CN106011220B - The method for quickly separating and detecting and used medium of sickle-like bacteria in a kind of sample - Google Patents
The method for quickly separating and detecting and used medium of sickle-like bacteria in a kind of sample Download PDFInfo
- Publication number
- CN106011220B CN106011220B CN201610618080.6A CN201610618080A CN106011220B CN 106011220 B CN106011220 B CN 106011220B CN 201610618080 A CN201610618080 A CN 201610618080A CN 106011220 B CN106011220 B CN 106011220B
- Authority
- CN
- China
- Prior art keywords
- sickle
- bacteria
- sample
- detecting
- culture medium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
- C12Q1/045—Culture media therefor
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to the method for quickly separating and detecting and used medium of sickle-like bacteria in a kind of sample, sample is coated on isolation medium and is cultivated, it is separately cultured in based component without any nitrogen source, contains by mass percentage: 0.4%-1% carbon source, 1.5-2% agar powder, 0.15-0.3%K2HPO4, 0.1-0.3%MgSO4, 0.1-0.3%CaCl2, 0.3-0.5%CaCO3, pH 6.5-7;Also contain the antibiotic that bacterium can be inhibited without inhibiting fungi in the culture medium;Carbon source is one or more of sucrose, glucose, D- galactolipin, arabinose and mannitol;Picking white translucent aerial hyphae, microexamination judge whether it is sickle-like bacteria according to cell morphological characteristic from single colonie after culture is good.The detection to the sickle-like bacteria in all kinds of samples can be achieved in the present invention, other fungal contaminations is avoided, so that detection sensitivity is higher, the period is shorter.
Description
Technical field
The present invention relates to a kind of strain separating technologies, and in particular to the method for quickly separating and detecting of sickle-like bacteria in a kind of sample
And used medium.
Background technique
Fusarium class fungi can lead to serious corps diseases, such as wheat scab, Fusarium and jade
Rice ear rot etc..The mycetogenetic fusarium toxin of the category is that a kind of secondary metabolites can make one vomiting, diarrhea, induce big joint
The serious health problems such as disease even cancer.Therefore sickle-like bacteria detection technique has in customs quarantine control, field diseases prevention and control detection
Important function;It and is an important detection in grain and food safety with the detection of the fusarium toxin of sickle-like bacteria tight association
Mesh.
It can only reflect the toxin concentration in sample for the detection technique of fusarium toxin content, can not be in test sample
It is no that there are sickle-like bacteria living body bacterium;During the unpredictable foodstuff preservation of this method toxin whether can persistent accumulation risk.Therefore,
Fusarium toxin during sickle-like bacteria content detection will be the key that prevention and control foodstuff preservation is carried out before foodstuff preservation to accumulate.
Mainly there are 4 classes to the detection method of sickle-like bacteria in field diseases or customs quarantine control at present:
1. being based on the detection technique of polymerase chain reaction (PCR)
This kind of detection technique designs a pair of generally directed to a certain segment in the genome of some or several Fusarium Species
Or multiple special primers, obtain target fragment by one or many PCR amplifications, and to the segment of amplification carry out band analysis or
The kind to judge thallus is sequenced.The detection technique sensitivity is still lower, and (Monitoring lower-cut is 500 cell/g samples containing sickle-like bacteria
Product), band analysis false positive is high, living body and dead volume bacterium, the inadequate wide spectrum of detection range cannot be distinguished.
2. the detection technique based on antibody
Such technology has special colour developing after the specific antibody for obtaining some specific reaping hook bacterial strain, with antibody connection is some
Whether the zymoprotein of reaction contains the specific reaping hook bacterial strain in test sample by chromogenic reaction.The detection technique research and development and
Use cost is high, and detection range is also very narrow.
3. the sickle-like bacteria spore In vivo detection technology based on fluorescent staining
Such fluorescent staining technique is usually to carry out living body judgement to the bacterial strain for being purifying.Living body bacterium and dead bacterium can
To catch different fluorescence colors, judge whether thallus is living body with this.The detection technique does not have specific aim, can not directly use
Sickle-like bacteria pollution in detection grain.
4. the detection method based on sickle-like bacteria separation
Culture medium PDA or the PPA culture medium added with pentachloronitrobenzene (PCNB) are often used using fungi, are divided from all kinds of samples
From sickle-like bacteria.Pure bacterial strain is obtained after multi-step continuously separates, then carries out bacterial strain identification by means such as Molecular Identifications.
This detection method is generally be directed to the material with obvious fusaridiosis.Such as Lu Weihong et al. is rotten from corncob
Pure bacterial strain is obtained with the method for PDA culture medium separating for several times in sick sample, then proves that isolated layer goes out sickle by Molecular Identification
(Lu Weihong, Huang Siliang, Tao Aili wait fusarium prolifertum in maize kernel rot sample to knife bacterium Fusarium proliferatum
Separation and identification [J] plant protection journal, 2011,38 (03): 233-239).Li Yongjian et al. is from banana blight
The Tanaka of (fusarium disease) takes rhizosphere soil, is screened after more wheel separation with the PPA culture medium with certain selection index system
Prove that isolated is that (Li Yongjian, Chen Yuanfeng, Yu Guohui wait dwarf banana to sickle-like bacteria to pure bacterium colony, then with method for identifying molecules
The separation of planting soil sickle-like bacteria and identification [J] guangdong agricultural science, 2014,41 (16): 74-80).
Since PDA is the culture medium of popularity, all kinds of fungies can fast-growth above it, therefore isolate and purify work
It measures very big, it is difficult to which screening obtains purpose sickle-like bacteria.
PPA culture medium has certain screening effect after joined PCNB, it is possible to reduce it is some to found withered bacterium and anthrax-bacilus etc.
The pollution of fungi, but it is still very big to screen isolated difficulty and workload, needs continuous multi-cycle separation screening.Such as Wang Jianfei
First step isolated strains from the chu chrysanthemum continuous cropping soil for have fusaridiosis with PPA culture medium, then " picking is grown on culture medium
The bacterium colony of 5d is inoculated into purifying culture 3d on potato culture, then picking colony is inoculated on potato culture, is so followed
(Wang Jianfei, Zhou Yi, Gao Xiang wait separation, the mirror of Fusarium oxysporum in chu chrysanthemum continuous cropping soil to ring, until the strain purified "
Fixed and variation characteristic [J] biology magazine, 2011,28 (06): 46-48).
Since such detection method is generally directed to containing a fairly large number of sample with sickle-like bacteria illness of sickle-like bacteria, and need
Want multiple separation that could obtain reaping hook bacterial strain;Therefore the less sample of no sickle-like bacteria illness, thallus content is not suitable for
Quickly detection.
To sum up, the detection method based on sickle-like bacteria separation, disadvantage are: cultivating used in a, current such separation method
Base such as PDA or PPA etc. cause the pollution rate of other fungies high, need multiple multi-cycle separation that could obtain pure bacterial strain;Separating difficulty
Greatly.B, the separation characteristic as a, this method separation cycle is too long, one separation circulation time 5 days or so, it is more than two
Separation circulation need 10 days or more working times, not being suitable for quickly detecting.C, the separation characteristic as a, separation
Heavy workload needs to expend biggish manpower and material resources.
Summary of the invention
The object of the present invention is to provide a kind of method for quickly separating and detecting of sickle-like bacteria in sample, it can be achieved that all kinds of samples
In sickle-like bacteria detection, other fungal contaminations are avoided, so that detection sensitivity is higher, the period is shorter.
The present inventor has found during correlative study: sickle-like bacteria is a kind of fungi with nitrogen fixation, has and is not required to
Want any nitrogen source, as long as having suitable carbon source and inorganic salts can normal growth physiological property;So far there are no it is any about
Sickle-like bacteria can be with the report of fixed nitrogen.And the culture medium such as PDA that uses of detection method in the prior art based on sickle-like bacteria separation or
The nitrogen source all rich in such as PPA, therefore the pollution rate that will lead to other fungies is high.
