CN106011307A - Nucleic acid rapid detection method for H7 subtype avian influenza virus - Google Patents
Nucleic acid rapid detection method for H7 subtype avian influenza virus Download PDFInfo
- Publication number
- CN106011307A CN106011307A CN201610063693.8A CN201610063693A CN106011307A CN 106011307 A CN106011307 A CN 106011307A CN 201610063693 A CN201610063693 A CN 201610063693A CN 106011307 A CN106011307 A CN 106011307A
- Authority
- CN
- China
- Prior art keywords
- influenza virus
- avian influenza
- nucleic acid
- subtype avian
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Belonging to the field of biotechnology, the invention establishes a nucleic acid rapid detection method for H7 subtype avian influenza virus. The method comprises three technical points: establishment of primer sequences needed by nucleic acid detection; establishment of detection reaction type; and establishment of a detection reaction system and reaction conditions. The nucleic acid detection method can be used for scientific research of H7 subtype avian influenza virus, and also can be used for clinical diagnosis detection of animals or human.
Description
Technical field
The invention belongs to biological technical field；Particularly, the present invention establishes the method for quick of H7 subtype avian influenza virus, and for the quick detection of H7 subtype avian influenza virus, there is bigger use value in the field such as diagnosis, veterinary, food safety, bio-safety in vitro.
Background technology
Bird flu, according to pathogenic difference, can be divided into high pathogenic avian influenza, low pathogenicity bird flu and no pathogenicity bird flu.Wherein, high pathogenic avian influenza is the disease caused by some strain of H5 and H7 hypotype.
Viral nucleic acid detection is one of Viral diagnosis important method.At present, various nucleic acid detection methods to H7 subtype avian influenza virus both at home and abroad, including agricultural industry criteria or national standard, the consuming time is the most long, as agricultural industry criteria (rapid test of AIV by RT-PCR, NY/T 772 2013) at least needs 2 h, national standard (H7 subtype avian influenza virus fluorescence RT-PCR detection method, GB/T 19438.3 2004) at least need 1.2 h, currently without the detection method more in hgher efficiency than these methods.
Summary of the invention
The present invention is directed to the deficiency of above-mentioned existing H7 subtype avian influenza virus detection technique, carried out further investigation and test, established H7 subtype avian influenza virus nucleic acid method for quick based on recombinase polymeric enzymatic amplification technology, it is only necessary to 20 min can complete detection.The method includes three below aspect content:
(1) primer sequence required for detection of nucleic acids is established, for conservative region in H7 HA Gene of H 9 Subtype AIV, design primer sequence, wherein forward primer sequence contains 30 bases, sequence is SEQ ID NO.1 in ggtattcgctctgattgcgatcattccaac(i.e. sequence table), downstream forward primer sequence contains 30 bases, and sequence is SEQ ID NO.2 in ttccactgtatgtgaatcccattgcttcct(i.e. sequence table)；
(2) method for quick based on recombinase polymeric enzymatic amplification technology is established；
null(3) detection reaction system and reaction condition are established，Pure water 9.2 μ l it is sequentially added in the pipe of polymerase chain reaction、Reaction buffer 29.5 μ l(contains dATP、dGTP、dTTP、Four kinds of nucleotide such as dCTP)、Forward primer 2.4 μ l(concentration synthesized by the first step is 10 μm ol/L)、Downstream primer 2.4 μ l(concentration synthesized by the first step is 10 μm ol/L)、Enzymatic mixture [reverse transcriptase、Can be in conjunction with the recombinase of single-chain nucleic acid (oligonucleotide primers)、Single-stranded DNA binding protein (SSB) and strand displacement archaeal dna polymerase] 1.0 μ l、RNase inhibitor 1.0 μ l、The influenza nucleic acids 2.0 μ l(needing detection extracts with nucleic acid extraction kit from clinical sample or other samples)、Magnesium acetate (280 mmol/L) 2.5 μ l；Then reaction system is airtight, it is placed on thermostat (or water-bath) and reacts, reaction condition is 40 DEG C of 20 min；After reaction terminates, add containing coloured nucleic acid electrophoresis buffer in the reaction product, carry out agarose nucleic acid gel electrophoresis, be about the nucleic acid electrophoresis band of 395 bp if there is size, be then judged as the positive, be otherwise judged as feminine gender.
Detailed description of the invention
Below by embodiment, technical scheme is described, but protection scope of the present invention is not limited to this embodiment.
The present embodiment recombinase polymeric enzymatic amplification technology, carries out nucleic acid to H7 subtype avian influenza virus and quickly detects, comprise the steps:
The first step (synthetic primer): the nucleotide sequence (i.e. SEQ ID NO.1 and SEQ ID NO.2 in sequence table) specified according to the present invention, synthetic recombinase polymeric enzymatic amplification reaction required for forward primer and downstream primer；
nullSecond step (configuration reaction system): be sequentially added into pure water 9.2 μ l in the pipe of polymerase chain reaction、Reaction buffer 29.5 μ l(contains dATP、dGTP、dTTP、Four kinds of nucleotide such as dCTP)、Forward primer 2.4 μ l(concentration synthesized by the first step is 10 μm ol/L)、Downstream primer 2.4 μ l(concentration synthesized by the first step is 10 μm ol/L)、Enzymatic mixture [reverse transcriptase、Can be in conjunction with the recombinase of single-chain nucleic acid (oligonucleotide primers)、Single-stranded DNA binding protein (SSB) and strand displacement archaeal dna polymerase] 1.0 μ l、RNase inhibitor 1.0 μ l、The influenza nucleic acids 2.0 μ l(needing detection extracts with nucleic acid extraction kit from clinical sample or other samples)、Magnesium acetate (280 mmol/L) 2.5 μ l；
3rd step (reaction): after the reaction system that configured by second step is airtight, being placed on thermostat (or water-bath) and react, reaction condition is 40 DEG C of 20 min；
4th step (result detection): add containing coloured nucleic acid electrophoresis buffer in the product of the 3rd step, carry out agarose nucleic acid gel electrophoresis, be about the nucleic acid electrophoresis band of 395 bp if there is size, be then judged as the positive, be otherwise judged as feminine gender.
Result of practical application: 96 parts of H7 subtype avian influenza virus standard positive clinical samples are detected, and 300 parts of standard female samples, detecting by above-mentioned H7 subtype avian influenza virus Rapid nucleic acid detection technique, result shows that the sensitivity of this technology is 100.0%, and specificity is 100.0%.
<110>China Animal Health and Epidemiology Center
<120>H7 subtype avian influenza virus nucleic acid method for quick
<160>
2
<210>
1
<211> 30
<212>
DNA
<213>artificial sequence
<220>
<223>design, as the forward primer required for H7 subtype avian influenza virus detection of nucleic acids according to nucleotide sequence conservative in the genome of H7 subtype avian influenza virus
<400>
1
ggtattcgctctgattgcgatcattccaac 30
<210>
2
<211> 30
<212>
DNA
<213>artificial sequence
<220>
<223>design, as the downstream primer required for H7 subtype avian influenza virus detection of nucleic acids according to nucleotide sequence conservative in the genome of H7 subtype avian influenza virus
<400>
2
ttccactgtatgtgaatcccattgcttcct 30
Claims (5)
1.H7 subtype avian influenza virus nucleic acid method for quick, uses the reaction of recombinase polymeric enzymatic amplification, it is characterized in that detecting all H7 subtype avian influenza virus.
2.H7 subtype avian influenza virus nucleic acid method for quick, its feature has two: one to be to detect all H7 subtype avian influenza virus；Two is to use the reaction of recombinase polymeric enzymatic amplification.
3.H7 subtype avian influenza virus nucleic acid method for quick, its feature has three: one to be to detect all H7 subtype avian influenza virus；Two is the pair of primers using the region conservative for H7 HA Gene of H 9 Subtype AIV and designing；Three is to use the reaction of recombinase polymeric enzymatic amplification.
4.H7 subtype avian influenza virus nucleic acid method for quick, can use recombinase polymeric enzymatic amplification to react, and its feature has two: one to be to detect all H7 subtype avian influenza virus；Two be the sequence of a primer that detection reaction uses be ggtattcgctctgattgcgatcattccaac, or have sequence that the base sequence of 10 or more than 10 is identical with ttccactgtatgtgaatcccattgcttcct sequence (in this section of word, primer sequence is 5 slash ends and skims end to 3, and a, t, g, c represent corresponding base).
5.H7 subtype avian influenza virus nucleic acid method for quick, its feature has two: one to be to use the reaction of recombinase polymeric enzymatic amplification；Two is two primers that detection reaction uses, its sequence is respectively ggtattcgctctgattgcgatcattccaac and ttccactgtatgtgaatcccattgcttcct, or have sequence that the base sequence of 10 or more than 10 is identical with the two sequence (in this section of word, primer sequence is 5 slash ends and skims end to 3, and a, t, g, c represent corresponding base).
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610063693.8A CN106011307A (en) | 2016-01-29 | 2016-01-29 | Nucleic acid rapid detection method for H7 subtype avian influenza virus |
| CN202210373783.2A CN114645100A (en) | 2016-01-29 | 2016-01-29 | Primer pair for detecting H7 subtype avian influenza virus, and method for detecting H7 subtype avian influenza virus by using primer pair |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610063693.8A CN106011307A (en) | 2016-01-29 | 2016-01-29 | Nucleic acid rapid detection method for H7 subtype avian influenza virus |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210373783.2A Division CN114645100A (en) | 2016-01-29 | 2016-01-29 | Primer pair for detecting H7 subtype avian influenza virus, and method for detecting H7 subtype avian influenza virus by using primer pair |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106011307A true CN106011307A (en) | 2016-10-12 |
Family
ID=57082805
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610063693.8A Pending CN106011307A (en) | 2016-01-29 | 2016-01-29 | Nucleic acid rapid detection method for H7 subtype avian influenza virus |
| CN202210373783.2A Pending CN114645100A (en) | 2016-01-29 | 2016-01-29 | Primer pair for detecting H7 subtype avian influenza virus, and method for detecting H7 subtype avian influenza virus by using primer pair |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210373783.2A Pending CN114645100A (en) | 2016-01-29 | 2016-01-29 | Primer pair for detecting H7 subtype avian influenza virus, and method for detecting H7 subtype avian influenza virus by using primer pair |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN106011307A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106676104A (en) * | 2017-03-01 | 2017-05-17 | 中国农业大学 | Primer pair for authenticating North America-branch H7 subtype avian influenza virus and application thereof |
| CN109722492A (en) * | 2019-01-24 | 2019-05-07 | 中国动物卫生与流行病学中心 | A method of detection H5 and H7N9 subtype highly pathogenic avian influenza virus and H9 subtype avian influenza virus |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105018485A (en) * | 2015-07-31 | 2015-11-04 | 中国动物卫生与流行病学中心 | Primer and probe for detecting peste des petits ruminants virus by virtue of RPA (Recombinase Polymerase Amplification) technique |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2718482T3 (en) * | 2004-06-01 | 2019-07-02 | Alere San Diego Inc | Recombinase polymerase amplification kit |
| CN104694662A (en) * | 2015-04-03 | 2015-06-10 | 杜文红 | Nucleic acid isothermal amplification reaction detecting method and detection kit based on nucleic acid isothermal amplification reaction detecting method |
-
2016
- 2016-01-29 CN CN201610063693.8A patent/CN106011307A/en active Pending
- 2016-01-29 CN CN202210373783.2A patent/CN114645100A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105018485A (en) * | 2015-07-31 | 2015-11-04 | 中国动物卫生与流行病学中心 | Primer and probe for detecting peste des petits ruminants virus by virtue of RPA (Recombinase Polymerase Amplification) technique |
Non-Patent Citations (3)
| Title |
|---|
| NAHED YEHIA, ET AL.: "Development of reverse transcription recombinase polymeraseamplification assay for avian influenza H5N1 HA gene detection", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| VIRUSAHMED ABD EL WAHED, ET AL.: "Diagnostics-in-a-Suitcase: Development of a portable and rapid assayfor the detection of the emerging avian influenza A (H7N9) virus", 《JOURNAL OF CLINICAL VIROLOGY》 * |
| 孙祖越 周莉 主编: "《药物生殖与发育毒理学》", 31 January 2015, 上海科学技术出版社 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106676104A (en) * | 2017-03-01 | 2017-05-17 | 中国农业大学 | Primer pair for authenticating North America-branch H7 subtype avian influenza virus and application thereof |
| CN109722492A (en) * | 2019-01-24 | 2019-05-07 | 中国动物卫生与流行病学中心 | A method of detection H5 and H7N9 subtype highly pathogenic avian influenza virus and H9 subtype avian influenza virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114645100A (en) | 2022-06-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105671201B (en) | For identifying that the primer of foot and mouth disease virus and vesicular stomatitis virus is combined and its applied | |
| CN101624636B (en) | LAMP-LFD detection method of infectious spleen and kidney necrosis virus (ISKNV) | |
| CN105986044B (en) | Avian influenza virus nucleic acid General rapid detection method | |
| CN105018485A (en) | Primer and probe for detecting peste des petits ruminants virus by virtue of RPA (Recombinase Polymerase Amplification) technique | |
| CN105986042A (en) | Method for quickly detecting nucleic acid of H9 subtype avian influenza virus | |
| CN105986043A (en) | Method for quickly detecting nucleic acid of H5 subtype highly pathogenic avian influenza virus | |
| CN102676701B (en) | Universal RT-PCR (Reverse Transcription Polymerase Chain Reaction) detection primer and detection method for avian pneumovirus | |
| CN111118211A (en) | Bovine sarcoidosis detection kit and method based on loop-mediated isothermal amplification technology | |
| CN105331743A (en) | Kit for rapidly detecting various viruses in muskmelon by one step and rapid detection method adopting kit | |
| ES2541710T3 (en) | Genotyping procedure | |
| CN106754911B (en) | Primer group for identifying mycoplasma bovis, bovine viral diarrhea virus and infectious bovine rhinotracheitis virus and application thereof | |
| CN103484571A (en) | LAMP (loop-mediated isothermal amplification) detection primer group, detection kit and detection method for infectious hypodermal and hematopoietic necrosis virus | |
| CN109762940A (en) | For detecting the primer sets and kit of infectious spleen and kidney necrosis virus Yu mandarin fish rhabdovirus | |
| CN107287354B (en) | Method for detecting white spot syndrome virus of prawn by loop-mediated isothermal amplification method | |
| KR102231338B1 (en) | Primers and probes for detection of avian influenza, newcastle disease and avian infectious bronchitis viruses, and detecting method of avian influenza, newcastle disease and avian infectious bronchitis viruses using the same | |
| WO2016075277A1 (en) | Novel fish virus and method for detection | |
| CN106011307A (en) | Nucleic acid rapid detection method for H7 subtype avian influenza virus | |
| CN101487064B (en) | Method and special reagent kit for detecting five zoonosis virus | |
| CN107475462B (en) | Kit for identifying common serotype chicken inclusion body hepatitis infection and application thereof | |
| CN104762413A (en) | General nucleic acid detection method for influenza viruses | |
| CN105177138A (en) | Primer and method used for detecting Oidium heveae and application | |
| JP3494509B2 (en) | Nucleic acid synthesis method | |
| CN103215389A (en) | Porcine reproductive and respiratory syndrome and porcine Japanese B encephalitis dual one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) diagnosis kit | |
| WO2017209599A1 (en) | Method and kit for simultaneous and rapid detection of prawn viruses | |
| KR102076341B1 (en) | Composition for detecting severe fever with thrombocytopenia syndrome virus using LAMP and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161012 |
|
| RJ01 | Rejection of invention patent application after publication |