CN105985972A - Isoprene synthase gene and application thereof - Google Patents

Abstract

The invention relates to an isoprene synthase gene and an application thereof, in order to solve the technical problem that the synthesis of isoprene, with the adoption of engineering bacteria, is not high in efficiency. The invention provides the isoprene synthase gene, protein expressed by the isoprene synthase gene, a prokaryotic expression vector and an engineering bacterium containing the isoprene synthase gene as well as a preparation method for producing the isoprene engineering bacterium and an application of the isoprene engineering bacterium. The isoprene synthase gene disclosed by the invention can be widely applied to the field of preparing the isoprene.

Description

Isoprenoid synthase gene and application thereof

Technical field

The present invention relates to gene engineering technology field, particularly to a kind of isoprenoid synthase gene And application.

Background technology

In nature, isoprene is mainly emitted in air by certain plants blade, and work During industry produces, current isoprene is mainly by petroleum cracking thing C 5 fraction extractive distillation.So And along with petroleum resources are the most exhausted and non-renewable, the isoprene of natural plants release is collected again Getting half the result with twice the effort, producing isoprene by microbial engineering bacteria becomes the certainty of a kind of sustainable development Trend.

It is reported, the isoprene in annual Plant emission to air reaches 5,000,000 tons, and antibacterial is certainly Body does not the most have isoprenoid synthase gene, and therefore plant is isoprenoid synthase (ISPS) Source very well.Technique for gene engineering is utilized to carry out isoprenoid synthase gene studies achieved with one A little progress, research worker isolation identification has obtained a small amount of isoprenoid synthase gene, but domestic Not yet there is the report of this respect.

2000, Miller B obtained total length IspS first in willow (Cortex Populi dividianae × quaking aspen) Gene, and in escherichia coli, obtained isoprene (the Miller B et of 7.7nmol/mgDCW al.Planta.2001 213(3):483-7)；2005, Sasaki clone obtained Cortex Populi dividianae IspS gene (Sasaki K et al.FEBS Lett.2005 579 (11): 2514-8)；Thomas D.Sharkey obtains Montana Pueraria lobota IspS cDNA total length (Sharkey TD et in clone in 2005 Al.Plant Physiol.2005 137 (2): 700-12.), expand the most again several Salicaceae IspS gene, and obtained Robinia pseudoacacia L. IspS cDNA full length sequence (Sharkey TD et al, Evolution 2013 67(4):1026-1040)。

The most currently acquired visible isoprenoid synthase is mostly limited to Salicaceae and pulse family is planted Thing, leguminous plant is concentrated mainly on Radix Puerariae, Robinia pseudoacacia L. about the research of isoprenoid synthase gene, The correlational study of Salicaceae is concentrated mainly on Populus, and there is no research report in Fagaceae Quercus liaotungensis, Gene bank does not has Quercus liaotungensis isoprenoid synthase gene yet.

Summary of the invention

The technology that the present invention is contemplated to solve utilizing works bacterium synthesis isoprene inefficient is asked Topic, it is provided that a kind of isoprenoid synthase gene with higher combined coefficient and application.

For reaching above-mentioned purpose, a kind of isoprenoid synthase gene, it is following (a) or (b) Gene: the nucleotide sequence of (a) described gene cDNA is as shown in the sequence 1 of sequence table；(b) Described gene is the gene encoding following protein: the aminoacid sequence shown in sequence 2 of sequence table Middle through replacing, lack or add one or several aminoacid and there is isoprenoid synthase activity The sequence 2 by sequence table shown in the protein of protein derived that forms of aminoacid sequence.

Present invention simultaneously provides the protein of a kind of isoprenoid synthase gene expression, it is as follows The protein of (a) or (b): (a) is made up of the aminoacid sequence shown in the sequence 2 of sequence table Protein；In (b) aminoacid sequence in (a) through replacement, lack or add one or Several aminoacid and have isoprenoid synthase activity the protein derivative by (a)；Sequence table The aminoacid sequence shown in sequence 2 composition protein be by base shown in the sequence 1 of sequence table Sequential coding.

The present invention also provides for the prokaryotic expression carrier of a kind of isoprenoid synthase gene.

The present invention also provides for the product isoprene engineering of isoprenoid synthase prokaryotic expression vector Bacterium.

Present invention simultaneously provides product isoprene engineering bacteria application in preparing isoprene.

Beneficial effects of the present invention: according to plant in the rate of release of nature isoprene, this Bright have selected the higher Quercus liaotungensis isoprenoid synthase gene of burst size carried out isolation identification and gram Grand, successfully build isoprene produce bacterial strain, for bioanalysis produce isoprene search out one high The isoprenoid synthase of effect.The present invention utilizes genetic engineering means, clone to obtain Quercus liaotungensis base Because of QlIspS, being applied in escherichia coli, use gas chromatogram to detect, escherichia coli possess Producing the ability of isoprene, the present invention carries out isoprene large-scale industry for using microorganism Production provides an enzyme the most effective.

Accompanying drawing explanation

Fig. 1 is the sepharose electrophoresis result of Quercus liaotungensis total serum IgE；

Fig. 2 is the sepharose electrophoresis result of Quercus liaotungensis QlIspS gene 3 '-RACE；

Fig. 3 is the sepharose electrophoresis result of Quercus liaotungensis QlIspS gene 5 '-RACE；

Fig. 4 is Quercus liaotungensis QLISPS aminoacid sequence BlastP analysis result figure；

Fig. 5 is RACE schematic diagram；

Fig. 6 is the Quercus liaotungensis QLISPS albumen SDS-PAGE result at expression in escherichia coli；

Fig. 7 is the gas chromatograph results of isoprene standard substance；

Fig. 8 is the vapor detection result that Quercus liaotungensis QlIspS gene is applied in escherichia coli；

Fig. 9 is the gas that Quercus liaotungensis QLISPS albumen is applied after replacing sudden change in escherichia coli Phase testing result；

Figure 10 is that Quercus liaotungensis QLISPS albumen is applied after adding sudden change in escherichia coli Vapor detection result；

Figure 11 is that Quercus liaotungensis QLISPS albumen is applied after deletion mutation in escherichia coli Vapor detection result.

Detailed description of the invention

Below in conjunction with detailed description of the invention, the present invention is further described in detail, the reality be given Execute example only for illustrating the present invention rather than in order to limit the scope of the present invention.In following embodiment Experimental technique, if no special instructions, be conventional method.Material used in following embodiment, Reagent etc., if no special instructions, the most commercially obtain.

In following embodiment, escherichia coli BW25113 (Baba T et al.Mol Syst Biol. 2006；Being 2:2006.0008.) strain nonpathogenic bacteria, genetic background understands, generation time is short, hold Easily cultivate and culture medium raw material is cheap.The escherichia coli BW25113 public can be from the micro-life of the Chinese Academy of Sciences Thing institute obtain, the above biomaterial only attach most importance to duplicate invention related experiment used by, no Can use as other purposes.

The preparation of embodiment 1:RACE-Ready cDNA

1. extract Leaves of Quercus Liaotungensis total serum IgE

Gather Leaves of Quercus Liaotungensis, use RNeasy Plant Mini Kit (Qiagen company) to carry Take poplar leaf total serum IgE, carry out according to test kit illustration method, carry out electrophoresis (Fig. 1) checking RNA Extract quality, it is seen that RNA integrity is good, can carry out subsequent experimental.

The preparation of 2.RACE-Ready cDNA

The method obtaining cDNA total length is SMARTer-RACE, usesPCR cDNA Synthesis Kit (Clontech company) is carried out, and primer used below and reagent are except GSP It isThere is provided in PCR cDNA Synthesis Kit, according to test kit illustration method Carry out.