The technical solution of the present invention is as follows: in a kind of sample sickle-like bacteria method for quickly separating and detecting, comprising:
Sample is coated on isolation medium and is cultivated, it is described to be separately cultured in based component without any nitrogen source, by quality
Percentage contains: 0.4%-1% carbon source, 1.5-2% agar powder, 0.15-0.3%K2HPO4, 0.1-0.3%MgSO4, 0.1-0.3%
CaCl2, 0.3-0.5%CaCO3, pH 6.5-7;Also contain the antibiotic that bacterium can be inhibited without inhibiting fungi in the culture medium;
The carbon source is one or more of sucrose, glucose, D- galactolipin, arabinose and mannitol;
Picking white translucent aerial hyphae, microexamination judge according to cell morphological characteristic from single colonie after culture is good
It whether is sickle-like bacteria.
In a specific embodiment, the sample is derived from maize seed, corn stigma or wild rice stem.
In a specific embodiment, it is described can inhibit bacterium without inhibit fungi antibiotic be streptomysin and/
Or cephalosporin.
In a specific embodiment, the isolation medium thickness in plate is not less than 4 millimeters;Plate is not required to close
Envelope keeps ventilative.
In a specific embodiment, the culture is placed in constant incubator, and 28~30 DEG C are cultivated 2~3 days.
In a specific embodiment, the water droplet containing 15-30% glycerol is dripped on glass slide, by the white of picking
The translucent aerial hyphae of color is scattered in water droplet, and with micro- sem observation, by rule of thumb or software determines whether sickle-like bacteria.
In a specific embodiment, the kind of sickle-like bacteria is further determined that by fungal molecule identification method.Tool
For body, picking white translucent aerial hyphae is inoculated in after fungi liquid culture medium further cultivates, and carries out ITS sequence amplification
Sequencing.
A kind of culture medium for the quick separating detection of sickle-like bacteria in sample provided by the invention, in medium component not
Containing any nitrogen source, contain by mass percentage: 0.4%-1% carbon source, 1.5-2% agar powder, 0.15-0.3%K2HPO4, 0.1-
0.3%MgSO4, 0.1-0.3%CaCl2, 0.3-0.5%CaCO3, pH 6.5-7;The carbon source is sucrose, glucose, D- gala
One or more of sugar, arabinose and mannitol.
The method of the present invention is applicable to detect the sickle-like bacteria in the less sample of no sickle-like bacteria illness, thallus content, different
It surely is the material with obvious fusaridiosis;Detection sensitivity is high.
It examines through many experiments, can reach using the accuracy rate containing sickle-like bacteria in the method for the present invention separation detection sample
100%;It is even lower that Monitoring lower-cut reaches 10 living cells/g;Separation detection can be completed within 2-3 days.
Compared to 1. in the detection technique of polymerase chain reaction (PCR), the present invention has the advantages that detection sensitivity is significant
It improves;The detection cycle time is ideal, more economical real without other workloads during cultivating in addition to simple film-making observation
With.
Compared to 2. based on the detection technique of antibody, the present invention can be improved the detection sensitivity of sickle-like bacteria, reduce testing cost.
Compared to the detection method 4. based on sickle-like bacteria separation, the present invention, can be significant other than 4. possessed economy
Other fungal contaminations are reduced, the selective mechanisms period greatly shortens, and significantly improves working efficiency.
To sum up, the method for the present invention, which can be realized, carries out economic, easy and quick separating detection to the sickle-like bacteria in all kinds of samples
Purpose.This method more wide spectrum, detection sensitivity is higher, the period is shorter, cost is lower.It is remarkably improved the detection effect of sickle-like bacteria
Rate.Present invention can apply to sickle-like bacteria quarantine, the detection of seed sickle-like bacteria and the detections of grain sickle-like bacteria etc. in customs quarantine control.
