CN105969871B - Rice aspergillus PCR detection primer and application thereof - Google Patents
Rice aspergillus PCR detection primer and application thereof Download PDFInfo
- Publication number
- CN105969871B CN105969871B CN201610409325.4A CN201610409325A CN105969871B CN 105969871 B CN105969871 B CN 105969871B CN 201610409325 A CN201610409325 A CN 201610409325A CN 105969871 B CN105969871 B CN 105969871B
- Authority
- CN
- China
- Prior art keywords
- rice
- rice aspergillus
- aspergillus
- primer
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses one group of rice aspergillus PCR detection primers, and the present invention searches out the specific detection target of rice aspergillus by comparing the method for genome, and designs detection primer.This has the advantages that special good, stability is strong and high sensitivity compared with traditional rice aspergillus PCR detection primer, control the appearance of false positive well in the detection process, the presence of rice aspergillus can be accurately detected again simultaneously, provide good tool for Fields detection, the research of false smut Disease Cycle and the prediction of the disease etc. of rice aspergillus.
Description
Technical field
The invention belongs to biological fields, and in particular to rice aspergillus PCR detection primer and application thereof.
Background technique
False smut (Rice false smut) is the important rice of one kind as caused by Ustilaginoidea virens
Fungal disease, in the whole world, each rice region has generation.In recent years, with the change of rice calli, rice field nitrogen amount of application
Increase, in addition novel high yield dense cluster type hybrid paddy rice is widely applied, the Major Diseases that false smut has gradually risen as rice.Rice
The large area generation of bent disease not only influences yield and quality of rice, and the rice aspergin generated in rice curve is to the toxic work of people and animals
With seriously affecting grain security.
Research thinks that rice aspergillus is overwintering in soil or invalid body with chlamydospore and sclerotium at present, and sprouting forms mitogenetic
Spore or ascospore infect small ear and filigree in rice booting latter stage, and the rice curve of green is finally formed on rice grain.
Based on the special infection processs of rice aspergillus, occur to carry out early period PCR detection to the infection mechanism for understanding rice aspergillus in depth in disease
And the field prediction of false smut is particularly important.The rice aspergillus specific detection primer being previously reported is all based on rice aspergillus
The region ITS (rDNA internal transcribed spacer) design, and the region ITS between some sibling species fungies has
Higher homology, such as sclerotinite (Sclerotinia sclerotiorum) and Botrytis cinerea (Botrytis
Cinerea there is up to 99% homology in the region ITS), and the region ITS of the fungi of rice aspergillus and some Clavicipitaceaes also has
Up to 85% homology causes the specificity of these primer detections to significantly reduce.Therefore, the new specificity inspection of rice aspergillus is found
Surveying target is particularly important.
The development of bioinformatics and sequencing technologies provides new thinking to find rice aspergillus specific detection target.
BLAST (Basic Local Alignment Search Tool) is a kind of program of the difference between comparison dna sequence, is led to
BLAST comparison is crossed, the comparison between genome can be carried out, filters out rice aspergillus kind internal specific gene as detection target.With
The high speed development of high throughput sequencing technologies, the cost of microorganism genome sequencing and time substantially reduce.Currently, including rice
The full-length genome of many species including aspergillus is sequenced, and is provided data for screening rice aspergillus specific detection target and is supported.
Summary of the invention
It is an object of the invention to overcome Traditional Rice aspergillus PCR specific detection target single, detection primer specificity is not
Strong defect provides a kind of rice aspergillus specificity nest-type PRC detection primer with strong specificity and high sensitivity, and the present invention is also
Provide the purposes of the primer.
In order to reach the goals above, the present invention takes following technical measures:
Rice aspergillus specific detection target sieving and design of primers:
With AUGUSTUS software (Version 2.5.5) (http://augustus.gobics.de/) to rice aspergillus gene
Group carries out predictive genes, obtains the DNA sequence dna and protein sequence of 8231 genes.It constructs one and predicts base comprising 43 species
The database of cause.With BLASTP program by the protein sequence of rice aspergillus predicted gene and building 43 species predicted gene into
The row first round compares, and screening obtains the specific gene of 110 rice aspergillus.Again with BLASTP program by this 110 genes with
The NR database of NCBI carries out the second wheel and compares, and screening obtains the specific gene of 96 rice aspergillus.From what is finally screened
20 genes are randomly selected in 96 rice aspergillus specific genes, and as target according to the design nest-type PRC detection of its DNA sequence dna
Primer.
The verifying of rice aspergillus specificity nest-type PRC detection primer stability, specificity and sensitivity:
In order to verify the stability of target and primer, the rice in national different provinces is isolated from designed primer pair 97
Aspergillus bacterial strain DNA is expanded, and discovery has 19 target genes that can expand to obtain, and has the gene that a number is G192 only
It can expand and arrive on the bacterial strain in 16 Hubei and 4 Shaanxi, therefore give up this target gene.Choose remaining 19 target gene and
Its corresponding primer carries out specificity verification.16 disease fungus being collected into 19 pairs of nest-type PRC primer pairs, 2 pathogenetic bacterias
And the paddy DNA of 2 kinds carries out PCR amplification, can not expand to corresponding purpose band as the result is shown, illustrate these primers
With stronger specificity.Rice aspergillus DNA is subjected to concentration gradient dilution, is expanded respectively with 19 pairs of nest-type PRC detection primers
Increase, number is that can detecte minimum concentration be 1fg/ for the nest-type PRC primer of Uv-1F/Uv-1R, Uv-2F/Uv-2R as the result is shown
The rice aspergillus DNA of μ l.
The application of rice aspergillus specificity nest-type PRC detection primer:
It still can accurately be detected to verify the nest-type PRC detection primer in the hybrid dna sample with high background
To rice aspergillus DNA, with the thallospore mixed liquor of rice aspergillus with PSB culture medium be to impinge upon the rice booting 7-8 phase to fringe packet into
Row injection inoculation.After moisturizing culture 2 days, takes Inoculated Rice fringe portion to extract DNA and carry out PCR detection, discovery is vaccinated with rice aspergillus
Tassel may detect that the presence of rice aspergillus, and control amplification is less than target fragment.Illustrate that the detection primer can mix
The DNA of rice aspergillus is detected in DNA sample.
In field, the rice to boot stage carries out grab sample simultaneously, and rice is divided into root, stem, leaf and fringe and is carried out respectively
DNA is extracted and PCR detection, and discovery root, stem, leaf and fringe may detect that the presence of rice aspergillus.Illustrate that the primer can be used for
Fields detection.
Compared with prior art, the invention has the following advantages that
1. the method by comparing genome searches out the specific detection target of rice aspergillus, and designs detection primer.This
Have the advantages that special good, stability is strong and high sensitivity compared with traditional rice aspergillus PCR detection primer, in the detection process
The appearance of false positive is controlled well, while can be accurately detected the presence of rice aspergillus again, to be the field of rice aspergillus
Detection, the research of false smut Disease Cycle and prediction of the disease etc. provide good tool.
2. providing the scheme of a kind of convenience, efficient pathogen specific PCR detection target sieving, it is only necessary to obtain mesh
Mark pathogen full-length genome or partial genome sequence can complete target sieving, efficiently solve detection target it is single,
The not strong problem of the detection primer specificity of design.
Detailed description of the invention
Wherein swimming lane 1-9: the Detection of Stability glue figure of Fig. 1 primer Uv-1F/Uv-1R, Uv-2F/Uv-2R pick up from Jilin Province
Rice aspergillus bacterial strain, 10-19: pick up from the rice aspergillus bacterial strain in Liaoning Province, 20-23: picking up from the rice aspergillus bacterial strain in Shaanxi Province, 24-27:
The rice aspergillus bacterial strain in Henan Province is picked up from, 28-42: picking up from the rice aspergillus bacterial strain in Hubei Province, 43-51: picking up from the rice aspergillus in Hunan Province
52-59: bacterial strain picks up from the rice aspergillus bacterial strain in Jiangxi Province, 60-71: picking up from the rice aspergillus bacterial strain in Zhejiang Province, 72-82: pick up from Fujian
The rice aspergillus bacterial strain of province, 83-95: picking up from the rice aspergillus bacterial strain of Guangxi province, and 96: the rice aspergillus bacterial strain in Guangdong Province is picked up from, M:
DL500Marker。
The specific detection glue figure of Fig. 2 primer Uv-1F/Uv-1R, Uv-2F/Uv-2R, wherein swimming lane 1-22:
Ustilaginoides virens、Botrytis cinerea、Leptosphaeria biglobosa、Sclerotinia
minor、Sclerotinia trifoliorum、Sclerotinia nivalis、Sclerotinia sclerotiorum、
Rhizoctonia solani、Coniothyrium minitans、Colletotrichum higginsianum、
Beauveria bassiana、Magnaporthe oryzae、Alternaria arborescens、Alternaria
alternata、Phoma enqua、Trichoderma Koningiopsis、Metarhizium anisopliae、
Ralstonia solanacearum, Xanthomonas oryzae, rice evening Xian 98, I in Rice R28, CK, M:
DL1000Marker。
The sensitivity technique glue figure of Fig. 3 primer Uv-1F/Uv-1R, Uv-2F/Uv-2R, wherein swimming lane M:DL1000
Marker；The rice of 1-9:10ng/ μ l, 1ng/ μ l, 100pg/ μ l, 10pg/ μ l, 1pg/ μ l, 100fg/ μ l, 10fg/ μ l, 1fg/ μ l
Aspergillus DNA.
Fig. 4 primer Uv-1F/Uv-1R, Uv-2F/Uv-2R detect spike of rice after inoculation 2 days, wherein swimming lane 1-3: randomly selecting
3 inoculation rice aspergillus spike of rice testing result, swimming lane 4-6: randomly select 3 control spike of rice testing results, swimming lane 7: the positive
Control, swimming lane 8: negative control.
Fig. 5 primer Uv-1F/Uv-1R, Uv-2F/Uv-2R detect field rice root, stem, Ye Hesui, and wherein 1-5 is rice
Sample plant number, M:100bp DNA ladder.
Specific embodiment
Technical solution of the present invention is if not otherwise specified the conventional scheme of this field, agents useful for same or material,
It is if not otherwise specified publicly available.
Embodiment 1
1. the prediction of rice aspergillus full-length genome, specific detection target sieving and design of primers
The prediction of 1.1 rice aspergillus full-length genomes
According to the rice aspergillus sequencing bacterial strain HWD-2 genome (Jia et al., 2015) that sequencing obtains, AUGUSTUS is used
(Version 2.5.5) software carries out rice song by reference model of Fusarium graminearum (Fusarium graminearum) genome
The prediction of bacterium gene.Final forecast analysis rice aspergillus contains 8231 genes, and obtains corresponding DNA sequence dna and protein sequence.
1.2 compare the building of local data base and the screening of rice aspergillus specificity target gene used
In order to reduce the operand of computer, reducing the configuration requirement to computer and save the time, using two numbers
According to library, one is the database (table 1) comprising 43 species predicted protein sequences, the other is the NR database of NCBI, with
BLASTP (version 2.2.28+) carries out two-wheeled comparison.Since NR database contains existing overwhelming majority sequencing species
Gene data, data volume is very big, compares and expends the time very much, so first screening away one with a small local data base
Homeologous sequence, then be compared with NR database, screening obtains specific sequence.
43 species predicted protein sequence buildings local data base (table 1) are downloaded from each database.Due to detection disease
The host of opportunistic pathogen is rice, so wherein including the predicted protein sequence of rice to exclude the influence of false positive；In database
The protein sequence of rice blast fungus (Magnaporthe oryzae) and bacterial leaf spot bacterium (Xanthomonas oryzae) is further comprised, is anticipated
The influence of false positive is caused excluding both common rice pathogens；Also just like sickle-like bacteria (Fusarium in database
Graminearum, Fusarium oxysporum) and smut (Ustilago maydis) etc. and rice aspergillus affiliation compared with
Close bacterium, it is intended in order to screen the specific gene of rice aspergillus to greatest extent.Other bacterium are substantially some normal in database
See or widely distributed species.The protein sequence that rice aspergillus is predicted is compared with this local data base with BLASTP,
If e value is 1E-5, the sequence greater than 1E-5 then thinks do not have homology.Choose the rice aspergillus egg that e value after comparing is greater than 1E-5
Bai Xulie is as first round the selection result.The comparison result data PERL sentence (www.uoguelph.ca/_ of BLASTP output
Thsiang/est/ it) extracts.110 specific genes are obtained eventually by the comparison of the first round.By this 110 specificity
The protein sequence of gene is compared with BLASTP program with the NR database of NCBI, if e value is 1E-5, is chosen e value and is greater than 1E-
5 rice aspergillus protein sequence, is extracted with PERL sentence.The protein sequence of 96 rice aspergillus specific genes is finally obtained,
Corresponding DNA sequence dna is found according to corresponding number, 20 specific genes is randomly selected as couple candidate detection target and carries out primer
Design.
1 43 species of table and corresponding predicted protein sequence and source
The design of 1.3 specific PCR detection primers
The sequence of 20 candidate candidate targets is extracted from genome.With (the Molecular Biology of Oligo 7
Insights, Inc, Cascade, CO, USA) software progress design of primers, using the method for nest-type PRC, design nested type draws
Object.This experiment the primer is held up Kechuang neoformation Science and Technology Ltd. by Wuhan and is synthesized.
2. the screening of rice aspergillus specific detection primer stability, specificity and sensitivity
97 rice aspergillus bacterial strains in all parts of the country are collected, DNA is extracted respectively, is expanded with 20 pairs of nest-type PRC primers, are tied
Fruit shows 19 target genes and can expand to obtain, and illustrates that this 19 target genes can all be deposited in 97 rice aspergillus bacterial strains
There is preferably stability.And there is the gene that a number is G192 that can only expand on the bacterial strain in 16 Hubei and 4 Shaanxi
Increase and arrive, therefore gives up this target gene.It chooses remaining 19 target gene and its corresponding primer carries out specificity verification.
16 disease fungus, 2 plant pathogenetic bacterias and 2 rice varieties are collected, extract DNA respectively, with 19 pairs of nidos
PCR primer is expanded.Amplification is shown in this 19 species all amplifications less than purpose band.Illustrate this 19 pairs of nidos
PCR detection primer specificity with higher.
Rice aspergillus DNA is subjected to concentration gradient dilution, is expanded with 19 pairs of nest-type PRC detection primers, is as a result shown respectively
Show that number is that corresponding nest-type PRC the primer Uv-1F/Uv-1R, Uv-2F/Uv-2R of G544 target can detecte minimum concentration and be
The rice aspergillus DNA of 1fg/ μ l, sensitivity highest (Fig. 3).
So comprehensive stability (Fig. 1), specific (Fig. 2) and sensitivity results (Fig. 3), choosing number is G544 target
The corresponding specific detection primer of nest-type PRC primer Uv-1F/Uv-1R, Uv-2F/Uv-2R as rice aspergillus, first round amplification knot
Fruit is 453bp, and the second wheel amplification is 366bp.
The nucleotide sequence of specific primer is (5 ' -3 ') as follows:
Uv-1F:TCTTGGCTCCTCGGAAGCTC
Uv-1R:CATGTCTTGCCCAAAGATGCG
Uv-2F:AGGTTCTACATGCGTGTTGTGA
Uv-2R:GCCCTGTGAAACTTGGTGC.
The nucleotide sequence of target gene G544 is as shown in SEQ ID NO:5.
Nested PCR amplification system is as follows:
Taq DNA polymerase used is purchased from TaKaRa company.
Nested PCR amplification program is as follows:
3. the application of rice aspergillus specific detection primer Uv-1F/Uv-1R, Uv-2F/Uv-2R
It still can accurately be detected to verify the nest-type PRC detection primer in the hybrid dna sample with high background
To rice aspergillus DNA.The rice aspergillus HWD-2 mycelia block of 28 DEG C of cultures 7 days on PSA plate is taken to be put into 50ml PSB fluid nutrient medium
In, 28 DEG C, 150rpm shakes 7 days acquisition thallospore mixed liquors of training.With the thallospore mixed liquor (spore of 2ml rice aspergillus HWD-2
Concentration is 1 × 106/ ml) with PSB fluid nutrient medium be control, the rice booting 7-8 phase to fringe packet carry out injection inoculation (Jia
et al.,2014).20 spikes of rice of injection inoculation are distinguished with rice aspergillus thallospore and control PSB fluid nutrient medium, at 25 DEG C,
In the environment of 100% humidity, after moisturizing culture 2 days, the rice spike of rice and 3 injection 2ml of 3 inoculation rice aspergillus are randomly selected
PSB extracts DNA as the rice spike of rice of control, carries out nest-type PRC detection with Uv-1F/Uv-1R, Uv-2F/Uv-2R primer, sends out
The tassel for being now vaccinated with rice aspergillus may detect that the presence of rice aspergillus, and control amplification is less than target fragment (Fig. 4).And
Illustrate that the detection primer can detect the DNA of rice aspergillus in hybrid dna sample.
In the paddy field that area is 1 mu, 5 method samplings are carried out to boot stage rice, take 1 plant of rice at every.By every plant
Rice is divided into 4 root, stem, leaf and fringe parts, extracts DNA respectively with Uv-1F/Uv-1R, Uv-2F/Uv-2R primer and carries out nido
PCR detection, discovery may detect that the presence (figure of rice aspergillus in root, stem, leaf and the fringe that field grows rice naturally
5).Illustrate that this can apply detection primer in field.
Claims (3)
1. one group of rice aspergillus PCR detection primer, which is characterized in that its title and nucleotide sequence are as follows:
Uv-1F:TCTTGGCTCCTCGGAAGCTC
Uv-1R:CATGTCTTGCCCAAAGATGCG
Uv-2F:AGGTTCTACATGCGTGTTGTGA
Uv-2R:GCCCTGTGAAACTTGGTGC.
2. purposes of the primer described in claim 1 in rice aspergillus PCR detection.
3. a kind of rice aspergillus PCR detection method, it is characterised in that: the DNA for extracting rice spike of rice is drawn with described in claim 1
Object carries out nest-type PRC detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610409325.4A CN105969871B (en) | 2016-06-12 | 2016-06-12 | Rice aspergillus PCR detection primer and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610409325.4A CN105969871B (en) | 2016-06-12 | 2016-06-12 | Rice aspergillus PCR detection primer and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105969871A CN105969871A (en) | 2016-09-28 |
| CN105969871B true CN105969871B (en) | 2019-05-21 |
Family
ID=57011074
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610409325.4A Expired - Fee Related CN105969871B (en) | 2016-06-12 | 2016-06-12 | Rice aspergillus PCR detection primer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105969871B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1851448A (en) * | 2005-12-08 | 2006-10-25 | 中国农业科学院作物科学研究所 | Green smut bug real-time fluorescent quantitative PCR test kit and its use |
| CN103436605A (en) * | 2013-07-22 | 2013-12-11 | 江苏省农业科学院 | Molecular detection method for rapidly differentiating mating type of Villosiclavavirens |
| CN104032003A (en) * | 2014-06-11 | 2014-09-10 | 中国农业大学 | Method for quantitatively detecting ustilaginoidea virens from seed-borne and soil-borne media |
| CN104630330A (en) * | 2013-11-12 | 2015-05-20 | 浙江省农业科学院 | Kit for quantitatively detecting Ustilaginoidea virens |
-
2016
- 2016-06-12 CN CN201610409325.4A patent/CN105969871B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1851448A (en) * | 2005-12-08 | 2006-10-25 | 中国农业科学院作物科学研究所 | Green smut bug real-time fluorescent quantitative PCR test kit and its use |
| CN103436605A (en) * | 2013-07-22 | 2013-12-11 | 江苏省农业科学院 | Molecular detection method for rapidly differentiating mating type of Villosiclavavirens |
| CN104630330A (en) * | 2013-11-12 | 2015-05-20 | 浙江省农业科学院 | Kit for quantitatively detecting Ustilaginoidea virens |
| CN104032003A (en) * | 2014-06-11 | 2014-09-10 | 中国农业大学 | Method for quantitatively detecting ustilaginoidea virens from seed-borne and soil-borne media |
Non-Patent Citations (1)
| Title |
|---|
| 稻曲病菌检测及水稻品种的抗病性评价;林廷邦;《中国优秀硕士论文全文数据库 农业科技辑》;20140115;全文 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105969871A (en) | 2016-09-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Mycorrhizal symbiosis modulates the rhizosphere microbiota to promote rhizobia–legume symbiosis | |
| Marzano et al. | Novel mycoviruses discovered from metatranscriptomics survey of soybean phyllosphere phytobiomes | |
| Offre et al. | Identification of bacterial groups preferentially associated with mycorrhizal roots of Medicago truncatula | |
| Inglis et al. | Trichoderma from Brazilian garlic and onion crop soils and description of two new species: Trichoderma azevedoi and Trichoderma peberdyi | |
| Huang et al. | Colletotrichum gloeosporioides sensu stricto is a pathogen of leaf anthracnose on evergreen spindle tree (Euonymus japonicus) | |
| Stets et al. | Rapid identification of bacterial isolates from wheat roots by high resolution whole cell MALDI-TOF MS analysis | |
| Berruti et al. | AMF components from a microbial inoculum fail to colonize roots and lack soil persistence in an arable maize field | |
| Liang et al. | A proposed adhesin AoMad1 helps nematode-trapping fungus Arthrobotrys oligospora recognizing host signals for life-style switching | |
| Dubey et al. | Molecular diversity analysis of Rhizoctonia solani isolates infecting various pulse crops in different agro-ecological regions of India | |
| CN105557510B (en) | The biological agent and method of preventing and controlling banana fusarium wilt | |
| Braithwaite et al. | Trichoderma down under: species diversity and occurrence of Trichoderma in New Zealand | |
| Wilman et al. | Plant-pathogenic fungi in seeds of different pea cultivars in Poland | |
| Wang et al. | Biogeographic patterns and co-occurrence networks of diazotrophic and arbuscular mycorrhizal fungal communities in the acidic soil ecosystem of southern China | |
| Savitha et al. | Morphological and molecular identification of Trichoderma isolates with biocontrol potential against Phytophthora blight in red pepper | |
| CN106399511B (en) | A kind of method and primer of real-time fluorescence quantitative PCR detection soil withered germ of water-melon | |
| Samant et al. | Quantification of Frankia in soils using SYBR Green based qPCR | |
| CN114032331A (en) | Fusarium proliferatum specific detection target FPRO-09882 and application thereof | |
| Ong et al. | The challenges of using high-throughput sequencing to track multiple bipartite mycoviruses of wild orchid-fungus partnerships over consecutive years | |
| Tang et al. | PCR markers derived from comparative genomics for detection and identification of the rice pathogen Ustilaginoidea virens in plant tissues | |
| Ma et al. | Community composition and trophic mode diversity of fungi associated with fruiting body of medicinal Sanghuangporus vaninii | |
| Muñoz-Barrios et al. | Differential expression of fungal genes determines the lifestyle of Plectosphaerella strains during Arabidopsis thaliana colonization | |
| Franken et al. | Molecular analysis of the arbuscular mycorrhiza symbiosis | |
| Wang et al. | The Sordariomycetes: an expanding resource with Big Data for mining in evolutionary genomics and transcriptomics | |
| Soylu et al. | Morphological and molecular characterization of Fusarium incarnatum as a causal disease agent of pepper (Capsicum annuum) fruit rot | |
| Katoch et al. | Application of PCR based diagnostics in the exploration of Parastagonospora nodorum prevalence in wheat growing regions of Himachal Pradesh |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190521 Termination date: 20200612 |