The reverse transcription system of RACE-Ready cDNA the first chain is as follows:

3. the design of gene-specific primer:

According to Salicaceae and the conserved region of fabaceous known amino acid sequence, with reference to all known The nucleotide sequence of IspS and the nucleotide sequence of monoterpene synzyme, and the summer obtained with reference to the present inventor Rubber IspS sequential design gene-specific primer (GSP), RACE-Ready cDNA is masterplate, GSP And universal primer (Universal Primer Mix, UPM) does primer and expands, can obtain 3 '-RACE cDNA fragments and 5 '-RACE cDNA fragment.Primer location is as shown in Figure 5, middle Black part is divided into degenerate pcr to obtain sequence, and both sides black part is divided into universal primer sequence, white portion It is divided into the unknown nucleotide sequence part that needs obtain.

Totally 10 GSP sequences, such as following table:

The acquisition of embodiment 2:QlIspS gene coding region total length

The acquisition of 1.3 '-RACE cDNA end sequences

The 3 '-RACE-Ready cDNA using Quercus liaotungensis are masterplate, UPM with GSP is that primer enters Row amplification

Reaction system:

Reaction condition:

The agarose gel testing result of 3 '-RACE such as figure (Fig. 2):

Obtain a single bright Quercus liaotungensis DNA cloning band, connect carrier T, convert impression State cell, selects positive colony Sanger order-checking, obtains 3 ' end cDNA sequence.

The acquisition of 2.5 '-RACE cDNA end sequences

The 5 '-RACE-Ready cDNA using Quercus liaotungensis are masterplate, UPM with GSP is that primer enters Row amplification.

Reaction system:

Reaction condition:

The agarose gel testing result of 5 '-RACE such as figure (Fig. 3):

Obtain single bright amplified band as seen from the figure, select one to connect carrier T, convert sense By state cell, select positive colony Sanger order-checking, obtain 5 ' end cDNA sequence.

3. the acquisition of full length sequence

According to 3 '-RACE and 5 '-RACE sequencing result, carry out sequence alignment, obtain this gene CDNA full length sequence (sequence shown in SEQ ID No.1), is analyzed DNA, aminoacid sequence: This gene has 1761bp, encodes 586 aminoacid, has ATG initiation codon and TGA to terminate close Numeral, illustrates the integrity of this gene；The aminoacid of its coding contains an IspS high conservative mark Sign sequence D DXXD region, also contains RRX8W conservative region simultaneously.BLAST software is utilized to exist NCBI carries out homology comparison, result such as Fig. 4, shows that this gene is Isoprenoid_Biosyn_C1 Superfamily member, reaches with Fructus Vitis viniferae (Vitis vinifera) isoprenoid synthase homology To 59%；61% homology is had with the isoprenoid synthase of morus notabili (Morus notabilis), With the homology that the β ocimene synzyme of Madagascar bean (Phaseolus lunatus) has 58%, explanation What we obtained is isoprenoid synthase gene, is abbreviated as QlIspS gene, is encoded The aminoacid sequence (sequence shown in SEQ ID No.2) of QLISPS albumen.

Embodiment 3: escherichia coli isoprene produces the structure of bacterial strain

Total length primer QLFa and QLRa sequence are as follows:

QLFa:5'AATTAACCATGGCGAGCAAACAAGTGCTTTCTA 3'

QLRa:5'ATATGGTACCCTAAAGGTGGATCTGGCTGTG 3'

1. coli expression carrier pBAD-QlIspS builds

The QlIspS genetic fragment using primer QLFa and QLRa to obtain is carried out NcoI and KpnI (TAKARA company) double digestion, and by pBAD-HisB expression vector (purchased from Invitrogen Company) carry out NcoI and KpnI double digestion, after QlIspS gene is connected to pBAD-HisB carrier Convert to trans5 α competent cell, choose positive colony and check order, pBAD-QlIspS's Nucleotide sequence is SEQ ID No.5.

2. isoprene produces the structure of bacterial strain MV/pQlIspS

The pBAD-QlIspS built and plasmid p1 and p2 cotransformation are obtained to BW25113 host Bacterial strain MV/pQlIspS is produced to isoprene.

And building control strain MV/pBAD, method is by pBAD-HisB and plasmid p1 and p2 altogether Go to BW25113 host, obtain the control strain MV/pBAD without isoprene synthase gene.

Above-mentioned isoprene produce bacterium construction method in, p1, p2 comprise isoprene route of synthesis- Mevalonic acid (MVA) pathway gene.Wherein p1 is by MvaE (S-acetyl-coenzyme-A Acetylase) Gene, MvaS (HMG-acetyl-CoA-synthetase) gene and MVK (E.C. 2.7.1.36) gene Composition, the albumen that described MvaE gene code is made up of the aminoacid sequence shown in SEQ ID No.8 Matter；The protein that described MvaS gene code is made up of the aminoacid sequence shown in SEQ ID No.9； Described mvk gene encodes the protein being made up of the aminoacid sequence shown in SEQ ID No.10.p2 By PMK (phosphomevalonate kinase) gene, MVD (pyrophosphoric acid mevalonic acid decarboxylase) gene And idi (Isoprenoid isomerase) genomic constitution, described PMK gene code is by SEQ ID The protein of the aminoacid sequence composition shown in No.11；Described MVD gene code is by SEQ ID The protein of the aminoacid sequence composition shown in No.12；Described idi gene code is by SEQ ID The protein of the aminoacid sequence composition shown in No.13.

Wherein, p1 is streptomycin resistance arabinose-inducible expression vector, the nucleotide sequence of p1 It is SEQ ID No.6, comprises MVA upstream pathway expression casette, MVA upstream pathway gene expression The nucleotide sequence of box is the 1307-5821 position of SEQ ID No.6, the of SEQ ID No.6 89-964 position is Arabinose promoter, and the 5930-6087 position of SEQ ID No.6 is that TrrnB is whole Only son, the 1307-3729 position of SEQ ID No.6 is the coded sequence of MvaE gene, SEQ ID The 3730-4904 position of No.6 is the coded sequence of MvaS gene, the of SEQ ID No.6 4905-5821 position is the coded sequence of mvk gene.

P2 is chlorampenicol resistant arabinose-inducible expression vector, and the nucleotide sequence of p2 is SEQ ID No.7, comprises MVA downstream pathway expression casette, the core of MVA downstream pathway expression casette Nucleotide sequence is the 1309-4442 position of SEQ ID No.7, the 89-964 of SEQ ID No.6 Position is Arabinose promoter, and the 4569-4726 position of SEQ ID No.6 is TrrnB terminator, The 1309-2661 position of SEQ ID No.6 is the coded sequence of PMK gene, SEQ ID No.6's 2677-3864 position is the coded sequence of MVD gene, the 3894-4442 position of SEQ ID No.6 It it is the coded sequence of idi gene.

The application in escherichia coli of the embodiment 4:QlIspS gene

1, ISPS protein expression

Above-mentioned colibacillus engineering MV/pQlIspS, after using L-arab induction, protein expression Result SDS-PAGE (Fig. 6) as shown in the figure, it is seen that the escherichia coli place without isoprenoid synthase Main itself not expressing isoprenoid synthase ISPS, the proceeding to of QlIspS gene makes host cell expression ISPS albumen.

Remarks: figure is QLISPS albumen expression in colibacillus engineering.

2, the detection of Escherichia coli fermentation product

Being fermented by above-mentioned 2 bacterial strains, method is as follows: by engineering bacteria with centesimal inoculum concentration It is transferred to 30mL (500mL triangular flask) containing streptomycin, chloromycetin and the Arab of ammonia benzyl resistance In sugar self-induction culture medium (ZYM), 30 DEG C, after 280rpm cultivates 20h.4 DEG C, 4000rpm Centrifugal bacterium solution of collecting, resuspended to 60OD cell concentration by the M9 culture medium containing 4% glucose, take The resuspended bacterium solution of 1mL is placed in 20mL ml headspace bottle, 37 DEG C, and 30h is cultivated in 280rpm concussion.

Self-induction culture medium self-induction culture medium ZYM formula containing streptomycin, chloromycetin and ammonia benzyl As follows: 100mL A+2mL B+2mL C+200 μ L D+100 μ L E (is percent mass below Specific concentration)；

A.ZY:1% tryptone, 0.5% yeast powder；

B.50 × M:1.25M Na2HPO4,1.25M KH2PO4,2.5M NH4Cl and 0.25M Na2SO4；

C.50 × 5052:25% glycerol, 2.5% glucose, 10% lactose；

D.1M MgSO4；

E.1000 × trace element: 50Mm FeCl3,20mM CaCl2,10mM MnCl2,10mM ZnSO4, The each 2mM of CoCl2, NiCl2, Na2Mo4, Na2SeO3 and H3BO3；

Streptomycin: final concentration 50mg/L, chloromycetin final concentration 34mg/L, ammonia benzyl final concentration 100mg/L.

M9 culture medium prescription such as Molecular Cloning: A Laboratory guide (Science Press) third edition page 1595 institutes Show.

After reaction terminates, carrying out gas chromatogram (GC) and analyze, the gas chromatographicanalyzer of use is Agilent 7890A GC Sysytem and Agilent7697A headspace Sampler head space enter Sample device, gas phase detached dowel is HP-5.Head-space sampling method is as follows, Time:GC cycle time 20min, Vial equib time 6min；Temperature (DEG C): Oven 51, Loop/Valve 55, Transfer line 60.GC method is as follows: flow velocity: 2mL/min, 0min～4min 50 DEG C, 4min～8.5min 50～280 DEG C, 8.5min～10.6min 280 DEG C.

Under the method, isoprene standard substance (Sigma company) appearance time is 1.75min (Fig. 7), The GC chromatogram (Fig. 8) of colibacillus engineering MV/pQlIspS and negative control bacterial strain MV/pBAD, Visible MV/pQlIspS is at the reservation peak of 1.75min, and compares and do not have.Visible do not add QlIspS The bacterial strain of gene does not possess isoprene production capacity, makes escherichia coli after proceeding to QlIspS gene Having possessed the ability producing isoprene, in escherichia coli, yield is up to 11.74mg/L.

Embodiment 5: through the application in escherichia coli of the QLISPS albumen of amino acid mutation

QLISPS albumen is replaced, adds and deletion mutation, use embodiment 3 to build PBAD-QlIspS is masterplate, according to Fast Mutagenesis System (TransGen company) Test kit explanation suddenlys change.

1, the amino acid mutation of QLISPS albumen

Amino acid whose replacement, suddenlys change: 33 amino acids T are sported A, will nucleotide sequence 97-99 The ACA of position sports GCA, and using mutant primer is 1F and 1R；

Amino acid whose interpolation suddenlys change: a 33 amino acids T aminoacid A added behind, Ji Jianghe Adding GCG base after acid sequence 99, the mutant primer of use is 2F and 2R；

Amino acid whose deletion mutation: 33 amino acids T removed, will nucleotide sequence 97-99 position Base ACA is removed, and the mutant primer of use is 3F and 3R.

Mutant primer sequence is as follows:

Numbering	Sequence
		1F	GCAAACAAGTGCTTTCTAATGCAGCAACTGAAAGGCAG
1R	GCATTAGAAAGCACTTGTTTGCTC
		2F	GAGCAAACAAGTGCTTTCTAATACAGCGGCAACTGAAAGGCAGTCGGCC
2R	GGCCGACTGCCTTTCAGTTGCCGCTGTATTAGAAAGCACTTGTTTGCTC
		3F	GAGCAAACAAGTGCTTTCTAATGCAACTGAAAGGCAGTCGGCC
3R	GGCCGACTGCCTTTCAGTTGCATTAGAAAGCACTTGTTTGCTC

Remarks: having underscore base is mutating alkali yl

PCR system

PCR condition

Electrophoresis detection

Take 10 μ l PCR primer, 1% agarose gel electrophoresis detection.

Observe that purpose stripe size is correct, available DMT enzymic digestion and conversion reaction.

The digestion of PCR primer

Add 1 μ l DMT enzyme in PCR primer, mixing, hatch 1h for 37 DEG C.

Convert

A. add 2-5 μ l DMT enzymic digestion product in 50 μ l DMT competent cells ( Product is added when competent cell just thaws), flick mixing, ice bath 30 minutes.

B.42 DEG C accurate heat shock 45 seconds, are immediately placed on 2min on ice.

C. add 250 μ l and balance the SOC to room temperature, 225 turns, cultivate 1 hour for 37 DEG C.

D. 200 μ l bacterium solution bed boards are taken, and overnight incubation (for obtain more clone, 4000rpm Centrifugal 1min, discards part supernatant, retains 100-150 μ l, flicks suspension thalline, takes all Bacterium solution coated plate, overnight incubation)

Check mutation efficiency by control plasmid template (4.5Kb), the flat board containing ammonia benzyl is coated with 8 μ l 500mM IPTG, 40 μ l 40mg/mlX-gal, the successful bacterium colony that suddenlys change is blueness.

Select blue colonies and carry out plasmid extraction (Plasmid Mini Kit 1, OMEGA company), Sanger checks order.Obtain correct mutant clon, replace the named pBAD-QlIspSc1 of mutant, Add the named pBAD-QlIspSc2 of mutant, replace the named pBAD-QlIspSc3 of mutant.

2, isoprene produces the structure of bacterial strain MV/pQlIspSc

By the pBAD-QlIspSc1 that builds and plasmid p1 and p2 cotransformation to BW25113 host Obtain isoprene and produce bacterial strain MV/pQlIspSc1；

By the pBAD-QlIspSc2 that builds and plasmid p1 and p2 cotransformation to BW25113 host Obtain isoprene and produce bacterial strain MV/pQlIspSc2；

By the pBAD-QlIspSc3 that builds and plasmid p1 and p2 cotransformation to BW25113 host Obtain isoprene and produce bacterial strain MV/pQlIspSc3.

3, the detection of Escherichia coli fermentation product

Concrete detection method is with method described in embodiment 4.The vapor detection that MV/pQlIspSc1 obtains Result such as Fig. 9, vapor detection result such as Figure 10, MV/pQlIspSc3 that MV/pQlIspSc2 obtains The vapor detection result obtained is as shown in figure 11, it is seen that MV/pQlIspSc1, MV/pQlIspSc2 And MV/pQlIspSc3 bacterial strain is likewise supplied with producing the ability of isoprene, yield respectively reaches 11.58mg/L, 12.46mg/L and 11.36mg/L.

Claims (5)

1. an isoprenoid synthase gene, is characterized in that the gene of following (a) or (b):

A the nucleotide sequence of () described gene cDNA is as shown in the sequence 1 of sequence table；

B () described gene is the gene encoding following protein: the ammonia shown in sequence 2 of sequence table Through replacing, lack or add one or several aminoacid and there is isoprene conjunction in base acid sequence The albumen of the protein derived that aminoacid sequence shown in the sequence 2 by sequence table of one-tenth enzymatic activity forms Matter.

2. the protein of isoprenoid synthase gene expression as claimed in claim 1, its feature It is the protein of following (a) or (b):

A protein that () is made up of the aminoacid sequence shown in the sequence 2 of sequence table；

Through replacing, lacking or add one or several in (b) aminoacid sequence in (a) Aminoacid and have isoprenoid synthase activity the protein derivative by (a)；

The protein of the composition of the aminoacid sequence shown in sequence 2 of described sequence table is by sequence table Base sequence shown in sequence 1 encodes.

3. the prokaryotic expression carrier containing isoprenoid synthase gene as claimed in claim 1.

4. one kind contains isoprenoid synthase prokaryotic expression vector as claimed in claim 3 Produce isoprene engineering bacteria.

5. product as claimed in claim 4 isoprene engineering bacteria application in preparing isoprene.