Detailed description of the invention
Fig. 1 is the separation situation comparison of maize seed glutinous 2000 in embodiment one;
Fig. 2 is the separation situation comparison of corn stigma in embodiment one;
Fig. 3 is the doubtful sickle-like bacteria that microscope is observed in embodiment one;
Fig. 4 PCR detects sample DNA and EF1- α gene PCR gel electrophoresis in comparative test.
Specific embodiment
In a specific embodiment of the invention, the method for quickly separating and detecting of sickle-like bacteria includes following step in sample
It is rapid:
1) sample treatment
Sample is without limitation, the less sample of no sickle-like bacteria illness, the thallus content of can having drawn from, such as the corn that has drawn from
Kind, corn stigma, wild rice stem etc..
Fluid sample can be directly used for applying ware;Solid sample then takes 0.5-1g, adds appropriate amounts of sterilized water, aseptically grinds
Juice is taken to apply ware after mill.
2) preparation of isolation medium
Isolation medium: carbon source containing 0.4%-1%, 1.5-2% agar powder by mass percentage, 0.15-0.3%
K2HPO4, 0.1-0.3%MgSO4, 0.1-0.3%CaCl2, 0.3-0.5%CaCO3, pH 6.5-7, without any nitrogen source.It is described
Carbon source is one or more of sucrose, glucose, D- galactolipin, arabinose and mannitol.
It is autoclaved after the culture medium bottling sealing of configuration.The culture medium to have sterilized can immediately using or put
It sets stand-by.Culture medium falls to be added before ware one or more antibiotic of the inhibition bacterial growth of debita spissitudo, in preferred culture medium
Every kind of antibiotic concentration is 100 mcg/mls or so.The culture medium thickness poured into plate is not less than 4mm.
3) ware culture is applied
50-200 microlitres of sample liquids is taken in being coated in above-mentioned isolation medium plate, not sealed to keep ventilative.
Then plate back-off is placed in constant incubator, 28~30 DEG C are cultivated 2~3 days.
4) picking white translucent aerial hyphae microexamination
Miscellaneous bacteria is very rare in cultured plate.Upper water droplet of the drop containing 15-30% glycerol is dripped on glass slide;
(on culture medium of the present invention there is this from picking white translucent aerial hyphae in single colonie in plate with sterile, tapering utensil
The mycelia of feature is generally sickle-like bacteria), it is scattered on slide glass water droplet and can be used to microexamination detection.It can be with experimenter
Sickle-like bacteria differentiating forms experience to determine whether sickle-like bacteria, or utilize " sickle-like bacteria Micrograph image processing and identifying system "
(Wang Guobin sickle-like bacteria Micrograph image processing and identifying system exploitation [D] Agricultural University Of Hebei, 2010;Guo Ling, Zhao Yan, Liu Yong
Good fortune waits research and development [J] agricultural research of sickle-like bacteria image identification system, 2011,33 (07): 122-124.) etc. it is soft
The judgement of part progress sickle-like bacteria.So far, the sickle-like bacteria quick separating detection work in sample is completed.
The artificial experience or software judgment method of micro- sem observation are all reliable judgment modes;But it can also be eventually by true
Bacterium molecule identification method, such as ITS, 18S and 28S DNA sequence dna sequencing etc. further determine that.
If 5) be used for other research work with the above-mentioned sickle-like bacteria being separated to
The white translucent aerial hyphae in picking single colonie is only needed to be inoculated in common fungi liquid culture medium further
Culture.
The step can use common fungi liquid culture medium, or (be not added with above-mentioned liquid separation culture medium
Agar, other components and proportion are identical as step 2).
6) bacterial strain is identified
In order to prove above-mentioned the 4) step it is isolated whether be sickle-like bacteria, picking mycelia through the 5) step culture extract DNA
Afterwards, ITS sequence amplification sequencing is carried out.Fungi ITS sequence primer is ITS1 and ITS4 (ITS 1:5'-TCCG TAGG
TGAA CCTG CGG-3 ', ITS 4:5'-TCCT CCGC TTAT TGAT ATGC-3 ').
