CN106046131A - Elytrigia elongata HKT type transporter, namely EeHKT1; 4, as well as coding gene and application thereof - Google Patents

Abstract

The invention discloses an elytrigia elongata HKT type transporter, namely EeHKT1; 4, as well as a coding gene and application thereof. The amino acid sequence of the transporter is shown as SEQ ID NO. 2, and the nucleotide sequence of the coding gene of the transporter is shown as SEQ ID NO. 1. The elytrigia elongata HKT type transporter, namely EeHKT1; 4, and the coding gene thereof can be used for improving the salt resistance of crops or fine pasture. Under salt stress, the EeHKT1; 4 gene is mainly expressed in roots and leaf sheaths, and the expression quantity in leaves is very low and is in the basically unchanged trend. The EeHKT1; 4 gene is over-expressed in tobacco; compared with the salt resistance of wild-type tobacco, the salt resistance of transgenic tobacco under salt stress is significantly improved, which indicates that the EeHKT1; 4 gene has important application prospect in genetic salt resistance and stress resistance improvement of plants.

Description

A kind of E. elongata HKT class transport protein EeHKT1；4 and encoding gene with Application

Technical field

The present invention relates to molecular biology and biological technical field, in particular it relates to a kind of E. elongata HKT class transhipment Albumen and encoding gene thereof and application.

Background technology

Due to global warming, world population is continuously increased, and industrial pollution aggravates, and the development of Irrigation farming, chemical fertilizer makes By the factor such as improper, the soil salinization is on the rise, and this not only makes soil desertification, ecological environment deteriorate further, and Have become as obstruction crop growth and the principal element of high yield and high quality.China's soil salinization is day by day serious at present, Badly influencing the production of crops, cause declining in agricultural production, this Tough questions is urgently to be resolved hurrily.Prior art solves to ask The main path of topic or the method for tradition improvement salinized soil, such as fresh water washing, Rational Irrigation and use CaCO₃Deng.But, pass System measure investment is big, benefit is low, and along with the secondary salinization adding membership aggravation soil of a large amount of chemical substances, this forces people Be considered as other measure and carry out modified utilization salt-affected soil.Along with the development of biotechnology, cultivate anti-salting, drought-resistant fitting On salt-affected soil, preferably grow and have the plant lines of higher economy and the ecological value, be develop salt-affected soil one Economic and effective approach.So the research of resistant gene of salt to be become current study hotspot.

Strengthen plant salt endurance or improve the subject matter that the salinization of soil has become present stage and faced, and E. elongata (Elytrigia elongata) is the sibling species of Semen Tritici aestivi, originates in W. Asia and Asia Minor, and habitat is beach and salt Alkali grassy marshland, has extremely strong salt tolerance, it has also become improvement Semen Tritici aestivi indispensable wild gene storehouse.Research finds, high affine K⁺ Transport protein HKT (High Affinity K⁺Transporter) by limiting root Na⁺Absorption, to remain internal, especially It is the Na that overground part is low⁺Concentration and high K⁺/Na⁺Ratio, is the key of Salt Tolerance of Higher Plant.Inventor is from E. elongata Strong Salinity tolerance germplasm material screens SSR molecular marker specific site Xgwm044 closely linked with resistant gene of salt, through order-checking card This site nucleotide sequence bright and one grained wheat TmHKT7-A2 (TmHKT1；4) genetic homology reaches 93%.

Summary of the invention

It is an object of the invention to provide a kind of high affine K⁺E. elongata HKT class transport protein EeHKT1；4 and compile Code gene.

Offer E. elongata HKT class transport protein EeHKT1 is provided；4 and encoding gene Preparing transgenic plant and the application improved in crops salt resistance ability.

The E. elongata HKT class transport protein EeHKT1 that the present invention provides；4, its aminoacid sequence is containing SEQ ID Aminoacid sequence shown in No.2.

Further, the E. elongata HKT class transport protein EeHKT1 of the present invention；4 containing coding P-loop a-quadrant One section of conserved sequence LFFTAVSAATVSSMSTV, wherein the S (serine) of the 129th is the special selection in P-loop a-quadrant Property site, with Na⁺Transport function is correlated with.

Gene of the present invention includes encoding described E. elongata HKT class transport protein EeHKT1；The nucleotides sequence of 4 is classified as and contains There is the nucleotide sequence shown in SEQ ID NO.1.

The present invention provides a kind of recombinant vector containing any of the above-described kind of gene.

Gene of the present invention can be operably connected with expression vector, obtain expressing the recombinant expressed of albumen of the present invention Carrier, imports this recombinant expression carrier in appropriate host cell, it is thus achieved that express E. elongata HKT class of the present invention further Transport protein EeHKT1；The genetic engineering bacterium of 4.

In present example, by by EeHKT1；4 genes are inserted into structure on expression vector pBI121 and obtain restructuring table Reach carrier pBI121-EeHKT1；4.Further, import to this expression vector Host Strains obtains express EeHKT1；4 gene works Journey bacterium.

The host cell that above-mentioned recombinant vector converts falls within protection scope of the present invention.

Present invention also offers above-mentioned EeHKT1；The application in preparing transgenic plant of 4 genes.

The invention provides E. elongata HKT class transport protein EeHKT1；4 or its encoding gene improve plant salt tolerance Application in ability.

The invention provides E. elongata HKT class transport protein EeHKT1；4 or its encoding gene at plant germplasm resource Application in improvement breeding.

Preferably, described plant is crops or herbage.

Obtaining the transgenic paddy rice with salt resistance ability so that it is can grow on salt-affected soil, this is to develop salt One economy of stain soil and effective approach.

The beneficial effects are mainly as follows: E. elongata HKT class transport protein EeHKT1 is provided；4 and compile Code gene, experiments verify that this EeHKT1；4 genes are expressed in Nicotiana tabacum L., can improve the ability of Tobacco Salt environment；Can be by EeHKT1；4 genes proceed in crops, it is thus achieved that have the transgenic crop of salt resistance ability, to improve the adaptability of crops, Important application prospect is had in crop breeding.

Accompanying drawing explanation

Fig. 1 is EeHKT1；4 transmembrane region.

Fig. 2 is E. elongata EeHKT1；4 and one grained wheat TmHKT1；4-A2, durum wheat TdHKT1；4-1 aminoacid Multiple comparisons.The S (serine) of arrow indication is specific selectivity site, P-loop a-quadrant.

Fig. 3 is that Real time RT-PCR analysis variable concentrations (0,25,50,100,150 and 200mM) NaCl processes 48h Afterwards to EeHKT1 in E. elongata root, sheath and blade；The impact of 4 gene expression doses.In figure, each point all represents averagely Value ± standard error (SE) (n=3).Actin gene in Real time RT-PCR as internal reference.

Fig. 4 is E. elongata HKT class transport protein EeHKT1；4 gene plant expression vector pBI121-EeHKT1；4 Build flow process.

Fig. 5 be transfer-gen plant L1, L7 and WT lines under 0mM and 200mM NaCl coerces, wild-type tobacco (WT) with the impact of transgenic line salt tolerance.Fig. 5 A is to wild type and transgene tobacco growing state after salt stress 10d Impact figure (WT: wild-type tobacco, T2: transgene tobacco)；Fig. 5 B is to grow wild type with transgene tobacco after salt stress 10d K in situation and root, stem, leaf⁺、Na⁺Change affects figure.

Detailed description of the invention

Following example are used for illustrating the present invention, but are not limited to the scope of the present invention.Without departing substantially from present invention spirit In the case of essence, the amendment that the inventive method, step or condition are made or replacement, belong to the scope of the present invention.

If not specializing, chemical reagent used in embodiment is conventional commercial reagent, skill used in embodiment The conventional means that art means are well known to those skilled in the art.

Embodiment 1 E. elongata and the cDNA clone of encoding gene thereof and qualification

According to known E. elongata EeHKT1；4 Gene Partial sequences, a length of 614bp, design 5 '-and 3 ' end draws Thing, uses RT-PCR and RACE method to be cloned into 5 ' from E. elongata-and 3 ' terminal sequences, length be respectively 580bp and 1117bp.Finally above 3 fragment assemblies are obtained EeHKT1；4 full length gene cDNA are 1977bp, comprise the opening of 1722bp Reading frame (ORF), the 5 ' untranslated regions (UTR) of 28bp and the 3 '-UTR of 227bp, be shown in Fig. 1.Encode 573 aminoacid, thus it is speculated that point Son amount is 62.92kDa, and isoelectric point, IP is 9.73.By its named EeHKT1；4.EeHKT1；4 transmembrane region are shown in Fig. 1.

Concrete operations are as follows:

(1) primer information:

1. 5 ' end primer:

UPM:

Long (0.4 μM):

5'–CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT–3'

Short (2 μMs): 5'CTAATACGACTCACTATAGGGC 3'

5’HKT1；4WR1:5 '-GTCTCATCATCGGCGGTAGTCG-3 '

NUP:5 '-AAGCAGTGGTATCAACGCAGAGT-3 '

5’HKT1；4NR2:5 '-GATCTCGACGCGCCTGGACGAC-3 '

2. 3 ' end primer:

3’HKT1；4WF1:5 '-ACGTACCTCACACGAGGCTGCG-3 '

3 ' O:5 '-TACCGTCGTTCCACTAGTGATTT-3 '

3’HKT1；4NF1:5 '-TGTTCACGACGGTGTCCACGTTCT-3 '

3 ' I:5 '-CGCGGATCCTCCACTAGTGATTTCACTATAGG-3 '

3. ORF frame primer:

ORF-F:5 '-ATGCAACTCCCAAGTCATAA-3 '

ORF-R:5 '-CTAACTAAGCTTCCAGGTCC-3 '

(2) 5 ' and 3 ' section sequence cloning process according to SMARTerTM RACE cDNA Amplification Kit with TaKaRa 3’-Full RACE Core Set With PrimerScropt^TMRTase test kit technical method operates.

(3) the long fringe affine K of Herba bromi japonici natural plant height that will obtain⁺The named EeHKT1 of transporter gene full-length cDNA；4, its core Nucleotide sequence is as shown in SEQ ID NO.1, and the aminoacid sequence of its encoding proteins is as shown in SEQ ID NO.2.E. elongata EeHKT1；4 and one grained wheat TmHKT1；4-A2, durum wheat TdHKT1；The amino acid whose multiple comparisons of 4-1 is shown in Fig. 2, in figure The S (serine) of 129 is specific selectivity site, P-loop a-quadrant.

Embodiment 2 E. elongata EeHKT1；4 genes expression characteristic under salt stress

In order to analyze E. elongata salt resistance ability Changing Pattern, the E. elongata seedling of 4 week old is respectively with different dense Degree NaCl (0,25,50,100,150 and 200mM NaCl) respectively organizes EeHKT1 in (blade, sheath and root) after processing 48h；4 bases The expression of cause is analyzed, and result is shown in Fig. 3.Method particularly includes: with Actin gene as internal reference,

HKT1；4 gene expression primer sequences be 5 '-CCGATGATGAGACGAGCAAG-3 ' and 5 '- ATGGCGAGGACGACGAA-3’。

Actin gene primer sequence be 5 '-CTTGACTATGAACAAGAGCTGGAAA-3 ' and 5 '- TGAAAGATGGCTGGAAAAGGA-3’。

Operational approach is as follows:

(1) Total RNAs extraction: extract E. elongata gene according to EZ-10RNA Mini-Preps test kit operating procedure Group total serum IgE.

(2) synthesis of cDNA the first chain:

1. DNA eliminates and reacts: 5 × gDNA Eraser Buffer 2.0 μ L, gDNA Eraser 1.0 μ L, Total RNA X μ L, RNase Free dH₂O7-x μ L, Total 10.0 μ L.2min is reacted in 42 DEG C；

2. reverse transcription reaction: above-mentioned (1) reactant liquor 10.0 μ L, 5 × PrimerScript Buffer 4.0 μ L, PrimerScript RT Enzyme MixI 1.0 μ L, RT Primer Mix 1.0 μ L, RNase Free dH₂O 4.0 μ L, Total 20.0μL.Reacting 15min, 85 DEG C of reaction 5s in 37 DEG C, 4 DEG C preserve or for follow-up test.(note: the use of total serum IgE Amount is 1 μ g.)

(3) Real-time PCR: reaction system: cDNA 1 μ L, Primers 1.6 μ L, ROX Reference Dye 0.4 μ L,PremixEix TaqII 10 μ L, dH₂O 7 μ L, cumulative volume 20 μ L.Reaction condition: 95 DEG C of 30s；95℃ 5s, 60 DEG C of 1min, 40 circulations；95℃10s；65 DEG C of 5s, 95 DEG C of 5s.Record test data result, analyzes EeHKT1；4 genes Gene expression abundance is strong and weak.

Real time RT-PCR analyzes and shows: along with the increase of NaCl (50-200mM) concentration for the treatment of, its blade, sheath With the EeHKT1 in root；4 genetic transcription abundance are all in increasing trend, and show root > sheath > trend of blade.This explanation EeHKT1；4 genes can unload Na from sheath and root xylem sap⁺, and then prevent the Na in blade⁺Build up to poison water Flat, thus maintaining overground part K⁺、Na⁺Stable state has important effect.

Embodiment 3 E. elongata EeHKT1；4 Functional identification of genes

Utilize the technical method that Clontech Infusion test kit is relevant, by EeHKT1；4 gene forwards are inserted into plants Between Xba I and the Sma I enzyme action of thing expression vector pBI121 (Fig. 4), obtain plant Overexpression vector pBI121-35S- EeHKT1；4-Nos.Use CaCl₂Freeze-thaw method is by pBI121-35S-EeHKT1；4-Nos plasmid imports in Agrobacterium EHA105, Utilize leaf dish infestation method, will be containing pBI121-35S-EeHKT1；The Agrobacterium bacterium solution of 4-Nos plant expression carrier plasmid is to The leaf dish differentiating callus infects, and 7min, dark processing 2d are infected in vibration, are positioned over containing 50mg/L kanamycin (Kan) culture identification is carried out, to obtain transgenic tobacco plant with in the MS culture medium of 500mg/L Carbenicillin (Carb).

By transgene tobacco and wild-type tobacco respectively in the Hoagland nutritional solution of 0,50,100 and 200mM NaCl Coerce 10d, with distilled water flushing tobacco plant salt surfactant, then by the 20mM CaCl of root pre-cooling₂Rinse 8min, water suction Paper blots its surface moisture, takes its root and overground part respectively, in 80 DEG C of drying (Wang et al.2007；Guo et al.2015).Dry sample is put in 20mL test tube, the 100mM glacial acetic acid of addition 10mL, 90 DEG C of temperature bath 2h, cooled and filtered, dilute Release suitable multiple, use atomic absorption spectrophotometer (AA-6300C, Shimadza, Kyoto, Japan) to measure K⁺、Na⁺。

By transgene tobacco and wild-type tobacco respectively in the Hoagland nutritional solution of 0,50,100 and 200mM NaCl Ionic stress 10d, with distilled water flushing tobacco plant salt surfactant, then by the 20mM CaCl of root pre-cooling₂Rinse 8min, Its surface moisture is blotted in absorbent paper, takes its root and overground part respectively, in 80 DEG C of drying (Wang et al.2007；Guo et al.2015).Dry sample is put in 20mL test tube, the 100mM glacial acetic acid of addition 10mL, 90 DEG C of temperature bath 2h, cooled and filtered, dilute Release suitable multiple, use atomic absorption spectrophotometer (AA-6300C, Shimadza, Kyoto, Japan) to measure K⁺、Na⁺.Logical Cross wild-type tobacco and transgene tobacco overground part and underground part K under the conditions of analysis variable concentrations NaCl⁺、Na⁺Accumulation mode changes Rule.Result shows: along with the increase of NaCl (50～200mM) concentration for the treatment of, Na⁺Accumulated concentrations at the root of Nicotiana tabacum L., stem, leaf In all present increase trend, show root > stem > trend (Fig. 5 A) of leaf, and K⁺Present downward trend (Fig. 5 B).Wherein 100 ～under 200mM NaCl processes, transgene tobacco root and Na in stem⁺Accumulated concentrations be higher than wild type, respectively higher than 15.3%, 18.2% and 11.7%, 14.2%, and K⁺There is no notable difference；And Na in transgenic leaf⁺Concentration is substantially less than wild type cigarette Grass, respectively 30.2%, 33.9%, contrary K⁺Concentration is significantly higher than wild type, is 29.7%, 37.0%.This shows, with wild Type is compared by Nicotiana tabacum L., the Na in transgene tobacco under salt stress⁺It is deposited in root and stem, decreases Na in its leaf⁺Excess amass Tired, to avoid the injury to blade, thus maintain K in blade⁺、Na⁺Stable state, thus improve transgenic tobacco plant Salt tolerance.

Although, the present invention is described in detail the most with a general description of the specific embodiments, but On the basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Cause This, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to the scope of protection of present invention.

Claims (10)

1. an E. elongata HKT class transport protein EeHKT1；4, it is characterised in that its aminoacid sequence is containing SEQ ID Aminoacid sequence shown in No.2.

2. E. elongata HKT class transport protein EeHKT1 as claimed in claim 1；4, it is characterised in that containing coding P- One section of conserved sequence LFFTAVSAATVSSMSTV of loop a-quadrant, wherein the serine of the 129th is that P-loop a-quadrant is special Different selectivity site, with Na⁺Transport function is correlated with.

3. coding E. elongata HKT class transport protein EeHKT1 described in claim 1；The gene of 4.

4. gene as claimed in claim 3, it is characterised in that its nucleotides sequence is classified as containing the core shown in SEQ ID NO.1 Nucleotide sequence.

5. contain the recombinant vector of gene described in claim 3 or 4.

6. contain the recombinant microorganism of gene described in claim 3 or 4.

7. contain the transgenic cell line of gene described in claim 3 or 4.

8. the application in preparing transgenic plant of the gene described in claim 3 or 4.

9. E. elongata HKT class transport protein EeHKT1；4 or its encoding gene in the application improved in plant salt tolerance ability.

10. E. elongata HKT class transport protein EeHKT1；4 or its encoding gene plant germplasm resource improvement breeding in Application.