grind Studying carefully result to show, some molecular regulation approach of non-transition type fruit and the aging of transition type fruit maturation is closely similar, Zhu Duoguo Real maturation process during fetal growth is also directly regulated and controled by ethylene.

ACS is the crucial rate-limiting enzyme of ethylene synthase, and ACS gene family is encoded by polygenes, and in Fructus Vitis viniferae genome extremely Rare 10VvACS gene and 3 ACO genes, therefore understand the spatial and temporal expression characteristic of VvACS gene family member, excavates fruit The gene of stalk and fruit specific expression is significant for the preservation and freshness of Fructus Vitis viniferae.

Summary of the invention

A kind of Fructus Vitis viniferae of offer is providedVvACS1 gene, by reticent or this gene of process LAN, thus Control the ripe opportunity of fruit, utilize the preservation and freshness of fruit.

Details are as follows for the technical solution used in the present invention.

A kind of Fructus Vitis viniferaeVvACS1 gene, this gene can clone from Thomson currant and obtain, and this gene comprises 1518 Individual base, sequence is as shown in SEQ ID NO.1.

DescribedVvThe application in cultivating new variety of plant of the ACS1 gene, this gene is in the carpopodium of Thomson currant Specifically expressing, has significant correlation with the acetate releasing quantity of carpopodium；After this gene-transformed plant body overexpression, can affect The maturation time of fruit.For theory, overexpression Fructus Vitis viniferaeVvAfter ACS1 gene, the release of ethylene can be promoted, promote fruit Maturation, but it is limited to the complexity of fruit maturation regulatory mechanism, it is also possible to there is different effects, such as, this gene is turned After changing Fructus Lycopersici esculenti overexpression, the maturation time of Fructus Lycopersici esculenti can be postponed.

Inventor is deep at the relevant ACS gene of Ruby seedless grape that is seedless to the Thomson of easy shattering and that be difficult to shattering Enter on Research foundation, it is believed that specifically expressing in the seedless carpopodium of ThomsonVvACS1 gene and acetate releasing quantity height correlation, profit Use this characteristic, can preferably be controlled the ripe opportunity of fruit by transgenic technology.After this gene transformation Fructus Lycopersici esculenti overexpression, Owing to there is post-transcriptional control, actual experiment result shows, the maturation time of transgenic Fructus Lycopersici esculenti has obtained a certain degree of delay. Thus, this gene developed application further, the preservation and freshness for fresh fruit food has preferable practical value, the most also Good basis has been established for new variety of plant exploitation.

Accompanying drawing explanation

Fig. 1 is that different times Thomson currant carpopodium (rachis) Ethylene Production Rate measures figure；

Fig. 2 is that different times Ruby seedless grape carpopodium (rachis) Ethylene Production Rate measures figure；

Fig. 3 is that different times Thomson currant fruit (berry) Ethylene Production Rate measures figure；

Fig. 4 is that different times Ruby seedless grape fruit (berry) Ethylene Production Rate measures figure；

Fig. 5 is that different times Thomson currant carpopodium (rachis) Ethylene Production Rate when AVG processes measures figure；

Fig. 6 is ACS gene expression in Thomson currant different tissues organ；

Fig. 7 is ACS gene expression in Ruby seedless grape different tissues organ；

Fig. 8 is the part ACS gene (ACS1, ACS3, ACS4, ACS7, ACS8) expression feelings in Thomson currant carpopodium Condition；

Fig. 9 is the part ACS gene (ACS2, ACS5, ACS6, ACS9) expression in Thomson currant carpopodium；

Figure 10 is that part ACS gene (ACS1, ACS3, ACS4, ACS5, ACS7, ACS9) is in Thomson currant fruit Expression；

Figure 11 is the part ACS gene (ACS2, ACS6, ACS8) expression in Thomson currant fruit；

Figure 12 is the part ACS gene (ACS1, ACS4, ACS7, ACS8, ACS9) expression feelings in Ruby seedless grape carpopodium Condition；

Figure 13 is the part ACS gene (ACS2, ACS3, ACS5, ACS6) expression in Ruby seedless grape carpopodium；

Figure 14 is the part ACS gene (ACS1, ACS4, ACS5, ACS6, ACS7) expression feelings in Ruby seedless grape fruit Condition；

Figure 15 is the part ACS gene (ACS2, ACS3, ACS8, ACS9) expression in Ruby seedless grape fruit；

Figure 16 be in Thomson currant carpopodium part ACS gene (ACS1, ACS6, ACS8) storage period and to ethephon at The response expression of reason；

Figure 17 be in Thomson currant carpopodium part ACS gene (ACS2, ACS4, ACS5) storage period and to ethephon at The response expression of reason；

Figure 18 be in Thomson currant carpopodium part ACS gene (ACS3, ACS7, ACS9) storage period and to ethephon at The response expression of reason；

Figure 19 be in Ruby seedless grape carpopodium part ACS gene (ACS1, ACS3, ACS6) storage period and to ethephon at The response expression of reason；

Figure 20 be in Ruby seedless grape carpopodium part ACS gene (ACS2, ACS5, ACS8) storage period and to ethephon at The response expression of reason；

Figure 21 be in Ruby seedless grape carpopodium part ACS gene (ACS4, ACS7, ACS9) storage period and to ethephon at The response expression of reason；

Figure 22 be Thomson currant carpopodium Ethylene Production Rate withVvACS1 gene expression amount correlation analysis；

Figure 23 isVvACS1 gene expression in Fructus Lycopersici esculenti different tissues position, wherein 6-6,6-8,6-9 are for turningVvACS1 Gene strain, NT is non-transgenic reference strain；

Figure 24 is Fructus Lycopersici esculenti different tissues position ACS enzymatic activity situation；

Figure 25 is tamato fruit ACS enzymatic activity situation；

Figure 26 is different times Fructus Lycopersici esculenti fruit stem ACS enzymatic activity situation；

Figure 27 is different tissues position Ethylene Production Rate situation；

Figure 28 is different times fruit Ethylene Production Rate situation；

Figure 29 is different times Fructus Lycopersici esculenti fruit stem Ethylene Production Rate situation；

In Fig. 1 ~ 5, " CK " is comparison；" ETH " is that ethephon processes (adopting first three sky to process)；" DAFB " is Post flowering natural law； " DAH " is postharvest storage natural law；" H " is harvest date；It addition, after the spending 49 days annesl period of maturation of Thomson currant, After the spending 81 days annesl period of maturation of Ruby seedless grape；

In Fig. 6 ~ 7, in the relative expression analysis of ACS gene, other experimental grouies are done normalization for " 1 " by the value with terminal bud；

In Figure 16 ~ 21, for the experimental data of ACS gene two tissue samples of relative expression's component analysis all to gather time (0 day) Sample data do normalized for " 1 ", wherein " CK " represents the matched group not processed, and " ETH " represents ethephon and process Group (adopts first three sky to process)；

It is to be understood that the mark that when mark such as a, b, c, d, e, f, g, h is data statistics processing in figure, software automatically generates Know.

Detailed description of the invention

Below in conjunction with embodiment, the present invention is further explained explanation, before introducing specific embodiment, in the present invention Involved partial material situation is briefly discussed below.

Experiment material:

Thomson thompson seedless grape (Vitis Vinifera L. cvs.Thompson seedless) and the seedless Portugal of ruby Grape (Vitis Vinifera L. cvs. Ruby Seedless), sample is taken from state of Zhengzhou fruit tree institute of the Chinese Academy of Agricultural Sciences The adult grapevine seedling that family grape resource garden preserves；

Wherein fruit and the fruit stem material of Thomson thompson seedless grape is spending (DAFB) within 21,35,49,57,64,71 days, to take afterwards respectively Sample, the Fructus Vitis viniferae material used by postharvest handling picks up from the period of maturation (71 DAFB)；Fruit and the fruit stem material of Ruby seedless grape divide Not spending (DAFB) sampling in 35,49,57,64,81,91,102 days afterwards, the Fructus Vitis viniferae material used by postharvest handling picks up from the period of maturation (102 DAFB)；

Blade (bud top down the 3rd to 8 leaf), fruit stem, petiole, terminal bud, stem section (from terminal bud first to the 3rd section), tendril etc. Different tissues position sample picks up from the period of maturation of two grape varieties respectively；

Put into the most rapidly quick-freezing in liquid nitrogen after all samples is in vitro, be saved in for a long time in-80 DEG C of ultra-low temperature surroundings with back-up Analysis uses.

Main agents:

Ethephon (Ethephon), Sigma company；

AVG(aminoethoxyvinylglycine), Valent Biosciences Corporation Libertyville, USA；

10 ppm ethylene gases, intelligent outstanding analysis Science and Technology Ltd. of BeiJing ZhongKe；

Reverse Transcription box FastQuant RT Kit (with gDNase I), Beijing Tian Gen company；

Fluorescence quantitative kit SYBR Select Master Mix (Applied Biosystems), USA；

Other common agents are domestic or Import Analysis is pure, the most excessively repeated description；

It is further to note that other reagent used and application thereof in experimentation, such as: 0.1 mol/L phosphate buffer (contains 4 mmol/L DTT, 10 mol/L pyridoxal 5-phosphates, 10 mmol/L EDTA), 0.5M EDTA(pH 8.0), 5 M NaCl, 3M NaAC(Ph5.2), 10 M LiCl, 1M boric acid, 5M KAC(pH4.8), 1M Tris-alkali, 0.5M Na₂EDTA(pH8.0), CTAB buffer, Washing buffer, 50 × TAE buffer etc. are prepared by this area routine techniques, retouch the most in detail State.

Key instrument has: DYY-6C type horizontal cataphoresis apparatus, SYNGENE G-Box EF2 type gel imaging system, ABI Veriti grads PCR instrument, ABI7500fast real-time fluorescence quantitative PCR instrument, Waters e2695 high performance liquid chromatograph, C18 are anti- Phase chromatographic column, Shimadzu GC-2010Plus gas chromatograph, GDX-502 type chromatography column (Lan Huasuo) etc., be this area normal With equipment, the most too much describe.

Predominantly detect analysis method to include:

Use gas chromatography (GC method) to measure and analyze Ethylene Production Rate, particularly as follows:

At fruit development different times, after taking off fruit and fruit stem from fruit ear, it is sealed in the airtight sample of 65 mL and 25 mL respectively In product bottle, 20 DEG C after airtight 3 hours, are extracted 1000 μ L gas sampling analyses in sample bottle；During gas chromatographic analysis, detection Device is hydrogen flame detector, and chromatographic column is GDX-502 type chromatography column, injector temperature 110 DEG C, column temperature 60 DEG C, detector Temperature is 150 DEG C, and carrier gas is nitrogen；It is to be understood that every part to measure sample be to be cut by the close fruit ear of 3 ~ 5 fringe Maturity The aggregate sample taken, each process is repeated 3 times；

Fructus Vitis viniferae geneome RNA extracts CTAB method (the Gambino G, et.al., A Rapid and effective taking improvement method for RNA extraction from different tissues of grapevine and other woody Plants, Phytochemical Analysis, 2008,19:520 ~ 525), the concentration of the Fructus Vitis viniferae geneome RNA extracted is adopted By UV spectrophotometer measuring, result shows, the A 260/280 of extracted RNA sample is worth all between 1.8 ~ 2.0, A 260/230 more than 2.0；The integrity of extracted RNA uses the agarose gel electrophoresis of 1.5 % to detect；

Prepared by cDNA: to specifications, and extracted Fructus Vitis viniferae geneome RNA is used Reverse Transcription box FastQuant RT Kit (with gDNase I) carries out synthetically prepared；

Real-time fluorescence quantitative PCR reacts: with prepared cDNA as template, uses 9 ACS genes, three reference genes respectively Special primer carry out PCR amplification；Primer sequence uses Primer Express version 3.0 to design, public by the raw work in Shanghai Department's synthesis provides, and concrete primer sequence is as follows:

。

Quantitative fluorescent PCR reaction uses 20 uL systems, and specific design is as follows:

。

Quantitative fluorescent PCR response procedures is: 95 DEG C, 2 min, degeneration；95 DEG C, 3 sec, annealing/extend；60℃、30 Sec, 40 circulations；

During it is further to note that subsequent data analysis processes, analyzing fruit and fruit stem different developmental phases sample ACS base As " 1 ", sample in other is done normalized Analysis using harvest time fruit and fruit stem data in period during the relative expression quantity of cause； Using terminal bud data as " 1 " other samples are done when analyzing the relative expression quantity of different tissues position sample ACS gene and return One fractional analysis.

Embodiment 1

This example mainly to developmental stages of grape berry different times and the acetate releasing quantity of post-harvest fruits carpopodium, ACS gene at Fructus Vitis viniferae Expression analysis, ethephon in histoorgan process adopting impact, Tom that rear ACS gene is expressed in grape fruit and carpopodium Inferior currant carpopodium VvACS1 gene expression amount and Ethylene Production Rate dependency, fruit development phase ACS gene are in Portugal The situations such as the expression in grape fruit and carpopodium are described, before being further described particular content, to ethylene in the present embodiment Profit (ETH) and ammonia oxygen ethyl vinyl glycine (AVG) process sample mode are briefly introduced and are described as follows:

Ethephon process, 100 mg/L AVG and solvent control that grape fruit ear sprays before gathering 400 mg/L respectively (are steamed Distilled water) process, each process chooses that 12 fringe Maturity are close, grape fruit ear without big granule.After gathering, fruit ear is housed in temperature It is the seal storage indoor of 15 DEG C and relative humidity 85 ~ 90%；Within storage period, the fruit analyzed for ethylene analysis and RNA Being sampling in every 2 days once with carpopodium sample, each process is chosen 9 fringes and is reused process sample as three times.

Each several part particular content is described below.

Developmental stages of grape berry different times and the acetate releasing quantity of post-harvest fruits carpopodium

And Ruby seedless grape fruit carpopodium seedless to Thomson is at the different times of growth promoter and the ethylene evolution after adopting Speed is measured and record, and result is as shown in Fig. 1 ~ 5.

Under natural conditions (i.e. CK group in Fig. 1 ~ 4), at the growth and development stage of fruit, Thomson currant fruit carpopodium Ethylene evolution have overall rising trend, and the burst size of (71 DAFB) ethylene steeply rises when maturation is gathered.And red treasured The carpopodium of stone currant 49 DAFB before gathering and 81 DAFB have two faint ethylene peak values two periods.To fruit Middle ethylene evolution measurement result shows, along with the growth of fruit, acetate releasing quantity presents downward trend generally, and is spending After the 35th day (35 DAFB) peak of acetate releasing quantity occurs.In general, no matter Thomson is seedless or ruby without Core, acetate releasing quantity (1 ~ 4.5 L kg of carpopodium^-1 h^-1) all than fruit acetate releasing quantity (0.02 ~ 1 L kg^-1 h^-1) want High.

When specifically comparing the two grape variety, the acetate releasing quantity in Thomson currant fruit carpopodium is wanted generally Slightly higher than Ruby seedless grape carpopodium.Such as, the 35th day (35 DAFB) after spending, Thomson is seedless and ruby without The Ethylene Production Rate of core grape fruit is respectively 1.0 and 0.4 L kg^-1 h^-1, the 71st day (71 DAFB) after spending, really In stalk, Ethylene Production Rate is respectively 4.3 and 2.2 L kg^-1 h^-1.When gathering, fruit releases a small amount of ethylene, and one Directly last till and adopt latter 10 ~ 15 days；And the acetate releasing quantity adopting rear Thomson currant carpopodium persistently reduces, after gathering before Six days, the acetate releasing quantity of Ruby seedless grape carpopodium was risen to 1.5 L kg by 0.75^-1 h^-1, then from adopting the rear 7th It begins to decline.

Ethephon result shows (in Fig. 1 ~ 4, ETH group, adopts process in first 3 days), and Thomson is seedless and the seedless Portugal of ruby Acetate releasing quantity in the fruit of two kinds of grape does not changes significantly, and the acetate releasing quantity in carpopodium the most substantially rises.

After Thomson currant carpopodium uses ethylene inhibitor (AVG) process further, to its at fruit development and The acetate releasing quantity of storage phase is measured, and result is as it is shown in figure 5, there it can be seen that the acetate releasing quantity of carpopodium very great Cheng The induction and the AVG process that are processed by ethephon on degree are suppressed.

ACS gene expression in grapes tissue organ

According to Real-Time Fluorescent Quantitative PCR Technique, inventor's expression to 9 ACS family genes in each histoorgan of Fructus Vitis viniferae Situation is detected, and concrete outcome is as shown in Fig. 6 ~ 7, and result shows, Fructus Vitis viniferae ACS(VvACS) gene Thomson seedless and Expression in Ruby seedless grape has larger difference, as follows:

In Thomson currant (Fig. 6),VvThe expression of ACS1 is the highest in carpopodium, and than it at terminal bud and blade In expression high 35 times.VvACS2-4 andVvThe transcriptional level of ACS6-9 gene is higher in blade, at grape fruit and carpopodium In relatively low or do not detect.VvThe expression of ACS5 gene is the highest in terminal bud and petiole, minimum in carpopodium；

In Ruby seedless grape (Fig. 7),VvACS4 andVvACS7-9 gene expression in tender stem segments is high, but Expression in fruit and carpopodium is low.VvThe transcriptional expression level of ACS5 gene is higher in terminal bud, tender stem segments and fruit, but Expression in carpopodium is at a fairly low.VvACS3 gene expression in carpopodium is the highest, is 10 times in its fruit.VvACS1 andVvACS6 gene expression in blade is the highest.

Fruit development phase different Fructus Vitis viniferae ACS gene (VvACSGene) expression feelings in grape fruit and carpopodium Condition

According to Real-Time Fluorescent Quantitative PCR Technique, to different in grape fruit and carpopodiumVvACSThe expression of gene is examined Surveying, result is as shown in Fig. 8 ~ 15, and result shows, the expression of these family genes is very different, as follows:

From Fig. 8, Fig. 9 it can be seen that in the carpopodium of Thomson currant,VvACS2、VvACS5、VvACS6、VvACS8、VvThe 57th day (57 DAFB), the 21st day (21 DAFB) after spending are relatively low for the expression peak of ACS9 gene, and when gathering Expression value is minimum；VvACS1 andVvACS3 gene in carpopodium express peak value consistent with its acetate releasing quantity, and this two The high expressed of individual gene measures when gathering now；

From Figure 10, Figure 11 it can be seen that in Thomson currant fruit,VvACS1、VvACS2、VvACS4、VvACS6、VvThe expression of ACS8 gene the 21st day (21 DAFB) after spending is the highest, and after spending, the 35th day (35 DAFB) slightly reduces, The most always with relatively low persistent levels to fruit maturation, this is more similar with the change of the burst size of ethylene；VvACS5、VvACS7、VvThe high expression level of ACS 9 records when gathering；

From Figure 12, Figure 13 it can be seen that in Ruby seedless grape carpopodium,VvACS1 andVvThe the highest of ACS6 gene is transcribed Thing accumulating level is the 35th day (35 DAFB) and 49 days (49 DAFB) after spending, its floor level after spending the 81st day (81 DAFB)；VvACS2 andVvThe highest transcript accumulating level of ACS5 gene the 91st day (91 DAFB) after spending, fruit other Stage of development expression is relatively low；VvThe expression of ACS3 gene is from spending rear 35th day (35 DAFB) to spending latter 57th day (57 DAFB) reduces step by step, has small size rising when gathering；VvACS4、VvACS 7、VvThe expression peak value of ACS 8 gene The 49th day (49 DAFB) after spending；In the whole period of development of Ruby seedless grape fruit,VvACS9 gene is in carpopodium Expression has almost no change；

From Figure 14, Figure 15 it can be seen that in Ruby seedless grape fruit,VvACS2 andVvThe expression of ACS6 gene Consistent with the generation amount of ethylene, simultaneously after spending, the 35th day (35 DAFB) and 81 days (81 DAFB) reaches peak value, and its The whole developmental stage of fruit all presents overall downward trend；VvACS3、VvACS7、VvACS 8、VvTurning of ACS 9 gene Record thing accumulation top level the 64th day (64 DAFB) after spending；VvACS4 andVvThe high expression level of ACS5 gene is being gathered Time be detected, just its gene expression dose minimum after spending after the 81st day (81 DAFB).

Ethephon processes the impact expressed post-harvest grapes ACS gene in grape fruit and carpopodium

According to Real-Time Fluorescent Quantitative PCR Technique, after processing ethephon, in Grape stems, the expression of different ACS genes is carried out Detection, result, as shown in Figure 16 ~ 21, is specifically described as follows.

As shown in Figure 16 ~ 18, in Thomson currant carpopodium,VvThe expression of ACS1 gene is in the postharvest storage phase In overall downward trend, this trend is almost the most consistent with the burst size of ethylene in carpopodium；VvACS2、VvACS4、VvACS6、VvThe expression of ACS 7 gene the 3rd day (3 DAH) after adopting rises, subsequently in whole storage period the most generally in now The trend of fall；VvACS5 andVvThe expression peak value of ACS9 gene occurs in the 6th day (6 DAH) after adopting；Test is processed at ethephon In, ethephon process groupVvACS1、VvACS2、VvACS5、VvACS6 gene the postharvest storage phase expression except After adopting, the 4th day (4 DAH) is all to lower to express；VvACS3、VvACS7、VvACS8、VvACS 9 gene the postharvest storage phase except After adopting, the 6th day (6 DAH) is also to lower to express；Generally speaking, under after ethephon processes, the expression in carpopodium of the ACS gene is Adjust.

As shown in Figure 19 ~ 21, in Ruby seedless grape carpopodiumVvACS1 gene andVvThe expression of ACS6 gene except After adopting, the 5th day (5 DAH) drops suddenly to outside low spot, the least in the change of its expression of postharvest storage phase；It addition,VvACS2 Gene after adopting the 3rd day (3 DAH) and after adopting the 9th day (9 DAH) have twice peak expression respectively；AndVvACS3 ~ 5 HeVvACS7 The expression of ~ 9 genes presents downward trend within the whole postharvest storage phase generally；In ethephon processes,VvACS base Lowering, because the expression in Ruby seedless grape carpopodium has up-regulated expression also to have, the mode expressed, result shows that it is released with ethylene The most not there is relation one to one.

Thomson currant carpopodiumVvACS1 gene expression amount and Ethylene Production Rate dependency

In sum, Thomson currant carpopodium is adopted front 6 periods and adopts the Ethylene Production Rate in rear 5 periods by inventor WithVvThe dependency of ACS1 gene expression amount calculates and analyzes, and result is as shown in figure 22.Result of calculation shows, Thomson without Core Grape stemsVvACS1 gene expression amount is notable with Ethylene Production Rate dependency, and its correlation coefficient r is 0.796*, 0.01 ＜ P=0.015 ＜ 0.05.

Conclusion

The acetate releasing quantity that summary obstructs for grape fruit and fringe, and 9VvThe spatial and temporal expression of ACS gene family member Result of study, can obtain as drawn a conclusion:

1, during developmental stages of grape berry, the peak of fruit grain (fruit) ethylene evolution occurs in initial stage and the annesl of fruit development Phase, acetate releasing quantity is relatively low, about 0.02 ~ 1 L kg^-1 h^-1；And the seedless carpopodium of Thomson ethylene evolution at fruit There is obvious jump phenomenon time ripe, and acetate releasing quantity is higher, is 1 ~ 4.5 L kg^-1 h^-1；Ethephon processes and can significantly improve The release of ethylene in carpopodium, AVG process inhibits the acetate releasing quantity of carpopodium, and ethephon processes the shadow to fruit ethylene evolution Ring inconspicuous；

2,9VvACS gene space-time tissue expression result in Fructus Vitis viniferae genome shows, Thomson is seedlessVvACS1 gene Expression there is carpopodium organizing specific expression, it is high more than 30 times during in the seedless carpopodium of Thomson, relative expression quantity is than stem apex, And remaining all ACS relative expression quantity in carpopodium is the most relatively low；

3, in Thomson seedless fruit growth course and after fruit harvesting,VvACS1 gene real time fluorescent quantitative table in carpopodium Reach analysis result to show,VvACS1 gene in grape fruit growth and development process and postharvest storage during, the height of its expression Low have significant correlation with carpopodium acetate releasing quantity, and the expression of other genes does not have relevant to the release of carpopodium ethylene Property, this tentatively indicatesVvACS1 gene is the key gene of the ethylene evolution of regulation and control carpopodium, in the ripening and senscence process of carpopodium In play an important role.

Further, rightVvACS1 gene sequencing result shows, this gene includes that this gene comprises 1518 bases, sequence As shown in SEQ ID NO.1, it may be assumed that

ATGAGAGTGATAGTTCCTTTACAAGGGGTGGTTCAGGGAAGAGGGGGACTTGTGTTGGGTTCAGTAATTCCCT GCGCTCTCTTTTACCTCTTGCAGCTCTACTTCAAACGACATCGTTCCGAGCCCACGCCCCCGCCCCAGAAGCTGACG GAGGTCTCTGAGTTAAACAGGTCCCTGTCTCGGACCCATCTGCCTGCAAGGGGTTCGAGCGCGCCGGCTTGTGTGTC AACGCGGGCAAATTCGATTGTGAAGTCCAGTGATTCGCCTTTCTATGTTGGGCTGAAGAGGGTTTCAGAGGATCCCT ATGATGAATTGAGTAATCCAGAGGGGGTTATTCAGCTTGGTTTGGCTGAAAACAAGTTGTCATTGGACTTGGCTCGA GACTGGCTTGCAGAGAATGCAAAGGATTGGATATTGAGTGGAGGTGGAAGTAGTGGGCCATTGAGTATGGGCGGGAT TGCAAATTATCAGGCGTCAGATGGATTAGTGGAGTTGAAAGTGGCTGTGGCAGGATTCATGTCTCAAGTCATGGAAC GATCAATATCCTTTAACCCATCACAGATAGTCTTAACAGCTGGTGCAGCCCCTGCAATTGAGATCCTCAGTTTCTGC CTAGCAGATACTGGAAATGCATTTCTTGTTCCCACACCATACTATCCCAGTTTTGATAGGGATTTAAAATGGAGAAC TGGGGTGGAGATAATTCCTGTTCCCTGTCGCAGTGCTGACAATTTCAATCTAAGTATAAGTGCTCTTGACTTAGCAT TCGACCAGGGAAAGAAACGTGGTTTAAAAGTTCGTGGGATTGTAATTTCCAACCCCTCAAATCCTGTTGGCAATCTG CTTAATCGAGAAACAATTTACAGCCTTGTAGACTTTGCTCGAGAGAAGAACATCCATATAATTTCAAATGAAATATT TGCTGGGTCCACTCATGGAAGCGAAGAGTTTGTGAGCATGGCTGAAATTATTGATTCGGAAGACTTGGACAGGGACA GAGTTCACATAGTGTATGGGCTGTCAAAAGACCTCTGTCTTCCACGTTTTAAAGTGGGGGTTATATATTCGTCTAAT GAAAATGTTCTGGCTGCTGCTAAGAAACTCTCAAGGTTTTCTTCCATTTCAGCTCCAACCCAGTGTTTGGTTATCTC CATGCTTTCAGATATAAGATTCATACAAAAGTTCATTCAGACCAACAGAGAGAGGCTTCAAAGAATGTATACTAAAT TCGTGGCAGGGTTGAAACAATTAGGAATTGAGTGCATGCGGAGCAGTGGGGGCTTCTACTGTTGGGCTGACATGAGG GGATTAATCCGCTCTTACAGTGAGAAAGGGGAGCTCGAGCTATGGAACAAATTGTTGAATATAGCAAAGATAAATGT AACTCCAGGATCTTCTTGTCACTGTATTGAACCTGGATGGTTCCGCTGTTGTTTTACTACATTRACTGAAAAGGATA TTCCTGTAGTGATGGAACGAATTCGGAAAGTTTCTGAAACCTGTATATCCCCCAGATGA。

Embodiment 2

Based in embodiment 1 forVvThe understanding of ACS1 gene importance, inventor is prepared forVvThe transgenic kind of ACS1 gene Eggplant strain, concrete preparation process brief introduction is as follows.

One, carrier construction

First amplification is designedVvThe primer sequence of ACS1 gene is as follows:

VvACS1F:5 '-CACCATGAGAGTGATAGTTCCTTTAC-3 ',

VvACS1R:5 '-TCATCTGGGGGATATACAG-3 '；

With the cDNA sequence of Thomson currant genome as template, carry out the amplification of sequence；

After the integrity carrying out sequence verification extension increasing sequence, the method for Gateway is utilized (i.e. to be expanded by genes of interestVvACS1 gene order) it is building up in the Overexpression vector (PCAMBIA 1304) with 35S as promoter, and convert Agrobacterium LAB4404 bacterial strain saves backup；

Two, outer implant is prepared

Take tomato seeds (kind is Moneymaker, a commercial variety, can openly obtain) on superclean bench, with 100mL, Soak 30 s, 100mL in 75% ethanol, 10% sodium hypochlorite soaks seed 20 min, and period constantly shakes to carry out thorough disinfection Sterilizing；

With seed after sterile distilled water washing and sterilizing 3 ~ 5 times (each 3 min), then by planting seed in 1/2 MS culture medium On；

Culture bottle is placed in constant incubator (25 DEG C, dark) and cultivates 3 days, then 25 DEG C, cultivate 4 ~ 5 under 16 h photoperiods My god, launch to cotyledon；

Three, agrobacterium mediation converted

The Agrobacterium LAB4404 bacterial strain containing genes of interest prepared in step one is rule on YEB solid medium, It is inverted light culture 1 ~ 2d；

Picking list colony inoculation is in adding 50 mg/L SPEC(spectinomycin hydrochlorides) YEB fluid medium in, 28 DEG C, 180 rpm/min shaken cultivation 15 about h (i.e. cultivating to exponential phase)；

Then on superclean bench, bacterium solution is transferred in sterile centrifugation tube, 4 DEG C, 4000 rpm/min be centrifuged 10 min, abandon Supernatant, collects thalline；

Resuspended with MS liquid minimal medium (MS liquid), it is diluted to debita spissitudo (OD600 is 0.3-0.5) and carries out cotyledon and invade Dye；Putting in re-suspension liquid by the preculture Fructus Lycopersici esculenti cotyledon of 2 days, at the uniform velocity shake is infected for 3-5 minute, then inhales with aseptic filter paper Remove Agrobacterium culture fluid unnecessary in cotyledon fragment, then cotyledon fragment is put back in MS culture medium, in constant incubator, 25 DEG C, cultivate 2 days under dark condition；

Four, the screening of resistant calli

After step 3 infecting rear Cotyledon culture 2 days, in the sterilized water containing 200 mg/L cefradines, rinse 10 min, Use rinsed with sterile water 3 times again；

Suck surplus liquid in cotyledon fragment with aseptic filter paper, cotyledon fragment is transferred to MS+2.0 mg/L ZT+200 (Kan: kalamycin, ZT: Semen Maydis in mg/L cefradine+50 mg/L Kan+30 g/L sucrose solids culture medium Element), 25 DEG C, under 16 h photoperiods, every ten days subcultures once, until there being regeneration bud to occur；

Regeneration bud is transferred to MS+ZT 1.0 mg/L+ 200 mg/L cefradine+50 mg/L Kan+ 30 g/L sugarcane Sugar cultured on solid medium.

Five, the taking root of resistant buds

Treat that regeneration bud that step 4 cultivated is at MS+ZT 1.0 mg/L+ 200 mg/L cefradine+50 mg/L Kan When growing to 2 cm height in+30 g/L sucrose solids culture medium, cut and transferred to MS+IBA 1.0 mg/L+ 200 The root media of mg/L cefradine+50 mg/L Kan+30 g/L sucrose carries out root culture；About one week Just can take root.

Through the Fructus Lycopersici esculenti strain turning VvACS1 gene that PCR and RT-PCR identifies, the most numbered 6-6,6-8,6-9 are as entering One step experiment material, arranges non-transgenic Fructus Lycopersici esculenti " Moneymaker " as comparison simultaneously；

Related experiment material accelerating germination in January, nursery, be colonizated in heliogreenhouse and terminate trophophase to July March；

Every ridge field planting two row Fructus Lycopersici esculenti, often about 15 tomato plants of row field planting in heliogreenhouse；Comparison and transfer-gen plant all enter The conventional consistent management of row.

Field planting starts after two weeks to sample once every two weeks, measures and records data and mainly include the plant height of tomato seedling system, stem Slightly, the morphological index such as panel length, ACS enzymatic activity,VvACS1 expression conditions, the content such as tomato-ethylene burst size is relevant Method in method described in experimental implementation reference example 1 or prior art, is not repeated.

VvACS1 gene expression in transgenic Fructus Lycopersici esculenti different tissues position

To different tissues position in transgenic Fructus Lycopersici esculentiVvACS1 expression conditions is measured, and result is as shown in figure 23.Knot Fruit shows, in three transgenic Fructus Lycopersici esculenti strains, all have in blade, flower, rachis, fruit, fruit stemVvThe mistake of ACS1 gene Scale reaches, rather than without expressing in transgenic Fructus Lycopersici esculenti comparison.Wherein, flower, rachis, fruit stem have higherVvACS1 gene Relative expression quantity；And in flowerVvWhat the relative expression quantity of ACS1 gene was the highest is two transgenic lines of 6-6,6-8；Inflorescence In axleVvWhat the relative expression quantity of ACS1 gene was higher is 6-9 strain.In the blade of three transgenic line Fructus Lycopersici esculenties, fruitVvACS1 gene has expression, but its relative expression quantity is in reduced levels.

VvThe impact on Fructus Lycopersici esculenti ACC synzyme (ACS) activity of the overexpression of ACS1 gene

The ACS enzyme at two transgenic lines (6-8,6-9) and non-transgenic strain (NT) tomato plant different tissues position is lived Property is determined, and result is as shown in figure 24.Result shows, in transgenic line, and the ACS activity ratio couple of rachis and flower Low according to strain, and significant difference；And in transgenic line tomato leaf, ACS activity ratio matched group is up, but difference The most notable.And compare different tissues position and find, in flower, fruit stem and rachis, the activity of ACS enzyme is than other tissue sites High.

To the 57th day (57 DAFB) after spending namely gather the same day (0 DAH) transgenic and non-transgenic tamato fruit ACS enzyme activity level is measured, and as shown in figure 25, result shows result, and the ACS enzymatic activity of three transgenic line fruits is equal Lower than matched group, and significant difference.

Analyzing ACS enzymatic activity in transgenic and non-transgenic Fructus Lycopersici esculenti strain fruit stem further, result is as shown in figure 26.Turn Gene strain presents similar variation tendency with the ACS enzymatic activity of non-transgenic strain Fructus Lycopersici esculenti fruit stem, after adopting the 21st day (21 DAH) reach peak to gradually reduce subsequently, and ACS enzymatic activity numerical value 21 DAH after adopting of two transgenic lines of 6-6,6-8 Apparently higher than non-transgenic reference group.During fruit and fruit stem Enzyme activities, the enzymatic activity of three transgenic lines is equal There is the result higher than non-transgenic reference group in various degree.Analyze and find, in whole period, turnVvACS1 transgenic tomato 6-6, In the fruit stem of two strains of 6-8, ACS enzymatic activity is above the enzyme activity level of non-transgenic reference Fructus Lycopersici esculenti, this withVvACS1 gene Expression of results in fruit stem is consistent, explanationVvACS1 gene overexpression in Fructus Lycopersici esculenti fruit stem may promote its ACS enzyme The rising of activity.

VvThe impact on Fructus Lycopersici esculenti different tissues position acetate releasing quantity of the overexpression of ACS1 gene

Entering reproductive growth after date Fructus Lycopersici esculenti, contemporaneity gathers transgenic and the different tissues of non-transgenic strain Fructus Lycopersici esculenti respectively Position sample, measures its Ethylene Production Rate, and result is as shown in figure 27.Relatively transgenic and each organization department of non-transgenic strain Position Ethylene Production Rate is it is found that the Ethylene Production Rate of transgenic line tomato leaf is than the ethylene of non-transgenic reference group Rate of release is low, and difference is the most notable.Ethylene Production Rate in transgenic line Fructus Lycopersici esculenti flower is than non-transgenic reference group Ethylene Production Rate is high, and significant difference.And compare rachis Ethylene Production Rate and find, the ethylene evolution of transgenic rachis Speed is higher than non-transgenic reference.

VvThe impact on tamato fruit fruit stem acetate releasing quantity of the ACS1 gene overexpression

In Development of Tomato Fruits phase and postharvest storage phase, to transgenic and the ethylene evolution of non-transgenic strain tamato fruit Speed is measured, and result is as shown in figure 28.(35 DAFB) is broken the color phase front, transgenic and non-transgenic strain Fructus Lycopersici esculenti at fruit The Ethylene Production Rate trend of fruit is basically identical, and is being in a relatively low level (0.068 ~ 1.018 L kg together^-1 h^-1), and be not significantly different from；Annesl maturation speed at non-transgenic (NT) tamato fruit afterwards of broken color phase (35 DAFB) is obvious the most relatively Hurry up, and the Ethylene Production Rate of non-transgenic (NT) tamato fruit 50 days (50 DAFB) after spending takes the lead in reaching peak, three The tamato fruit Ethylene Production Rate peak value of transgenic line respectively appears in be spent latter 57 days (57 DAFB) and adopts latter 7th day (7 DAH) and thereafter gradually reducing, this explanation turnsVvACS1 gene has delayed the maturation of tamato fruit.

Being measured the Ethylene Production Rate of transgenic and non-transgenic strain Fructus Lycopersici esculenti fruit stem, result is as shown in figure 29. It can be seen that the fruit Ethylene Production Rate trend of transgenic line and non-transgenic (NT) strain is basically identical, all same Individual relatively low value fluctuates (5 L kg^-1 h^-1), and without significant difference.Ethylene evolution transition peak is not all had to go out before gathering Existing, after gathering the 7th day, the fruit stem Ethylene Production Rate of four strain Fructus Lycopersici esculenties all reached peak (30 ~ 45 L kg^-1 h^-1), There is obvious transition compared with former and later two time points, and the fruit stem Ethylene Production Rate of transgenic line is substantially than nontransgenic plants Low.The Ethylene Production Rate of four strain Fructus Lycopersici esculenti fruit stems all gradually reduces until anaphase storage subsequently.

Conclusion

On the basis of embodiment 1, inventor thinksVvACS1 gene is specifically expressing in Thomson currant carpopodium tissue, And the Ethylene Production Rate of the height of its expression and carpopodium has significant correlation.In order to verifyVvThe expression of ACS1 gene is adjusted Control characteristic and gene function thereof, we are to turnVvMaking further research based on ACS1 transgenic tomato material, result shows:

1, turningVvIn the tomato plant of ACS1 gene, the different tissues such as the blade of Fructus Lycopersici esculenti, flower and rachis, fruit and fruit stem The spatial and temporal expression result at position shows, genes of interest is high expressed in flower, fruit stem, significantly becomes at blade and middle expression Change；

2、VvACS1 gene is in tomato dna group after overexpression, and the ACS enzymatic activity in Transgenic tomato fruit and flower is subject to To suppression in various degree, wherein in flower, the activity of ACS enzyme is substantially less than matched group, and the ethylene in transgenic Fructus Lycopersici esculenti flower is released Put and be substantially suppressed, and significant difference；And the activity of ACS enzyme is apparently higher than matched group in transgenic Fructus Lycopersici esculenti fruit stem；

3, for theory, overexpressionVvACS1 gene can promote the maturation of fruit, it should makes the period of maturation of fruit in advance, but is subject to It is limited to the complexity of fruit maturation regulatory mechanism,VvACS1 gene in Fructus Lycopersici esculenti after overexpression, the one-tenth of Transgenic tomato fruit Ripe being instead delayed, this result shows,VvAlthough ACS1 gene is relevant to the expression of ethylene and release, but for fruit maturation Specifically affect because of the difference of plant type, its impact effect is the most different.

SEQUENCE LISTING

<110>Agricultural University Of He'nan

<120>Fructus Vitis viniferae VvACS1 gene and application thereof

<130> none

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 1518

<212> DNA

<213> Vitis vinifera

<400> 1

atgagagtga tagttccttt acaaggggtg gttcagggaa gagggggact tgtgttgggt 60

tcagtaattc cctgcgctct cttttacctc ttgcagctct acttcaaacg acatcgttcc 120

gagcccacgc ccccgcccca gaagctgacg gaggtctctg agttaaacag gtccctgtct 180

cggacccatc tgcctgcaag gggttcgagc gcgccggctt gtgtgtcaac gcgggcaaat 240

tcgattgtga agtccagtga ttcgcctttc tatgttgggc tgaagagggt ttcagaggat 300

ccctatgatg aattgagtaa tccagagggg gttattcagc ttggtttggc tgaaaacaag 360

ttgtcattgg acttggctcg agactggctt gcagagaatg caaaggattg gatattgagt 420

ggaggtggaa gtagtgggcc attgagtatg ggcgggattg caaattatca ggcgtcagat 480

ggattagtgg agttgaaagt ggctgtggca ggattcatgt ctcaagtcat ggaacgatca 540

atatccttta acccatcaca gatagtctta acagctggtg cagcccctgc aattgagatc 600

ctcagtttct gcctagcaga tactggaaat gcatttcttg ttcccacacc atactatccc 660

agttttgata gggatttaaa atggagaact ggggtggaga taattcctgt tccctgtcgc 720

agtgctgaca atttcaatct aagtataagt gctcttgact tagcattcga ccagggaaag 780

aaacgtggtt taaaagttcg tgggattgta atttccaacc cctcaaatcc tgttggcaat 840

ctgcttaatc gagaaacaat ttacagcctt gtagactttg ctcgagagaa gaacatccat 900

ataatttcaa atgaaatatt tgctgggtcc actcatggaa gcgaagagtt tgtgagcatg 960

gctgaaatta ttgattcgga agacttggac agggacagag ttcacatagt gtatgggctg 1020

tcaaaagacc tctgtcttcc acgttttaaa gtgggggtta tatattcgtc taatgaaaat 1080

gttctggctg ctgctaagaa actctcaagg ttttcttcca tttcagctcc aacccagtgt 1140

ttggttatct ccatgctttc agatataaga ttcatacaaa agttcattca gaccaacaga 1200

gagaggcttc aaagaatgta tactaaattc gtggcagggt tgaaacaatt aggaattgag 1260

tgcatgcgga gcagtggggg cttctactgt tgggctgaca tgaggggatt aatccgctct 1320

tacagtgaga aaggggagct cgagctatgg aacaaattgt tgaatatagc aaagataaat 1380

gtaactccag gatcttcttg tcactgtatt gaacctggat ggttccgctg ttgttttact 1440

acattractg aaaaggatat tcctgtagtg atggaacgaa ttcggaaagt ttctgaaacc 1500

tgtatatccc ccagatga 1518

Claims (3)

1. Fructus Vitis viniferaeVvACS1 gene, it is characterised in that this gene comprises 1518 bases, sequence is as shown in SEQ ID NO.1.

2. described in claim 1VvACS1 gene application in cultivating new variety of plant, it is characterised in that by this gene transformation After plant overexpression, the maturation time of fruit can be affected.

The most as claimed in claim 2VvACS1 gene application in cultivating new variety of plant, it is characterised in that described plant For Fructus Lycopersici esculenti.