CN105969766A - Pear blister canker viroid (PBCVd) molecular standard sample and preparation method thereof - Google Patents
Pear blister canker viroid (PBCVd) molecular standard sample and preparation method thereof Download PDFInfo
- Publication number
- CN105969766A CN105969766A CN201610334244.2A CN201610334244A CN105969766A CN 105969766 A CN105969766 A CN 105969766A CN 201610334244 A CN201610334244 A CN 201610334244A CN 105969766 A CN105969766 A CN 105969766A
- Authority
- CN
- China
- Prior art keywords
- standard sample
- pbcvd
- blister canker
- pear blister
- canker viroid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a pear blister canker viroid (PBCVd) molecular standard sample and a preparation method thereof. The method comprises the following steps: PBCVd raw material selection, standard sample preparation, uniformity and stability inspection, qualitative detection, value fixation and the like. The preparation method of the standard sample comprises the following steps: extracting virus RNA from a PBCVd virus solution, carrying out RT-PCR amplification, purifying the target gene segment, and connecting and transforming the target segment; and recovering the plasmid. The pear blister canker viroid standard sample has the advantages of high stability and favorable uniformity, is suitable for quick detection verification on PBCVd, satisfies the standard sample demands for detection research, pesticide research and application research of the PBCVd, and can be widely used for epidemic situation monitoring in the agricultural production and environment and for PBCVd monitoring and detection in import and export trade. The standard sample can be used for implementing comparison on different laboratory results, thereby ensuring the quality control of the laboratory.
Description
Technical field
The invention belongs to detection Virus Standard product and preparation method thereof technical field, be specifically related to pears blister canker class sick
Poison standard sample and preparation method thereof.
Background technology
Pear blister canker viroid (Pear Blister Canker Viroid, PBCVd) is generally containing about 319 nucleoside
Acid.Can infect, with asexual propagation material long-distance communications through grafting and black peach aphid.Not yet there is the inspection of Pear blister canker viroid at present
Survey the standard operation code of authentication method.Therefore, the Testing and appraisal method general operation rule of specification Pear blister canker viroid
Journey, sets up simple and practical Pear blister canker viroid novel Testing and appraisal method, for improving Pear blister canker viroid
Quarantine and examination efficiency, prevent Pear blister canker viroid incoming, spread out of, protection China agricultural safety in production, promote China
The smooth outlet of agricultural product, tool is of great significance.Studing Plant Viroids due to the most dominant infect commonplace, Symptoms
Affected by ambient temperature relatively big, and several differential plant is similar to the reaction symptom of inhomogeneity virus, therefore it is raw to be difficult to application
Thing method for measuring.Owing to viroid can not produce any protein, so the Electronic Speculum of detection virus, serology can not be used
Method.Therefore, select molecular biology method that Pear blister canker viroid is detected.
In system, the sample of censorship seedling is the most healthier from the point of view of generally observing, and Pear blister canker viroid generally only has
Could fall ill under appropriate conditions, and PCR method now can only show from severe infection the plant of symptom and examine
Go out virus, it is impossible to detect potential virus.Along with the increase of foreign trade, the inspection process time limit requires reduction, plant virus
Epidemic disease majority molecular Biological Detection to be carried out, existing country and industry standard, it is required for standard positive strain or positive right
Carrying out testing Quality Control according to Quality Control thing, introducing of these positive strains needs to handle complicated examination and approval procedures, and acquisition expenses is expensive, difficult
Degree is relatively big, and the most common vegetable plague laboratory hardly results in this virus, and quality control and research to laboratory bring
Challenge greatly.
In order to help laboratory to set up the research and production of metallurgical standard sample work one of the quality assurance of specification, plant virus and viroid
Straight in carrying out.At present, the most not about the research of this kind of plant Virus Standard sample.We will develop first can
Molecular criteria sample and technology of preparing for quickly detection Pear blister canker viroid.Succeeding in developing of this standard sample, no
Only detect research, medical research, applied research provide the demand of standard sample, refer to for inspection and quarantine mechanism technology simultaneously
Lead, service export enterprise provides technical support.This invention achievement becomes the prominent of vegetable plague molecular diagnosis field by being expected to
Broken property product and technology, be improving further and development of epiphytology detection technique system.
Summary of the invention
It is an object of the invention to provide the Pear blister canker viroid molecular criteria sample that a kind of stability is high, uniformity is good
Product and preparation method thereof.
In order to obtain described Pear blister canker viroid molecular criteria sample, according to Pear blister canker viroid (PBCVd)
Gene complete sequence, design complete sequence and specific primer, its base sequence is as follows:
SEQ ID NO:1:GCCGTATCTCAACGGCTCAT
SEQ ID NO:2:CGTCTCATTTCAGAGACTCATCA
The Pear blister canker viroid molecular criteria sample of the present invention, adopts and prepares with the following method:
(1) plant tissue of infection Pear blister canker viroid, liquid nitrogen grinding are gathered；
(2) in the plant tissue that step (1) obtains, extraction obtains viral RNA；
(3) viral RNA of step (2) is as PCR reaction template, carries out RT-PCR amplified reaction, and wherein PCR is just reacting
Anti-primer is respectively SEQ ID NO:1 and SEQ ID NO:2；
(4) it is connected in PGEM-T carrier after purified for the pcr amplification product of step (3), connects product and convert to sense
After state cell, LB flat board is cultivated, and screening obtains positive colony；
(5) in positive colony, extraction obtains plasmid, is the standard sample of Pear blister canker viroid；
In above-mentioned preparation method, in step (4), the method for screening positive clone is RT-PCR method, and wherein RT-PCR is anti-
The positive anti-primer answered is respectively SEQ ID NO:1 and SEQ ID NO:2
The Pear blister canker viroid molecular criteria sample stability of the present invention is high, uniformity is good, for pears blister canker class
The detection research of virus, medical research, applied research provide the demand of standard sample, refer to for inspection and quarantine mechanism technology simultaneously
Lead, service export enterprise provides technical support.The standard sample using the present invention can realize different experiments room result
Comparison, thus ensure the quality control of laboratory.
Accompanying drawing explanation
Fig. 1 is the electrophoretogram of the pcr amplification reaction product of PBCVd target gene in embodiment 1, wherein M:
DL2000Marker, 1～4: negative control；5:PCR amplified production amplifies the fragment of 315bp size
Fig. 2, for being standard sample sensitivity technique result figure of the present invention, wherein by left-to-right, is 10 successively-1,10-2,10-3,10-4,10-5,10-6,10-7,10-8。
Detailed description of the invention
Following non-limiting example can make those of ordinary skill in the art that the present invention be more fully understood, but not with
Any mode limits the present invention.Pear blister canker viroid molecular criteria sample and preparation method thereof is carried out as follows:
The preparation of embodiment 1 Pear blister canker viroid molecular criteria sample
(1) viral RNA is extracted；
The plant tissue of collection 0.1g infection Pear blister canker viroid adds liquid nitrogen and is ground into powder, and abrasive material is rapid
Move in 1.5mL centrifuge tube, add 1mL Trizol Reagent, overturn and mix, 2 DEG C～8 DEG C, 12000g, centrifugal 10min.
Take supernatant, 15 DEG C～30 DEG C, place 5min；Add 0.2mL chloroform, acutely shake (not vortex oscillation), 15s with hands.15 DEG C～
30 DEG C, place 2min～3min；2 DEG C～8 DEG C, 12000g, centrifugal 15min.The careful upper strata aqueous phase being about 600 μ L of drawing, not
Disturbance mesophase and lower floor's phase.Add 500 μ L isopropanol mixing supernatants, 15 DEG C～30 DEG C, place 10min.2 DEG C～8 DEG C,
12000g, centrifugal 10min.Remove supernatant, precipitation adds 1mL 75% ethanol, washing；2 DEG C～8 DEG C, 7500g, centrifugal
5min.Remove supernatant, after precipitation natural drying, be dissolved in 30 μ L～50 μ L without in the water of RNase, be template to be checked
RNA。
(2) amplification of target gene
The viral RNA of step (1), as PCR reaction template, designed, designed primer of the present invention, carries out RT-PCR amplification anti-
Should, expanding Pear blister canker viroid gene complete sequence, size is the fragment of 315bp, wherein the positive and negative primer sequence of PCR reaction
As follows:
SEQ ID NO:1:GCCGTATCTCAACGGCTCAT
SEQ ID NO:2:CGTCTCATTTCAGAGACTCATCA
Amplification solution adds 2 × RT-PCR buffer (10 times of polymerase chain Mix reactant liquors) 12.5 μ L, 10pmol/
The each 0.5 μ L of μ L SEQ ID NO:1 and SEQ ID NO:2, adds in reaction system by the testing sample RNA extracted, and DEPC water is mended
Foot volume to 25 μ L, PCR cycle condition is: 48 DEG C of 30min, after 94 DEG C of denaturations 5min, enters 94 DEG C of degeneration 30s, and 53 DEG C are moved back
Fire 40s, 72 DEG C extend 45s, altogether circulation 35 times；Then 72 DEG C re-extend 10min.
PCR primer is carried out agarose gel electrophoresis, takes 2g agarose, heat in 100mL electrophoretic buffer, the most molten
Change, add ethidium bromide stock solution to final concentration of 0.5 μ g/mL, glue.In electrophoresis tank, add electrophoretic buffer, make liquid level
Just do not had gel；3 μ L～6 μ L pcr amplification products are mixed with appropriate sample loading buffer respectively, point sample；9V/cm constant voltage electricity
Swimming, until bromophenol blue indicator migrates in the middle part of gel；Observing electrophoresis result under Ultraviolet Detector, field to be checked sample can expand
Increasing and expection band, amplified band is 315bp, and electrophoresis result is shown in Fig. 1.
(3) sequencing of target gene
Pcr amplification product send precious biological (Dalian) company limited check order, sequencing result such as SEQ ID NO.3.Will
Gained sequence is analyzed by NCBI online nucleotide blast, and result shows: this nucleotide sequence and pears blister canker class
The nucleotide sequence similarity of virus (PBCVD) is up to 99%, for Pear blister canker viroid gene complete sequence.
(4) purification of target gene
Pcr amplification product in step (2) is used TaKaRa Agarose Gel DNA Purification Kit
Ver.2.0 test kit (article No. DV805A), and reclaim target molecule DNA fragmentation by its operating instruction, i.e. shown in SEQ ID NO.3
PBCVd gene complete sequence.
(5) connection of purpose fragment converts
Purpose fragment 4 μ L, the 2 × Rapid ligation buffer 5 μ L, PGEM-T that purification obtains in step (4)
Carrier 0.5 μ L, T4DNA Ligase 0.5 μ L, is supplemented to 10 μ L with sterilized water, and room temperature connects 1h.Connection product is joined system
In the competent cell E.coli JM109 got ready, mix with pipettor gently, ice bath 20min, 42 DEG C of heat stress 1min, ice bath
2min, adds 800 μ L SOC culture medium, and 150g shakes bacterium 1.5h, and 1000g is centrifuged 10min, discards culture fluid, adds fresh SOC
Culture medium 200 μ L, is coated in after mixing on the LB flat board containing Amp+, after air-drying, is inverted for 37 DEG C and cultivates 12h-16h.
Picking is cultivated in LB culture fluid by monoclonal bacterium, carries out the screening of positive colony, PCR system by PCR method
And reaction condition is shown in (2) of step 3.Amplified production is carried out sepharose electrophoresis qualification, result obtain with expect in the same size
315bp fragment.
Application Omega company plasmid extraction kit Plasmid Mini Kit I (100test), the above-mentioned step of extraction purification
The positive colony that in rapid, screening obtains, it is thus achieved that recombiant plasmid PGEM-T-PBCVD, every EP pipe is distributed into 100 μ L, every restructuring
Plasmid content is 1 μ g, is Pear blister canker viroid molecular criteria sample.
The homogeneity test of embodiment 2 Pear blister canker viroid molecular criteria sample
The uniformity of Pear blister canker viroid molecular criteria sample is such as the method for embodiment 1 to be prepared
PBCVd molecular criteria sample is randomly divided into two sample sets, i.e. sample sets A and sample sets B, and each sample sets is respectively arranged with 15 standards
Sample, each sample carries out PCR amplification according to following reaction condition, measures PCR primer concentration (ng/ μ L), produces by comparing PCR
The concentration change of thing, according to the uniformity of evaluation of statistical methods standard sample,
PCR reaction system: add Pear blister canker viroid molecular criteria sample 1 μ L in reaction tube (containing 1 × 10-2μg
DNA), 2 × PCR buffer (10 times of polymerase chain Mix reactant liquors) 12.5 μ L, 10pmol/ μ L SEQ ID NO:1 and SEQ
The each 0.5 μ L of ID NO:2, DEPC water supplies volume to 25 μ L.
PCR reaction condition: after 94 DEG C of denaturations 5min, enters 94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, and 72 DEG C extend 30s,
Circulation 35 times altogether；Then 72 DEG C re-extend 10min.
Result such as table 1,2 and 3.
Table 1 Pear blister canker viroid molecular criteria sample homogeneity measurement result
Table 2 Pear blister canker viroid molecular criteria sample homogeneity evaluation result
Table 3 Pear blister canker viroid molecular criteria sample homogeneity detects
Knowable to the result of table 1 and statistical result (table 2 and table 3) thereof, between two sample sets, there is not significant difference, can
To think that sample is uniform.
The stability experiment of embodiment 3 Pear blister canker viroid molecular criteria sample
The Pear blister canker viroid molecular criteria sample random packet method of embodiment 1 prepared, each sample is pressed
According to carrying out PCR amplification under the PCR reaction system described in embodiment 2 and PCR reaction condition, measure PCR primer concentration (ng/ μ L),
By comparing the concentration change of PCR primer, according to the stability of evaluation of statistical methods standard sample.
Use two kinds of stability test:
A kind of is the stability test at-20 DEG C, takes 24 parts of Pear blister canker viroid molecular criteria sample at random, often
Within individual month, detect 2 parts, continuous 12 months, result such as table 4.
Another kind is the stability test at higher temperature 20 DEG C, takes Pear blister canker viroid molecular criteria at random
12 parts of sample, weekly detection 3 parts, continuous 4 weeks, test result such as table 5.
Table 4. stability test experiment (-20 DEG C)
F assay to table 4 result is F=1.30769231, FTable 0.05=4.2838, F ＜ FCr[0.05,5,5], i.e. sample
Between there was no significant difference.
Table 5. stability test experiment (20 DEG C) result
Table 6. variance analysis
It is F=0.566, F to table 6 result the results of analysis of varianceTable 0.05=4.066, F ＜ FCr[0.05,5,5], i.e. sample room without
Significant difference.
Embodiment 4 valued methods
The Pear blister canker viroid molecular criteria sample prepared by the method for embodiment 1 selects 15 at random, each sample
Described in embodiment 2, carrying out definite value test with Pear blister canker viroid polymerase chain reaction method, result is completely the same,
It is Pear blister canker viroid nucleic acid positive.
This Pear blister canker viroid molecular criteria sample is through Fujian inspection and quarantine bureau, Yantai inspection and quarantine bureau, Gansu inspection
Test the coordinated trials definite value result statistics such as Quarantine Bureau, Guangdong inspection and quarantine bureau and be shown in Table 7.
Table 7. coordinated trials definite value result table
Application Pear blister canker viroid polymerase chain reaction method is pears to the definite value experimental result of this standard sample
Blister canker viroid nucleic acid is positive.
SEQUENCE LISTING
<110>Inspection and Quarantine Technology Center, Shandong Inspection and Quarantine
<120>Pear blister canker viroid molecular criteria sample and preparation method thereof
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223>SEQ ID NO:1
<400> 1
GCCGTATCTCAACGGCTCAT 20
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223>SEQ ID NO:2
<400> 2
CGTCTCATTTCAGAGACTCATCA 23
<210> 3
<211> 315
<212> DNA
<213> Artificial Sequence
<220>
<223>SEQ ID NO:3
<400> 3
gccgtatc tcaacggctc atcagtgggc taagcccaga cttatgagag agtgatgacc
tctcagcccc tccaccttgg ggtgccctat tcggagcact gcagttcccg atagaaaggc taagcacctc
gcaatgaggt aaggtgggac ttttccttct ggaaccaagc ggttggttcc gaggggggtg tgatccaggt
accgccgtag aaactggatt acgacgtcta cccgggatcc aaacccggtc ccctccagaa gtgattctgg
aaaaagagtc tgtgcttagc acactgatga gtctctgaaa tgagacg 315
Claims (2)
1. the preparation method of a Pear blister canker viroid standard sample, it is characterised in that preparation process is as follows:
(1) plant tissue of infection Pear blister canker viroid, liquid nitrogen grinding are gathered；
(2) in the plant tissue that step (1) obtains, extraction obtains viral RNA；
(3) viral RNA of step (2) is as PCR reaction template, carries out RT-PCR amplified reaction, wherein positive and negative the drawing of PCR reaction
Thing is respectively SEQ ID NO:1 and SEQ ID NO:2；
(4) it is connected in PGEM-T carrier after purified for the pcr amplification product of step (3), connects product and convert to competence
After cell, LB flat board is cultivated, and screening obtains positive colony；
(5) in positive colony, extraction obtains plasmid, is the standard sample of Pear blister canker viroid；
Wherein said competent cell is E.coli JM109.
2. the Pear blister canker viroid standard sample utilizing method described in claim 1 to prepare.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610334244.2A CN105969766A (en) | 2016-05-19 | 2016-05-19 | Pear blister canker viroid (PBCVd) molecular standard sample and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610334244.2A CN105969766A (en) | 2016-05-19 | 2016-05-19 | Pear blister canker viroid (PBCVd) molecular standard sample and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105969766A true CN105969766A (en) | 2016-09-28 |
Family
ID=56957131
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610334244.2A Pending CN105969766A (en) | 2016-05-19 | 2016-05-19 | Pear blister canker viroid (PBCVd) molecular standard sample and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105969766A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101058834A (en) * | 2007-05-24 | 2007-10-24 | 清华大学 | Method of quantificationally detecting rota virus and special-purpose standard substance for the same |
| CN102719560A (en) * | 2012-06-12 | 2012-10-10 | 中国检验检疫科学研究院 | Chip for screening apscaviroid viroid and application of chip |
| CN103555860A (en) * | 2013-11-07 | 2014-02-05 | 吴斌 | SVCV (spring viraemia of carp virus) standard sample and preparation method thereof |
| US20140242048A1 (en) * | 2013-02-25 | 2014-08-28 | Beijing Dabeinong Technology Group Co., Ltd. | Methods For Controlling Pests |
-
2016
- 2016-05-19 CN CN201610334244.2A patent/CN105969766A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101058834A (en) * | 2007-05-24 | 2007-10-24 | 清华大学 | Method of quantificationally detecting rota virus and special-purpose standard substance for the same |
| CN102719560A (en) * | 2012-06-12 | 2012-10-10 | 中国检验检疫科学研究院 | Chip for screening apscaviroid viroid and application of chip |
| US20140242048A1 (en) * | 2013-02-25 | 2014-08-28 | Beijing Dabeinong Technology Group Co., Ltd. | Methods For Controlling Pests |
| CN103555860A (en) * | 2013-11-07 | 2014-02-05 | 吴斌 | SVCV (spring viraemia of carp virus) standard sample and preparation method thereof |
Non-Patent Citations (3)
| Title |
|---|
| XU,W.X.等: "Peach latent mosaic viroid, complete sequence", 《GENBANK: AY685181.1》 * |
| 吴玉鹏等: "利用RT- PCR检测库尔勒香梨泡状溃疡类病毒", 《广西园艺》 * |
| 胡加谊等: "菠萝凋萎相关病毒-１ 实时荧光定量RT-PCR 检测体系的建立与应用", 《植物保护》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104372081B (en) | The LAMP detection primer of one group of Eggs of Silkworm microsporidian and kit | |
| CN109295261A (en) | It is a kind of for detecting the primer, probe and detection method of slow virus RCL | |
| CN104263857B (en) | A kind of nano PCR kit of quick detection mink enteritis virus and its application | |
| CN101899501B (en) | Constant temperature amplification detection kit and method for detecting food allergen crustacean gene | |
| CN105063229B (en) | For detecting quantitative fluorescent PCR specific primer, probe and its kit of sheep derived material in meat products | |
| CN108588276A (en) | D type influenza virus fluorescence quantification PCR primers pair and kit | |
| CN105969766A (en) | Pear blister canker viroid (PBCVd) molecular standard sample and preparation method thereof | |
| CN105803050B (en) | Primer and method for detecting CHO cell DNA | |
| CN103451320A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method for three genotypes of human parvovirus B19, as well as universal detection primer, TaqMan probe and kit thereof | |
| CN108315479A (en) | Ankara real-time fluorescence quantitative PCR primer pair and kit | |
| CN104450975A (en) | RT-HDA primer, kit and method for detecting tomato spotted wilt virus | |
| CN102912038B (en) | RT-HDA kit and primer for detecting avian influenza virus | |
| CN103805717A (en) | Dual Eva Green real-time fluorescence quantification PCR (Polymerase Chain Reaction) detection kit for detecting equine herpesviruses I and IV and application thereof | |
| KR101236197B1 (en) | Differential detection of West nile virus and Japanese encephalitis virus | |
| CN108148834B (en) | Primer combination, kit and method for detecting the fungi in space environment | |
| CN105925571A (en) | ASSVd (Apple Scar Skid Viroid) molecule standard sample and preparation method thereof | |
| CN105886666A (en) | Duck circovirus real-time fluorescent quantitative PCR (polymerase chain reaction) detection method | |
| CN105950616A (en) | Peach latent mosaic viroid molecule standard sample and preparation method thereof | |
| CN105861497A (en) | Tomato spotted wilf virus molecule standard sample and preparation method thereof | |
| CN105002166A (en) | Molecular standard sample of brown cockroaches and preparation method of molecular standard sample | |
| CN104131106B (en) | The primer that the special quantitative PCR of transgenic corns 98140 structure precisely detects and probe and method | |
| CN109609661A (en) | A kind of combination of kidney-yang deficiency exogenous disease mouse model lung tissue qPCR reference gene and its screening technique | |
| CN106011265A (en) | Molecular biology distinguishing method of larvae of Cnaphalocrocis medinalis and Marsamia patnalis | |
| CN104450972B (en) | NASBA primer, test kit and the method for detection Fructus Mali pumilae rust fruit virus | |
| CN109576394A (en) | It is a kind of detect Nebovirus SYBR Green fluorescence quantitative RT-PCR primer and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160928 |
|
| RJ01 | Rejection of invention patent application after publication |