One sickle-like bacteria separation detection optimization experiment of embodiment
Several solid mediums are configured, it is spare after high pressure-temperature sterilizing.Several medium component contents are respectively as follows:
1. PPA:D- galactolipin 1%, peptone 0.5%, KH2PO40.1%, MgSO40.05%, agar powder 2%, pH value
6.8;Pentachloronitrobenzene (PCNB), which is added, in the when of falling plate makes its final concentration of 150 mcg/ml, and streptomysin and cephalosporin is added
Final concentration is respectively 100 mg/mls.
2. PDA:200g peeled potatoes are to boil water to cross filtered juice about 800ml, add 20g glucose, 20 agar powders, natural ph,
Pure water is added to be settled to 1L;Streptomysin is added in the when of falling plate and cephalosporin final concentration is respectively 100 mg/mls.
3. isolation medium of the invention: 1% sucrose, 1.7% agar powder, 0.2%K2HPO4, 0.25%MgSO4,
0.25%CaCl2, 0.4%CaCO3, pH value 7.0;The when of falling plate be added streptomysin and cephalosporin final concentration be respectively 100 milligrams/
Milliliter.
Mortar toasts 2 hours through 110 DEG C, and after being cooled to room temperature, addition 3ml sterile water has enough liquid after grinding sample
Body;Weighing about 0.5g maize seed respectively, " glutinous 2000 " (buying from market) and 0.5 corn stigma (from Changsha field), are respectively put into and grind
It smashs to pieces, stir evenly in alms bowl.It respectively draws 200 microlitres of aqueous to be respectively coated in above-mentioned 1. -3. three kind of culture medium, covers plate lid
Open-ended after son, back-off plate, which is placed in 28 DEG C of incubators, to be cultivated 3 days.
Picking aerial hyphae is scattered in containing in 15% glycerol water droplet, under the microscope microscopy.
As a result " the separation situation such as Fig. 1 of glutinous 2000 ": being covered with by other moulds 1 maize seed quickly in PDA culture medium, several
Entire culture dish is covered, a few individual bacterium colony is through micro- sem observation, the bacterium colony of no sickle-like bacteria feature.PPA culture medium
In have 16 filamentous fungi bacterium colonies, have 1 doubtful sickle-like bacteria bacterium colony through sediments microscope inspection.In " separation " culture medium of the invention
In, only 3 bacterium colonies with sparse white translucent aerial hyphae (since background is white culture medium, do not see bacterium on figure
It falls, but can visually see in real sample);It is doubtful sickle-like bacteria through microexamination 3.
As a result the separation situation such as Fig. 2 of 2 corn stigmas: covering is covered with by a large amount of fungies in PDA culture dish, list can not be chosen
Bacterium colony;The mycelia for attempting picking 10 different bacterium colonies, through micro- sem observation without doubtful sickle-like bacteria.Have in PPA culture dish big
Fungi single colonie is measured, wherein filamentous fungi bacterium colony there are 69, through micro- sem observation, there are 2 doubtful sickle-like bacteria bacterium colonies.In the present invention
" separation " culture medium in, 5 have a sparse white translucent aerial hyphae bacterium colony (since background is white culture medium, figure
On do not see the bacterium colony of sparse white translucent aerial hyphae), be doubtful sickle-like bacteria through micro- sem observation.
To maize seed, " the separation statistical conditions of glutinous 2000 " and corn stigma such as table 1, from " success rate ", the present invention is dividing
It is significantly improved from upper success rate is detected, success rate is up to 100% in our many experiments.In terms of screening process, common PDA
The various fungal contaminations of fungi culture medium are very serious, it is difficult to isolate sickle-like bacteria;And although PPA has a part screening effect, but
To, there are still more serious living contaminants, separative efficiency is still lower in the screening process of different materials sieve;It is and existing in terms of result
Technology is compared, the present invention can the inhibition of high degree other Mycophyta miscellaneous bacterias, quick separating detects sickle-like bacteria.
The case where 1 two kinds of materials of table separate sickle-like bacteria in different medium
Table note: success rate=sickle-like bacteria clump count/filamentous fungi clump count × 100%.
From maize seed " doubtful sickle-like bacteria such as Fig. 3 a in the filamentous fungi that glutinous 2000 " are separated to.Liquid through isolation medium
Body culture medium extracts DNA after expanding culture, with fungi ITS1, ITS4 primer (ITS 1:5'-TCCG TAGG TGAA CCTG
CGG-3 ', ITS 4:5'-TCCT CCGC TTAT TGAT ATGC-3 ') carry out PCR amplification after be sequenced.Sequencing result is in NCBI
Upper Blastn is compared, and the similitude with Fusarium verticillioides is 99%, it was demonstrated that the bacterium being separated to is exactly sickle
Knife bacterium.
The sequence obtained, which is sequenced, is
>ITS Fusarium verticillioides
CTCCCAACCCCTGTGACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGC
CCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAA
CGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT
CATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCA
AGCCCAGCTTGGTGTTGGGACTCGCGAGTCAAATCGCGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTTCCATAG
CGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGG
ATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATA
From such as Fig. 3 b of the doubtful sickle-like bacteria in the filamentous fungi being separated in corn stigma.Through fungi ITS1, ITS4 primer into
Blastn is compared on NCBI after row amplification, and as a result the similitude with Fusarium proliferatum strain H10 is
100%, it was demonstrated that being separated to is also sickle-like bacteria.
The sequence obtained, which is sequenced, is
>ITS Fusarium proliferatum strain H10
AACCCCTGTGACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCC
AGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGAT
CTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCG
AATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCC
CCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTT
CCATTGCGTAGTAGTAAAACCCTCGCAACTGGTACGCGGCGCGGCCAAGCCGTTAAACCCCCAACTTCTGAATGTTG
ACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA
It is tested as a comparison with PCR detection technique
Whether to verify the detection method of PCR suitable for maize seed " the sickle-like bacteria detection glutinous 2000 " and corn stigma.Point
Indescribably take " glutinous 2000 ", corn stigma (experiment with above " embodiment one " is to sample with a batch) and Fusarium after purification
The sample total DNA of verticillioides and Fusarium proliferatum.According to sickle-like bacteria EF1- α gene
The pair of primers EF1- α F:5 '-of (Translation Elongation Factor 1-alpha gene) homologous sequence design
ATGGGTAAGGAGGACAAGACTCAC-3 ' and EF1- α R:5 '-GAGCGACAACATACCAATGACGG-3 ', to sample DNA into
Row PCR amplification, through 1% agarose gel electrophoresis testing result such as Fig. 4.
The genomic DNA of 4 samples has extracted success in Fig. 4, but the DNA is used to carry out EF1- α gene as pcr template
When fragment amplification, only the DNA profiling of F.verticillioides and F.proliferatum sample can amplify purpose band,
And maize seed glutinous 2000 and corn stigma sample can not amplify purpose band.Therefore, contrast and experiment further illustrates: in purpose
It is not sensitive enough by the detection method of based on PCR technology in the less sample of cell (sickle-like bacteria) content, it can not detect
The a small amount of sickle-like bacteria contained in sample;And method of the invention can go out the very low sickle-like bacteria of content with separation detection.
Sickle-like bacteria in two separation detection wild rice stem of embodiment
The embodiment place different from embodiment one is: the wild rice stem bought from food market is as material;It only prepares and divides
Two kinds of culture mediums of solid and liquid from culture medium, component content are as follows: (fluid nutrient medium is or not 0.5% mannitol, 2% agar powder
Add agar powder), 0.3%K2HPO4, 0.1%MgSO4, 0.1%CaCl2, 0.5%CaCO3, pH value 6.5.
It turns out the white translucent mycelia come and is tentatively judged as sickle-like bacteria through micro- sem observation.Through separating fluid nutrient medium
Further expansion culture is sequenced after extracting DNA with fungi ITS1 and ITS4 primer amplification;The sequence of sequencing carries out on NCBI
Blastn is compared, and as a result has 100% similitude with Fusarium chlamydosporum strain NZD-mf112.So far
It there is no the relevant report for being reported in and sickle-like bacteria being separated or detected in wild rice stem, this example demonstrates that the present invention can be widely applied to
The separation identification of sickle-like bacteria in various samples!
>ITS Fusarium chlamydosporum
CTCCCAACCCCTGTGACATACCTATACGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGG
CCCGCCCGAGGACCCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTAAAACAAACAAATAAATCAAAACTTTCAACA
ACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAA
TCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTC
AAGCTCAGCTTGGTGTTGGGACTCGCGGTAACCCGCGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTTCCATAGC
GTAGTAATCATACACCTCGTTACTGGTAATCGTCGCGGCCACGCCGTAAAACCCCAACTTCTGAATGTTGACCTCGG
ATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA
As can be seen that quick separating that can be highly sensitive, inexpensive of the invention detects various samples from above-described embodiment
In sickle-like bacteria.
Claims (8)
1. the method for quickly separating and detecting of sickle-like bacteria in a kind of sample, characterized by comprising:
Sample is coated on isolation medium and is cultivated, it is described to be separately cultured in based component without any nitrogen source, by quality percentage
Than containing: 0.4%-1% carbon source, 1.5-2% agar powder, 0.15-0.3% K2HPO4, 0.1-0.3% MgSO4, 0.1-0.3% CaCl2,
0.3-0.5% CaCO3, pH 6.5-7;Also contain the antibiotic that bacterium can be inhibited without inhibiting fungi in the culture medium;The carbon
Source is one or more of sucrose, glucose, D- galactolipin, arabinose and mannitol;
Picking white translucent aerial hyphae, microexamination judge whether according to cell morphological characteristic from single colonie after culture is good
For sickle-like bacteria;
It is described that bacterium can be inhibited without inhibiting the antibiotic of fungi for streptomysin and/or cephalosporin.
2. the method for quickly separating and detecting of sickle-like bacteria in sample according to claim 1, it is characterised in that the sample takes
From maize seed, corn stigma or wild rice stem.
3. the method for quickly separating and detecting of sickle-like bacteria in sample according to claim 1 or 2, it is characterised in that in plate
Isolation medium thickness is not less than 4 millimeters;Plate is not required to seal, and keeps ventilative.
4. the method for quickly separating and detecting of sickle-like bacteria in sample according to claim 1 or 2, it is characterised in that the culture
It is placed in constant incubator, 28 ~ 30 DEG C are cultivated 2 ~ 3 days.
5. the method for quickly separating and detecting of sickle-like bacteria in sample according to claim 1, it is characterised in that on glass slide
Water droplet containing 15-30% glycerol in drop disperses the white translucent aerial hyphae of picking in water droplet, with micro- sem observation,
By rule of thumb or software determines whether sickle-like bacteria.
6. according to claim 1 or 5 in sample sickle-like bacteria method for quickly separating and detecting, it is characterised in that pass through fungi
Method for identifying molecules further determines that the kind of sickle-like bacteria.
7. the method for quickly separating and detecting of sickle-like bacteria in sample according to claim 6, it is characterised in that picking white half
Transparent aerial hyphae is inoculated in after fungi liquid culture medium further cultivates, and carries out ITS sequence amplification sequencing.
8. a kind of culture medium for the quick separating detection of sickle-like bacteria in sample, it is characterised in that be free of and appoint in medium component
What nitrogen source, contains: 0.4%-1% carbon source, 1.5-2% agar powder, 0.15-0.3% K by mass percentage2HPO4, 0.1-0.3%
MgSO4, 0.1-0.3% CaCl2, 0.3-0.5% CaCO3, pH 6.5-7;The carbon source be sucrose, glucose, D- galactolipin, Ah
Draw one or more of uncle's sugar and mannitol;
Also contain the antibiotic that bacterium can be inhibited without inhibiting fungi in the culture medium.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610618080.6A CN106011220B (en) | 2016-07-29 | 2016-07-29 | The method for quickly separating and detecting and used medium of sickle-like bacteria in a kind of sample |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610618080.6A CN106011220B (en) | 2016-07-29 | 2016-07-29 | The method for quickly separating and detecting and used medium of sickle-like bacteria in a kind of sample |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106011220A CN106011220A (en) | 2016-10-12 |
CN106011220B true CN106011220B (en) | 2019-06-07 |
Family
ID=57115236
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610618080.6A Active CN106011220B (en) | 2016-07-29 | 2016-07-29 | The method for quickly separating and detecting and used medium of sickle-like bacteria in a kind of sample |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106011220B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106636401A (en) * | 2016-12-22 | 2017-05-10 | 福建省农业科学院植物保护研究所 | Anoectochilus roxburghii stalk rot pathogen molecular detection primers and detection method thereof |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6761899B1 (en) * | 1998-10-05 | 2004-07-13 | Pennfield Oil Company | Particulate animal feed supplements and processes for the preparation thereof |
CN103074238A (en) * | 2013-02-08 | 2013-05-01 | 云南省农业科学院花卉研究所 | Method for separating fusarium oxysporum from soil |
-
2016
- 2016-07-29 CN CN201610618080.6A patent/CN106011220B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN106011220A (en) | 2016-10-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Niessen et al. | Detection of Fusarium graminearum DNA using a loop-mediated isothermal amplification (LAMP) assay | |
Luo et al. | Development and application of a loop-mediated isothermal amplification assay for rapid identification of aflatoxigenic molds and their detection in food samples | |
Niessen et al. | ATP citrate lyase 1 (acl1) gene-based loop-mediated amplification assay for the detection of the Fusarium tricinctum species complex in pure cultures and in cereal samples | |
Hussain et al. | A quantitative Real Time PCR based method for the detection of Phytophthora infestans causing Late blight of potato, in infested soil | |
EP2712923B1 (en) | Method of detecting heat-resistant fungi | |
US20110201085A1 (en) | Nucleic acid extraction from complex matrices | |
Dung et al. | Morphological and genetic characteristics of Oyster mushrooms and conditions effecting on its spawn growing. | |
Houbraken et al. | Induction of the sexual cycle in filamentous ascomycetes | |
Ahmad et al. | Detection of Aspergillus flavus and Aspergillus parasiticus from aflatoxin-contaminated peanuts and their differentiation using PCR-RFLP | |
Vogt et al. | Detection of penicllium oxalicum in grapes with a loop-mediated isothermal amplification (LAMP) assay | |
CN104593502A (en) | Loop-mediated isothermal amplification primer composition capable of detecting colletotrichum truncatum and application thereof | |
CN106755339B (en) | Cucumber anthracnose LAMP detection primer and its application | |
CN108285927A (en) | Molecular labeling Caps7 and its application in a kind of gene of rice Cd accumulation related gene OsHMA3 | |
WO2006123423A1 (en) | Primer for detecting fungus of the genus fusarium | |
CN108624655A (en) | Real-time fluorescence L AMP detection method and kit for potato late blight bacteria | |
CN106011220B (en) | The method for quickly separating and detecting and used medium of sickle-like bacteria in a kind of sample | |
CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
CN1312475C (en) | Molecular detection method for fusarium toxin | |
Pallez et al. | Validation of a quick PCR method suitable for direct sequencing: identification of Fusarium fungal species and chemotypes for preventive approaches in food safety | |
CN109868329B (en) | Screening, quarantine and identification method of colletotrichum specific primers | |
CN114395617B (en) | LAMP (loop-mediated isothermal amplification) visual rapid detection method and application of powdery mildew of strawberry | |
JP2014003946A (en) | Method for detecting thermoascus fungus | |
WO2003068988A1 (en) | A method of pcr based detection and identification of rice blast fungus magnaporthe grisea | |
CN106085880B (en) | A kind of separation method and used medium of smut | |
CN105567726B (en) | A kind of construction method of the knockout mutations body bacterial strain of high yield deoxynivalenol |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |