CN105969772A - shRNA for restraining PRDX5 gene expression in targeted mode - Google Patents
shRNA for restraining PRDX5 gene expression in targeted mode Download PDFInfo
- Publication number
- CN105969772A CN105969772A CN201610388830.5A CN201610388830A CN105969772A CN 105969772 A CN105969772 A CN 105969772A CN 201610388830 A CN201610388830 A CN 201610388830A CN 105969772 A CN105969772 A CN 105969772A
- Authority
- CN
- China
- Prior art keywords
- shrna
- prdx5
- sequence
- seq
- frame
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to shRNA for restraining PRDX5 gene expression in a targeted mode. The shRNA is composed of a positive sense strand and an antisense strand. The shRNA is characterized in that the positive sense strand comprises a sequence shown in SEQ ID NO:1, the antisense strands comprises a complementary sequence of the sequence shown in SEQ ID NO:1, the amino acid sequence of PRDX5 is shown in SEQ ID NO:2, and the gene coding sequence of PRDX5 is shown in SEQ ID NO:3. The shRNA can be used for treating cancer such as stomach cancer. The invention further relates to an anticancer pharmaceutical composition containing the shRNA.
Description
Technical field
The present invention relates to field of cancer, more specifically it relates to a kind of shRNA treating cancer.
Background technology
China is the High Risk For Gastric Cancer country, and the 3rd and the 2nd of whole malignant tumor is in its sickness rate and fatality rate respectively
Position.Owing to gastric cancer onset is hidden, the most non-evident symptons, subtle so that the early discovery of gastric cancer is extremely difficult.Especially
Being in China, the gastric cancer more than 80% has the most been in progressive stage when making a definite diagnosis, and prognosis is very poor, and serious threat the life of people and is good for
Health.It is thus desirable to a kind of effective Drug therapy gastric cancer.
Oxidative stress refers to that the factor such as environment or mitochondrial function obstacle causes activity in vivo oxygen clusters (reactive
Oxygen species, ROS) such as superoxide anion, hydroxy radical, hydrogen peroxide generation too much, oxidative system and antioxidation system
Unite unbalance, thus cause tissue injury.Internal there is antioxidase such as superoxide dismutase (superoxide
Dismutase, SOD), catalase (catalase, CAT), glutathion peroxidase (glutathione
Peroxidase, GST-Px), the regulation response to oxidative stress such as peroxide enzyme (peroxiredoxins, PRDXs).Low dense
Degree ROS can promote cell proliferation and differentiation, high concentration ROS then inducing cell apoptosis.
Close correlative connection is had between oxidative stress and mitochondria dysfunction.Oxidative stress heavy weight line mitochondria function
Obstacle, and mitochondria dysfunction increases the generation of ROS, forms the vicious cycle strengthening oxidative stress.By tumor line grain
Body protein group analysis, finds that the albumen (including CAT, PRDX3 and PRDX5 etc.) that a lot of anti-oxidative damage is relevant is expressed and increases.
PRDXs is the antioxidation albumen that a class can reduce that ROS produces, by increasing capacitance it is possible to increase cell is survived under oxidative stress pressure and breeds energy
Power, its expression is relevant to some tumors such as thyroid carcinoma, breast carcinoma and pulmonary carcinoma.And PRDX5 antagonism ROS in terms of than other
PRDXs more effectively, it can protective wire plastochondria and damage of nuclear dna, reduce its expression and make cell be prone to apoptosis.Existing
In the relation about PRDX5 and gastric cancer, study the most considerably less.
The detection of expression of PRDX5 gene and albumen is introduced in diagnosing gastric cancer and applies by the present invention, and designs specificity shRNA
Carrying out targeting blocking-up for PRDX5, result of study has theory innovation feature and bigger realistic meaning, and the present invention will be for gastric cancer
Specificity, the early stage diagnosis and treatment of susceptiveness help is provided.The most also the antitumor for targeting regulation oxidative stress associated protein is controlled
Treat research and case screening provides important references.
Summary of the invention
The invention provides the shRNA of a kind of targeted inhibition PRDX5 gene expression, comprise what 5 ' the just frames and 3 ' held were held
Antisense frame, the sequence of described justice frame is as shown in SEQ ID NO:1, and the sequence of described antisense frame is SEQ ID NO:1 institute
Show the complementary series of sequence, the aminoacid sequence of described PRDX5 as shown in SEQ ID NO:2, the gene code sequence of described PRDX5
Row are as shown in SEQ ID NO:3.
Preferably, there are the interval of 3-10 nucleotide, described 3-10 nucleoside between described justice frame and described antisense frame
Acid is the most complementary, to form hair fastener ring.
Preferably, 3 ' ends of described antisense frame are attached two or more uridnine.
Preferably, the sequence of described shRNA is as shown in SEQ ID NO:4.Described shRNA can be used for preparing cancer therapy drug.
Present invention also offers a kind of DNA vector, it comprises the DNA encoding sequence of above-mentioned shRNA, and drives described
The promoter that DNA encoding sequence is transcribed, described DNA encoding sequence is operably coupled to described along the transcriptional orientation of described promoter
The downstream of promoter.
Preferably, described promoter be can in the cell of people the promoter of constitutive expression.
Described DNA vector can be used for preparing cancer therapy drug, such as, is used for treating gastric cancer.
The invention also discloses a kind of anticancer pharmaceutical composition, it comprises above-mentioned shRNA and/or DNA vector, and pharmacy
The combination of one or more in acceptable supporting agent, excipient, diluent, adjuvant.
Preferably, described pharmaceutical composition is used for treating gastric cancer.
Accompanying drawing explanation
Fig. 1 is the Western blot figure of detection PRDX5-shRNA suppression PRDX5 protein level；
Fig. 2 is the result figure of the Q-PCR of detection PRDX5-shRNA suppression PRDX5 transcriptional level；
Fig. 3 is the cartogram of PRDX5-shRNA anticancer propagation.
Detailed description of the invention
Being described further principle and the feature of the present invention below in conjunction with instantiation and accompanying drawing, example is only used
In explaining the present invention, it is not intended to limit the scope of the present invention.
Inventor is during research gastric cancer, by linear track ion trap chromatography-mass spectroscopy technical Analysis patients with gastric cancer
With the tissue samples of healthy person, find that PRDX5 protein level raises 3 times in the tissue samples of patients with gastric cancer, therefore predict
PRDX5 albumen plays an important role in the evolution of gastric cancer tumor.Inventor designs according to the cDNA sequence of PRDX5 albumen
ShRNA, to study the expression of this shRNA Yu PRDX5, and the impact on tumor.Unexpectedly, inventor finds this
ShRNA has antitumaous effect.
The preparation of embodiment 1PRDX5-shRNA
The shRNA of the targeted inhibition PRDX5 expression of the present embodiment designs according to the cDNA sequence of PRDX5, and passes through
The method of synthetic is respectively synthesized 5 '-CACCGCCTGGCACCCAATATCATCTTTCAAGAGAAGATGATATTGGGTGCCA
GGCTTTTTTG-3 ' and 5 '-GATCCAAAAAAGCCTGGCACCCAATATCATCTTCTCTTGAAAGATGATATTGGGTG CCA
GGC.By two chain equal proportion mixing, obtain double-strand after annealing and be connected in expression vector along the transcriptional orientation of promoter, logical
Crossing the expression of this expression vector and obtain RNA, its sequence is 5 '-GCCUGGCACCCAAUAUCAUCUUUCAAGAGAAGAUGAUAUUGG
GUGCCAGGCUU-3 ' (SEQ ID NO:4), anneals in this RNA chain and obtains PRDX5-shRNA:
The suppression that PRDX5 is expressed in stomach cancer cell by embodiment 2shRNA
By lipofection by above-mentioned shRNA transfection to gastric carcinoma cell line SGC-7901, select transfectant and train
Support, detected the expression feelings of PRDX5 transfectant by Western blot and Q-PCR respectively from protein level and transcriptional level
Condition, with out of order comparison shRNA as negative control.
As depicted in figs. 1 and 2, PRDX5's result of the gastric carcinoma cell line SGC-7901 having transfected PRDX5-shRNA either exists
Protein level (Fig. 1) or in transcriptional level (Fig. 2) substantially lower than comparison, this prompting, PRDX5-shRNA significantly suppress cancer
The expression of PRDX5 in cell.
The propagation of embodiment 3shRNA suppression stomach cancer cell
In 72 hours, monitor in real time the cell proliferative condition of above-mentioned stomach cancer cell transfectant, with compare shRNA carry out right
Ratio, obtains Fig. 3.Result shows, PRDX5-shRNA can significantly inhibit the propagation of cancerous cell.
The growth inhibited effect to suppression tumor SGC7901 of embodiment 4shRNA
Choose female BAl BIc/c nude mice 2 that body weight is 18-22g only to set up Transplanted tumor model, by thin for people's gastric cancer SGC7901
It is subcutaneous that born of the same parents are inoculated in nude mice axillary fossa, every inoculation 2 × 106Individual cell.Treat tumor mass volume about 100mm3During size, by nude mice according to
Tumor mass size and body weight carry out being divided into 3 groups, often 6 nude mices of group.Normal saline group, negative control-shRNA (shNC) group and
PRDX5-shRNA group, three-times-weekly, intratumor injection, successive administration two weeks.Test the 24th day and put to death animal, separate tumor and claim
Weight, calculates tumour inhibiting rate (table 1).Result shows, compared with each matched group, PRDX5-shRNA has notable anti-tumor activity.
The inhibitory action that transplanted tumor in nude mice SGC7901 is grown by table 1 shRNA
* is P ＜ 0.01 compared with normal saline group, P ＜ 0.05 compared with # with shNC group.
The foregoing is only presently preferred embodiments of the present invention, not in order to limit the present invention, all spirit in the present invention and
Within principle, any modification, equivalent substitution and improvement etc. made, should be included within the scope of the present invention.
Claims (9)
1. the shRNA of a targeted inhibition PRDX5 gene expression, it is characterised in that comprise that 5 ' the just frames and 3 ' held hold is anti-
Justice frame, the sequence of described justice frame is as shown in SEQ ID NO:1, and the sequence of described antisense frame is shown in SEQ ID NO:1
The complementary series of sequence, the aminoacid sequence of described PRDX5 as shown in SEQ ID NO:2, the gene coded sequence of described PRDX5
As shown in SEQ ID NO:3.
ShRNA the most according to claim 1, it is characterised in that have 3-10 between described justice frame and described antisense frame
The interval of nucleotide, described 3-10 nucleotide is the most complementary, to form hair fastener ring.
ShRNA the most according to claim 1, it is characterised in that 3 ' ends of described antisense frame are attached two or more
Individual uridnine.
ShRNA the most according to claim 1, it is characterised in that sequence is as shown in SEQ ID NO:4.
5. the application in preparing cancer therapy drug of the shRNA according to any one of claim 1-4.
6. a DNA vector, it is characterised in that comprise the DNA encoding sequence of shRNA according to any one of claim 1-4,
And driving the promoter that described DNA encoding sequence transcribes, described DNA encoding sequence has along the transcriptional orientation of described promoter
Effect is connected to the downstream of described promoter.
DNA vector the most according to claim 6, it is characterised in that described promoter is composing type table in the cell of people
The promoter reached.
8. the application in preparing cancer therapy drug of the DNA vector described in a claim 6 or 7.
9. an anticancer pharmaceutical composition, it is characterised in that comprise the shRNA according to any one of Claims 1-4 and/or
In DNA vector described in claim 6 or 7, and pharmaceutically acceptable supporting agent, excipient, diluent, adjuvant one or more
Combination.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610388830.5A CN105969772B (en) | 2016-06-02 | 2016-06-02 | A kind of shRNA of targeted inhibition PRDX5 gene expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610388830.5A CN105969772B (en) | 2016-06-02 | 2016-06-02 | A kind of shRNA of targeted inhibition PRDX5 gene expression |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105969772A true CN105969772A (en) | 2016-09-28 |
| CN105969772B CN105969772B (en) | 2019-04-23 |
Family
ID=57010689
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610388830.5A Active CN105969772B (en) | 2016-06-02 | 2016-06-02 | A kind of shRNA of targeted inhibition PRDX5 gene expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105969772B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116287272A (en) * | 2023-03-23 | 2023-06-23 | 潍坊市人民医院(潍坊市公共卫生临床中心) | Application of PRDX5 in diagnosis and treatment of glioma |
-
2016
- 2016-06-02 CN CN201610388830.5A patent/CN105969772B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| EBERT, L. ET AL: "CR457203", 《GENBANK》 * |
| FANG LIU ET AL: "Quantitative proteomic analysis of gastric cancer tissue reveals novel proteins in platelet-derived growth factor B signaling pathway", 《ONCOTARGET》 * |
| KUNZE A ET AL: "NP_036226.1", 《GENBANK》 * |
| ST´EPHANIE DE SIMONI ET AL.: "Silencing of peroxiredoxin 3 and peroxiredoxin 5 reveals the role of mitochondrial peroxiredoxins in the protection of human neuroblastoma SH-SY5Y cells toward MPP+", 《NEUROSCIENCE LETTERS》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116287272A (en) * | 2023-03-23 | 2023-06-23 | 潍坊市人民医院(潍坊市公共卫生临床中心) | Application of PRDX5 in diagnosis and treatment of glioma |
| CN116287272B (en) * | 2023-03-23 | 2023-09-15 | 潍坊市人民医院(潍坊市公共卫生临床中心) | Application of PRDX5 in diagnosis and treatment of glioma |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105969772B (en) | 2019-04-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yi et al. | Transforming “cold” tumors into “hot” ones via tumor-microenvironment-responsive siRNA micelleplexes for enhanced immunotherapy | |
| CN101951926B (en) | Composition containing microRNA-21 inhibitor for enhancing radiation sensitivity | |
| MY180758A (en) | Pegylated l-asparaginase | |
| Yin et al. | Antitumor effects of oncolytic herpes simplex virus type 2 against colorectal cancer in vitro and in vivo | |
| CN105969772A (en) | shRNA for restraining PRDX5 gene expression in targeted mode | |
| CN104056277B (en) | The application of MLH1 gene or its expression product in the highly expressed colorectal cancer of DKK4 | |
| Girald et al. | Toxicity and delivery methods for the linamarase/linamarin/glucose oxidase system, when used against human glioma tumors implanted in the brain of nude rats | |
| CN109420167B (en) | Combined medicine for treating tumor | |
| CN101648011B (en) | Tumor targeting recombinant DNA vaccine, preparation method thereof and application thereof | |
| CN106075453A (en) | A kind of anti-tumor medicinal preparation combination | |
| ES2842748T3 (en) | Attenuated or inactivated pathogenic Escherichia coli for the treatment of urogenital cancer | |
| CN112618569A (en) | Medicine for treating urothelial cancer | |
| CN105886508B (en) | A kind of siRNA of targeted inhibition ATP5A1 gene expression and its application | |
| CN114099685B (en) | Application of substance for inhibiting MUC1 expression and glycosylation modification in reducing drug resistance of anti-breast cancer drugs | |
| Xu et al. | MEDU-22. INHIBITION OF OLIG2 SUPPRESSES THE GROWTH OF MYC-AMPLIFIED MEDULLOBLASTOMA | |
| CN110772477A (en) | Recombinant adenovirus sustained-release hydrogel, preparation method and application thereof | |
| CN116769724B (en) | Mesenchymal stem cells carrying killing switch and application thereof in tumor treatment | |
| Demers et al. | CANCER IMMUNOTHERAPY | |
| CN111617235A (en) | Application of IL-12 in postoperative antitumor aspect | |
| Xie et al. | Enhanced antitumor effect of biodegradable cationic heparin-polyethyleneimine nanogels delivering FILIP1LΔC103 gene combined with low-dose cisplatin on ovarian cancer | |
| CN101391104A (en) | New use of oncolytic adenovirus recombinant of tumour cell single-expression immunoloregulation fator GM-CSF | |
| CN110025627A (en) | A kind of drug and application thereof of anti-curing oncoma | |
| Sun et al. | Attenuated Salmonella typhimurium carrying the hepatocyte growth factor and keratinocyte growth factor genes repairs gastrointestinal mucosal damage caused by chemotherapy | |
| KR20240015029A (en) | Recombinant Expression Vector for Secretion of Catalase and Escherichia coli Transformed Therewith | |
| Zhang et al. | Engineering Proteus mirabilis improves antitumor efficacy via enhancing cytotoxic T cell responses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |