CN105950759B - Kit for simultaneously detecting four pathogenic bacteria and non-diagnostic detection method thereof - Google Patents
Kit for simultaneously detecting four pathogenic bacteria and non-diagnostic detection method thereof Download PDFInfo
- Publication number
- CN105950759B CN105950759B CN201610461677.4A CN201610461677A CN105950759B CN 105950759 B CN105950759 B CN 105950759B CN 201610461677 A CN201610461677 A CN 201610461677A CN 105950759 B CN105950759 B CN 105950759B
- Authority
- CN
- China
- Prior art keywords
- seq
- sequence
- probe
- brucella
- pathogenic bacteria
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kit and a non-diagnostic detection method for simultaneously detecting four pathogenic bacteria, namely Yersinia pestis, Clara fungi, Burkholderia pseudomallei and Brucella by adopting fluorescent quantitative PCR (polymerase chain reaction), wherein the kit comprises specific primers and probes corresponding to the four pathogenic bacteria. The kit provided by the invention is convenient to use, uses few reagents, is low in cost, and has strong detection specificity and high sensitivity; the detection method realizes the detection of four pathogenic bacteria on the same sample, greatly simplifies the operation process, reduces the steps of repeated operation, saves time, reduces the labor force consumed by the repeated operation, effectively saves the cost and realizes rapid screening.
Description
Technical Field
The invention belongs to the field of biotechnology detection, and particularly relates to a kit for simultaneously detecting four pathogenic bacteria, namely Yersinia pestis, Clara fungi, Burkholderia pseudomallei and Brucella and a non-diagnostic detection method thereof.
Background
Yersinia pestis (Yersinia pestis) is gram-negative Bacillus pumilus, which is the pathogenic bacterium of plague, and the transmission of plague between animals and humans is mainly mediated by fleas. After rat fleas suck the blood of rat containing pathogenic bacteria, the bacteria are propagated in flea stomach in large quantity, and when fleas suck the blood again, the pathogenic bacteria are brought into animal or human body. Flea droppings also contain plague bacillus, which can enter the skin because of itching. The transmission mode of 'mouse → flea → human' is the main transmission mode of plague, a few of which can be infected by directly contacting with pollutants of patients, and the plague patients can be transmitted by droplets to cause the pandemic of the plague among people. Plague has four types including glandular type, pulmonary type, septicemia type and mild type clinically, and the general poisoning symptoms in the initial stage of each type are almost the same except mild type. It is mainly used for detecting organs such as liver, lung, lymph tissue and the like.
The tularella (Francisella tularensis) is gram-negative coccobacillus, can cause tularemia (tularemia, called tularemia or harlequin fever for short), is a typical zoonosis, and the pathogenic bacteria are various in transmission path, easy to diffuse and strong in toxicity, and the medium of the tularella in the nature is mainly arthropod such as various ticks, while the host mainly comprises harlequin and wild mouse and the like. In many localities, cases of infection by tick bites are very common, and in recent years there have been increasing reports of "rabbit fever" which is a murine transmission infection of humans, seriously threatening the life safety of humans.
Burkholderia melioidis (Burkholderia pseudomelioidis) is a gram-negative bacillus parasitized in cells, and the melioidosis which can be caused is an important zoonosis disease, and has high pathogenicity and death rate to human beings or animals. The transmission route of gangrene in humans is often a chronic form of disease caused by the entry of infected material into skin abrasions or wounds; infections obtained by deliberate release or aerosol condensation often cause acute nasal gangrene, are untimely to treat, die within days and can serve as a potential biological weapon, which the U.S. CDC lists as a class B bioterrorism agent.
Currently, melioidosis caused by burkholderia pseudomallei has become a worldwide problem (Dance D, 2000), and no vaccine against melioidosis is available. Therefore, the diagnosis can be made timely and accurately, and the method has important significance for improving the cure rate, controlling the spread of infectious bacteria, researching epidemiology and the like.
Brucella (Brucella) is a gram-negative, spore-free, facultative, intracellular parasitic bacterium, which is divided into 6 species according to the variation of antibodies and the main host: brucella melitensis (B.mel strain), Brucella suis (B.sui s), Brucella bovis (B.a bortus), Brucella canis (B.cani s), Brucella ovis (B.ovis), and Brucella murinus forests (B.neotoma). Brucellosis caused by the bacteria is one of five zoonosis infectious diseases causing in the world, can cause acute and chronic acute infections of people and various animals, more than 60 kinds of domestic animals and poultry are known at present, and wild animals are hosts of the brucellosis. The human-related sources of infection are mainly sheep, cattle and pigs, and secondly dogs and mice. The infected animals spread among the same animals to cause bacteria carrying or disease, and then the infected human and animals show symptoms of abortion, infertility and the like. The disease is prevalent around the world (Jonas M et al, 2010) and 123 countries in 160 countries around the world are investigated to have brucellosis, which brings great threat to human life and property.
In conclusion, yersinia pestis, tularella terrestris, burkholderia melitensis and brucella melitensis are four important pathogens of zoonosis, are widely distributed and seriously harmful. Therefore, a method for simultaneously and rapidly detecting the four pathogens is established, and has important significance in the aspects of public health safety, bioterrorism attack, entry-exit inspection and quarantine.
In the prior art, a method for detecting a single pathogen is common, but a detection method capable of simultaneously detecting the four pathogens is rare, and the prior patent publication No. CN101560557 discloses a gene liquid chip for jointly detecting five virulent pathogens and a non-diagnostic detection method thereof. In the detection process, 5 types of coded microspheres are required to be coupled with the capture probe, the microspheres need to be washed and activated, the operation is complex, coupling failure sometimes occurs, the subsequent detection result is invalid, and manpower and material resources are wasted. The adopted suspension chip detection system detects by two beams of red and green lasers, the red laser excites dyes of microsphere matrixes to identify numbers of microspheres, the green laser identifies surface-bound fluorescent dyes, the reagent for coding the microspheres is expensive, the used reagents EDC and streptavidin-phycoerythrin need import reagents, the effect of domestic reagents is poor, instruments are not possessed by common detection units, a high-multiple microbial microscope is needed when a blood cell counter counts the number of the microspheres, and a suspension chip detector is needed when fluorescence is detected, so that the limitation of detecting the pathogens by using a gene liquid phase chip is large, the pathogens can be detected simultaneously, the detection reagent is easy to obtain, and the detection reagent and the detection method are suitable for the existing units to realize the detection purpose.
Disclosure of Invention
In order to solve the technical problems, the invention provides a group of nucleic acids for simultaneously detecting and detecting four pathogenic bacteria, namely Yersinia pestis, Clara fungi, Burkholderia farinae and Brucella. The invention also provides a kit for simultaneously detecting and detecting four pathogenic bacteria, namely Yersinia pestis, Clara fungi, Burkholderia pseudomallei and Brucella melitensis by fluorescent quantitative PCR and a non-diagnostic detection method thereof.
In order to achieve the purpose, the invention adopts the following technical scheme:
a group of nucleic acids for simultaneously detecting four pathogenic bacteria by multiplex PCR comprises upstream and downstream primers of four pathogenic bacteria of Yersinia pestis, Clara, Burkholderia farinae and Brucella, wherein the upstream primer sequence of Yersinia pestis is shown as SEQ ID No.1, and the downstream primer sequence is shown as SEQ ID No. 2;
the sequence of an upstream primer of the tularaemia speciosa is shown as SEQ ID No.5, and the sequence of a downstream primer is shown as SEQ ID No. 6;
the sequence of the upstream primer of the burkholderia melioidis is shown as SEQ ID No.9, and the sequence of the downstream primer is shown as SEQ ID No. 10;
the upstream primer sequence of the Brucella is shown as SEQ ID No.14, and the downstream primer sequence is shown as SEQ ID No. 13.
A group of nucleic acids for simultaneously detecting four pathogenic bacteria by fluorescent quantitative PCR comprises upstream and downstream primers of the four pathogenic bacteria such as Yersinia pestis, Clara, Burkholderia pseudomallei and Brucella as described above and probes corresponding to the pathogenic bacteria,
the probe sequence of the Yersinia pestis is shown in SEQ ID No. 3;
the probe sequence of the tularaemia speciosa is shown as SEQ ID No. 7;
the probe sequence of the burkholderia melioidea is shown as SEQ ID No. 11;
the probe sequence of the Brucella is shown as SEQ ID No. 15.
The nucleic acid as described above, preferably, the set of nucleic acids further comprises a sequence of a positive amplification product comprising detection of four pathogenic bacteria, Yersinia pestis, Clara, Burkholderia pseudomallei and Brucella,
the positive amplification product sequence for detecting Yersinia pestis comprises a sequence shown as SEQ ID No. 4;
the positive amplification product sequence for detecting the tularaemia comprises a sequence shown as SEQ ID No. 8;
the positive amplification product sequence for detecting burkholderia melioidis contains a sequence shown as SEQ ID No. 12;
the positive amplification product sequence for detecting Brucella contains a sequence shown as SEQ ID No. 16.
A kit for simultaneous detection of four pathogenic bacteria by fluorescent quantitative PCR, the kit comprising: the upstream and downstream primers and the corresponding probes of four pathogenic bacteria of Yersinia pestis, Clara terrestris, Burkholderia farci and Brucella melitensis are respectively and correspondingly labeled FAM-BHQ1, Texred-BHQ2, JOE-TAMRA and CY5-BHQ3 at the 5 'end and the 3' end of each probe.
The kit as described above, preferably, further comprises a sequence for detecting positive amplification products of four pathogenic bacteria, Yersinia pestis, Clara terrestris, Burkholderia farinae and Brucella melitensis, wherein,
the positive amplification product sequence for detecting Yersinia pestis comprises a sequence shown as SEQ ID No. 4;
the positive amplification product sequence for detecting the tularaemia comprises a sequence shown as SEQ ID No. 8;
the positive amplification product sequence for detecting burkholderia melioidis contains a sequence shown as SEQ ID No. 12;
the positive amplification product sequence for detecting Brucella contains a sequence shown as SEQ ID No. 16.
The kit as described above, preferably, further comprises Premix EX Taq X2.
A non-diagnostic detection method for simultaneously detecting four pathogenic bacteria by fluorescent quantitative PCR is used for detecting four pathogenic bacteria, namely Yersinia pestis, Clara bacteria, Burkholderia pseudomallei and Brucella, and specifically comprises the following steps:
(1) extracting bacterial DNA from the sample;
(2) performing fluorescent quantitative PCR amplification on the extracted bacterial DNA; wherein, during fluorescent quantitative PCR amplification, in a reaction system, the nucleotide sequences of upstream and downstream primers and probes of Yersinia pestis are shown as SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, and the 5 'end and the 3' end of the probes are respectively and correspondingly labeled with FAM and BHQ 1; the nucleotide sequences of the upstream primer, the downstream primer and the probe of the tularaemia are shown as SEQ ID No.5, SEQ ID No.6 and SEQ ID No.7, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with Texred and BHQ 2; the nucleotide sequences of the upstream primer, the downstream primer and the probe of the burkholderia melioidis are shown as SEQ ID No.9, SEQ ID No.10 and SEQ ID No.11, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with JOE and TAMRA; the nucleotide sequences of the upstream primer, the downstream primer and the probe of the brucella are shown as SEQ ID No.14, SEQ ID No.13 and SEQ ID No.15, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with CY5 and BHQ 3;
(3) collecting fluorescence signals, selecting a fluorescence detection mode of the fluorescent group in the step (2), adjusting a base line, taking 3-15 circulating fluorescence signals, and setting a threshold line by the highest point of the threshold line just exceeding the normal negative control;
(4) and (4) judging a result: and (3) judging the sample to be detected to be positive if the fluorescence increase curve exceeds a threshold line and shows finger increase, and judging the sample to be detected to be negative if no typical amplification curve exists.
The non-diagnostic detection method as described above, preferably, the reaction system of the fluorescent quantitative PCR amplification in step (2) is specifically as follows:
1×Premix EX Taq，
the final concentration of the Yersinia pestis upstream primer is 0.48 mu mol/L, the final concentration of the downstream primer is 0.48 mu mol/L, and the final concentration of the probe is 0.104 mu mol/L; the final concentration of the tularaemia speciosa upstream primer is 0.48 mu mol/L, the final concentration of the downstream primer is 0.48 mu mol/L, and the final concentration of the probe is 0.104 mu mol/L; the final concentration of the forward primer of the burkholderia melioidis is 0.64 mu mol/L, the final concentration of the backward primer is 0.64 mu mol/L, and the final concentration of the probe is 0.136 mu mol/L; the final concentration of the upstream primer of the Brucella is 0.64 mu mol/L, the final concentration of the downstream primer is 0.64 mu mol/L, and the final concentration of the probe is 0.136 mu mol/L;
the DNA of the sample is 1 mu L;
meanwhile, setting water without nuclease as a negative control;
meanwhile, genes comprising a sequence shown as SEQ ID No.4, a sequence shown as SEQ ID No.8, a sequence shown as SEQ ID No.12 and a sequence shown as SEQ ID No.16 are respectively set as positive controls.
The non-diagnostic detection method as described above, preferably, the reaction procedure of the fluorescent quantitative PCR amplification in step (2) is: pre-denaturation stage at 95 deg.C for 5 min; amplification stage 94 ℃, 15 sec; 60 ℃ for 30 sec; 72 ℃, 1min, 45 cycles; 72 ℃ for 10 min; keeping the temperature at 4 ℃.
In the non-diagnostic detection method as described above, preferably, in the determination of the result in the step (4), when the Ct value is less than or equal to 35, a significant amplification curve is a positive result; when the Ct value is more than 40, no obvious amplification curve is a negative result.
The invention provides a nucleic acid group for detecting four pathogenic bacteria, namely Yersinia pestis, Clara bacteria, Burkholderia pseudomallei and Brucella, wherein the nucleic acid group can be used for detecting single pathogenic bacteria and can also be used for multiple amplifications for synchronously detecting several pathogenic bacteria. When the kit is used for synchronously detecting the four pathogenic bacteria, cross reaction does not occur among the pathogenic bacteria through verification, and the kit has high detection sensitivity and strong specificity.
The invention also provides a kit for simultaneously detecting four pathogenic bacteria, namely Yersinia pestis, Clara fungi, Burkholderia pseudomallei and Brucella by fluorescent quantitative PCR, and simultaneously establishes a non-diagnostic method which is relatively efficient and sensitive and can simultaneously detect the four pathogenic bacteria. The method can effectively improve the detection sensitivity and avoid the occurrence of false negative results. The provided detection kit is convenient to use, simple and convenient to operate, high in automation degree, capable of effectively replacing traditional pathogen isolation culture to obtain a detection result, few in reagent used by the kit, low in cost, capable of greatly simplifying the operation process, reducing the repeated operation process, reducing pollution in the operation process, avoiding excessive labor force consumption caused by repeated operation, saving time, effectively saving cost, and capable of realizing rapid screening, and the used kit is good in detection effect, strong in specificity and high in sensitivity.
The detection method provided by the invention adopts the operation of completely closing the tube, is simple, convenient and quick to operate, obtains a quantitative result by directly detecting the change of a fluorescent signal in the PCR process, does not need common PCR post-treatment or electrophoresis detection, overcomes the defects of easy pollution and false positive occurrence of the conventional PCR technology, can effectively avoid the difficulty of nonspecific amplification, and is suitable for screening and detecting large-batch samples.
The kit provided by the invention has higher detection sensitivity, can realize the investigation of four pathogenic bacteria by detecting 1 sample, mainly detects whether the sample to be detected contains the nucleic acid of the four pathogenic bacteria, namely Yersinia pestis, Clara terrestris, Burkholderia melissii and Brucella melitensis, and does not aim at the disease diagnosis. The diagnosis of general diseases can be confirmed only by comprehensively evaluating the symptoms of patients, and the detection method only checks whether the nucleic acid of corresponding pathogenic bacteria exists or not and belongs to non-diagnostic detection. The detection method can help to discover carriers infected with the four pathogenic bacteria in advance, latent infectors with no disease symptoms and no morbidity, and provides effective technical support for timely and effectively controlling the transmission and diffusion of the four pathogenic bacteria, namely Yersinia pestis, Clara terrestris, Burkholderia pseudomallei and Brucella.
Drawings
FIG. 1 is a diagram showing the results of the sensitivity test for detecting Yersinia pestis when four pathogenic bacteria are simultaneously detected by the fluorescent quantitative PCR of the present invention.
FIG. 2 is a diagram showing the results of the sensitivity test for detecting tulathelia bacteria when four pathogenic bacteria are simultaneously detected by the fluorescent quantitative PCR of the present invention.
FIG. 3 is a graph showing the results of the sensitivity test for detecting Burkholderia meliloti when four pathogenic bacteria are simultaneously detected by the fluorescent quantitative PCR of the present invention.
FIG. 4 is a diagram showing the results of the sensitivity test for detecting Brucella in the case of simultaneous detection of four pathogenic bacteria by fluorescent quantitative PCR.
FIG. 5 is a standard curve diagram of the fluorescent quantitative PCR of the present invention for simultaneous detection of four pathogenic bacteria.
Detailed Description
The present invention is further described in detail with reference to the following specific examples, which are not intended to limit the invention, the embodiments of the present invention are not limited thereto, the complementary sequences of the nucleotide sequences provided by the present invention can also implement the present invention, and the reagents used are conventional reagents unless otherwise specified, and therefore all equivalent substitutions in the art made in accordance with the present disclosure are within the scope of the present invention.
Example 1 design of primers and probes
Firstly, respectively screening specific target genes of four pathogenic bacteria, downloading a plurality of pathogenic bacteria gene sequences from GenBank for each pathogenic bacteria according to the detection purpose, carrying out comparison analysis, selecting a conserved region, and designing an amplification primer and a hybridization probe suitable for a fluorescent quantitative PCR reaction system by adopting the aid of Array design 4.0 software.
Because the invention is a multiple fluorescence quantification, firstly, the selection of the probe label is more critical, secondly, the probe designed by software is screened, the probe signals of four genes can not interfere with each other, and therefore, the four pairs of primers and the four probes can not interfere with each other when the probe is designed.
The fluorescent quantitative PCR detection is based on the common PCR detection, and further passes through a specific fluorescent probe which is an oligonucleotide, and two ends of the probe are respectively marked with a reporter fluorescent group and a quenching fluorescent group. When the probe is complete, the fluorescent signal emitted by the reporter group is absorbed by the quenching group; during PCR amplification, the 5 '-3' exonuclease activity of Taq enzyme cuts and degrades the probe, so that the reporter fluorescent group and the quenching fluorescent group are separated, a fluorescence monitoring system can receive a fluorescence signal, namely, one fluorescent molecule is formed when one DNA chain is amplified, and the accumulation of the fluorescence signal and the formation of a PCR product are completely synchronous. Therefore, the precondition of the fluorescent quantitative PCR detection is to perform PCR amplification reactions, cross reactions between primers and products of the amplification reactions need to be avoided as much as possible, and cross reactions between the specific probe and each amplification product and each primer are further ensured. In addition, because the invention is a multiplex fluorescence quantification, the selection of the probe label is more critical, and not only the probes designed by software need to be screened, but also the probe signals of the four genes can not interfere with each other.
A plurality of primer sequences and hybridization probe sequences specific to four pathogenic bacteria, namely Yersinia pestis, Clara, Burkholderia melioides and Brucella are respectively designed, NCBI Blast online analysis software (http:// www.ncbi.nlm.nih.gov/Blast) is adopted to analyze and evaluate sequence homology and adaptability of a probe and a primer combination to be selected, and detection tests verify that the primers and the probe combination which are specific to the four pathogenic bacteria and are suitable for a multiple fluorescence quantitative reaction system are finally selected.
It should be noted that, in the design, the design principle of the ordinary PCR primer is not suitable for the design of the fluorescent quantitative PCR primer, and the design requirement of the fluorescent quantitative PCR primer is more strict than that of the ordinary PCR primer, but the fluorescent quantitative PCR primer is certainly applicable to the ordinary PCR amplification reaction.
The amplification primers designed for each pathogen are firstly used for carrying out amplification detection on a single pathogen, and then amplification of multiple pathogens is carried out after confirming that the amplification detection on the single pathogen has no non-specific amplification, the primers are designed to avoid cross reaction as much as possible, the amplification conditions are considered to be consistent as much as possible, and finally the cross reaction is eliminated through the hybridization reaction; the following sequences were determined based on the above design, bioinformatic analysis and the inventors' empirical design and screening results of a number of experimental tests:
yersinia pestis specific amplification primer pairs and probes: the specific amplification primer pair shown as SEQ ID No.1 and SEQ ID No.2 and the hybridization probe sequence shown as SEQ ID No.3 are as follows:
SEQ IDNo.1：5′-atgtcacacctaatgccaaagtctt-3′
SEQ IDNo.2：5′-gccaatagagacagaatctccacta-3′
SEQ IDNo.3：5′-cagtaaatatgatgagggcaaaggaggtactc-3′
and (3) a specific amplification primer pair and a probe of tularaemia: the specific amplification primer pair shown as SEQ ID No.5 and SEQ ID No.6 and the specific probe sequence shown as SEQ ID No.7 are as follows:
SEQ IDNo.5：5′-ttggtagatcagttggtggga-3′
SEQ IDNo.6：5′-agctactttactatcatgag-3′
SEQ IDNo.7：5′-cctaaagcatcagtcatagcatgg-3′；
b: the specific amplification upstream and downstream primers shown as SEQ ID No.9 and SEQ ID No.10 and the hybridization probe sequence shown as SEQ ID No.11 are as follows:
SEQ IDNo.9：5′-cggaaaaagagccgacacgcgtct-3′
SEQ IDNo.10：5′-ggtcagtatccgtaacagcttcat-3′
SEQ IDNo.11：5′-cgtgcacaccggtcagtatc-3′。
brucella subtype specific amplification primer pairs and hybridization probes: specific amplification primer pairs shown as SEQ ID No.13 and SEQ ID No.14 and specific probe sequences shown as SEQ ID No.15, specifically as follows:
SEQ IDNo.13：5′-cgcgcttgcctttcaggtctg-3′
SEQ IDNo.14：5′-tggctcggttgccaatattca-3′
SEQ IDNo.15：5′-accgatttgatgtttgcatccttacgc-3′。
in the invention, the design of the probe is particularly critical, the probe can be selected among fragments amplified by the primer, but the probe can not form primer dimer, otherwise, false negative detection results can be caused, when the probe is used for detecting multiple pathogenic bacteria, cross reaction exists among the fragments which can not be subjected to multiple detection, and otherwise, false positive results can be caused. The probes are designed such that the maximum fluorescence emission wavelength of the reporter group of each pathogen probe is in a different spectral range to ensure that the detection channel of the quantitative fluorescence PCR instrument can distinguish the probes of each pathogen. Therefore, in addition to using primer select software to evaluate, and ensure that the multiplex reaction is theoretically matched as much as possible, the design should be made with appropriate adjustment of primer and probe concentrations according to the amplification curve of the reaction until the optimal amplification curve is amplified.
The four fluorescent dyes selected by the invention, namely FAM, JOE, Texred and CY5, have the wavelengths in different spectral ranges, cannot interfere with each other, and have obvious distinguishing effect and signal intensity.
A large number of experiments prove that when the primers and the probes are adopted, the primers and the probes can be independently used for detecting the corresponding pathogenic bacteria, and the 5 'end and the 3' end of the probes can be respectively selected from the markers FAM-BHQ1, Texred-BHQ2, JOE-TAMRA and CY5-BHQ 3. However, when four pathogenic bacteria are simultaneously detected, the labeling of each probe shall be used for labeling the four combination relations, that is, FAM-BHQ1, Texred-BHQ2, JOE-TAMRA and CY5-BHQ3 are respectively used for labeling Yersinia pestis probes, Clara terrestris probes, Burkholderia melini-like probes and Brucella probes, and the labels of the 5 'end and the 3' end of each probe are not overlapped, but can be randomly combined, and the detection result is that when a single pathogenic bacteria is detected, other fluorescent groups such as VIC, NED and the like can be used as luminescent groups, and BHQ and MGB and the like can be used as non-fluorescent quenching groups.
Specifically, in the present invention, the 5' fluorescent dye label of the probe depends on the configuration of the real-time fluorescent PCR instrument used, and the first to fourth detection assays are labeled with FAM, Texred, JOE and Cy5, respectively, as exemplified by ABI7500(Applied biosystem) fluorescent quantitative PCR instrument. The first detection channel detects Yersinia pestis, and the detection wavelength of the fluorescent dye is about 520 nm; the second detection channel detects tularaemia, and the detection wavelength of the fluorescent dye is about 580 nm; the third detection channel detects burkholderia melioidis, and the detection wavelength of the fluorescent dye is about 550 nm; the fourth detection channel detects brucella, and the detection wavelength of the fluorescent dye is about 650 nm. The following examples illustrate the invention using the most preferred examples.
Example 2 general PCR detection of four pathogenic bacteria Yersinia pestis, Clara terrestris, Burkholderia pseudomallei and Brucella
A pair of oligonucleotide sequences (primers) and a probe were designed according to example 1 to screen the conserved sequence of the Pla gene fragment of Yersinia pestis. Finally, the size of the amplified fragment of the Yersinia pestis primer is determined to be 113bp, and the nucleotide sequence is shown as SEQ ID No. 4.
SEQ IDNo.4：atgtcacacc taatgccaaa gtctttgcgg aatttacata cagtaaatat gatgagggca aaggaggtac tcagatcatt gataagaata gtggagattc tgtctctatt ggc。
The tularaemia strain selects ISFtu2 gene, the size of the primer amplified fragment is 113bp, and the nucleotide sequence is shown as SEQ ID No. 8.
SEQ IDNo.8：agctacttta ctatcatgag ttttaccttc tgacaacaat atttctattg gattacctaaagcatcagtc atagcatgga ttttagtggt tatcccacca actgatctac caa。
The burkholderia melioidis selects ttsS gene, the size of primer amplified fragment is 124bp, and the nucleotide sequence is shown as SEQ ID No. 12.
SEQ IDNo.12：cggaaaaaga gccgacacgc gtctctatac tgtcgagcaa tcggcggata tccggaatct ggatcaccac cactttccgt ccttgccctg gaatgagacc atgaagctgt tacggatactgacc。
The Brucella is BCSP31 gene, the size of the primer amplified fragment is 224bp, and the nucleotide sequence is shown as SEQ ID No. 16.
SEQ IDNo.16：ggctcggtt gccaatatca atgcgatcaa gtcgggcgct ctggagtccg gctttacgca gtcagacgtt gcctattggg cctataacgg caccggcctt tatgatggcaagggcaaggtggaagatttg cgccttctgg cgacgcttta cccggaaacg atccatatcg ttgcgcgtaa ggatgcaaacatcaaatcgg tcgcagacct gaaaggcaag cgcg。
The designed primer pair is applied to simultaneously carry out common PCR amplification on four pathogenic bacteria, namely Yersinia pestis, Clara bacteria, Burkholderia melioides and Brucella melitensis, and a Premix EX Taq multiplied by 2 and 25 mu L reaction system of Takara bioengineering (Dalian) Co., Ltd is adopted: 1.25. mu.L of each upstream and downstream primer; premix EX Taq X212.5. mu.L; the template was 1. mu.L, and the remainder was made up with nuclease-free water.
The PCR amplification reaction conditions are preferably:
reaction conditions are as follows: pre-denaturation stage at 95 deg.C for 5 min; amplification stage 94 ℃, 15 sec; 60 ℃ for 30 sec; 72 ℃, 1min, 45 cycles; 72 ℃ for 10 min; keeping the temperature at 4 ℃.
Wherein, the detection of positive and negative control samples is provided, and the negative control is nuclease-free water; the positive control is plasmid DNA carrying sequences shown in sequence tables SEQ ID No.4, SEQ ID No.8, SEQ ID No.12 and SEQ ID No. 16.
Electrophoresis is carried out on the amplification product, and the result shows that the designed primer can effectively amplify the positive bands corresponding to Yersinia pestis, Clara, Burkholderia pseudomallei and Brucella.
Example 3 fluorescent quantitative PCR detection kit for four pathogenic bacteria
The fluorescent quantitative PCR detection kit for four pathogenic bacteria, namely Yersinia pestis, Clara bacteria, Burkholderia pseudomallei and Brucella comprises the following components:
Premix EX Taq×2；
the upstream primer sequence of Yersinia pestis is shown as SEQ ID No.1, the downstream primer sequence is shown as SEQ ID No.2, the probe sequence is shown as SEQ ID No.3, the 5 'marker FAM of the probe SEQ ID No.3 and the 3' marker BHQ 1;
the sequence of an upstream primer of the tularaemia is shown as SEQ ID No.5, the sequence of a downstream primer is shown as SEQ ID No.6, the sequence of a probe is shown as SEQ ID No.7, wherein the 5 'of the probe SEQ ID No.7 is marked with Texred, and the 3' of the probe SEQ ID No.7 is marked with BHQ 2;
the sequence of an upstream primer of the burkholderia melioidis is shown as SEQ ID No.9, the sequence of a downstream primer is shown as SEQ ID No.10, the sequence of a probe is shown as SEQ ID No.11, wherein the 5 'of the probe SEQ ID No.11 is marked with JOE, and the 3' of the probe is marked with TAMRA;
the sequence of the downstream primer of the Brucella is shown as SEQ ID No.13, the sequence of the upstream primer is shown as SEQ ID No.14, the sequence of the probe is shown as SEQ ID No.15, wherein the probe SEQ ID No.15 is marked with CY5 at the 5 'position, and is marked with BHQ3 at the 3' position.
Furthermore, in order to avoid the failure or pollution of the used reagent, a positive control reagent and a negative control reagent are arranged, and the negative control adopts nuclease-free water;
the positive control adopts plasmid DNA carrying amplification products, and the nucleotide sequences of the amplification products are respectively shown as SEQ ID No.4, SEQ ID No.8, SEQ ID No.12 and SEQ ID No. 16.
The design of negative control can effectively verify whether the used reagent is polluted or not, so that false positive is avoided, and the design of positive control can effectively verify the effectiveness of the used reagent, so that false negative is avoided.
Wherein the Premix EX Taq X2, nuclease-free water is available from Takara Bio Inc.; the primers, probes, and plasmids were synthesized by Weijie fundi (Shanghai) trade Limited.
Example 4 fluorescent quantitative PCR method for simultaneously detecting four pathogenic bacteria
The method for simultaneously detecting four pathogenic bacteria, namely Yersinia pestis, Clara bacteria, Burkholderia pseudomallei and Brucella by adopting fluorescent quantitative PCR comprises the following steps:
(1) pathogenic bacteria DNA extraction
Extraction of pathogen DNA, i.e., extraction of sample DNA, can be performed using Qiagen DNA extraction reagents (e.g., Qiagen reagents, Inc., available from Qiagen).
(2) Fluorescent quantitative PCR amplification
The reaction system was prepared using the kit prepared in example 3, and 25. mu.L of the reaction system: yersinia pestis, tularella terrestris final concentration of upstream and downstream primers 0.48. mu. mol/L, probe concentration 0.104. mu. mol/L, Burkholderia melioides and Brucella melitensis final concentration 0.64. mu. mol/L, probe final concentration 0.136. mu. mol/L, Premix EX Taq X2 added to 12.5. mu.L, each sample extracted DNA added to 1. mu.L.
When positive control is set, the sample DNA is replaced by plasmid containing positive amplification sequence of each pathogenic bacterium, and when negative control is set, the sample DNA is replaced by nuclease-free water.
Amplification conditions: the following amplification conditions are preferred:
pre-denaturation stage at 95 deg.C for 5 min; amplification stage 94 ℃, 15 sec; 60 ℃ for 30 sec; 72 ℃, 1min, 45 cycles; 72 ℃ for 10 min; keeping the temperature at 4 ℃.
(3) Collecting fluorescence signal signals, respectively selecting fluorescence detection modes of FAM, Texred, JOE and Cy5, adjusting a base line, taking 3-15 cycles of fluorescence signals, and setting a threshold line with the highest point of the threshold line just exceeding the normal negative control;
(4) and (4) judging a result: the fluorescence increase curve of the sample to be detected exceeds a threshold value line and shows good logarithmic increase, the sample to be detected is judged to be positive, if no typical amplification curve exists, the sample to be detected is judged to be negative, in the specific embodiment, the threshold value is 35, and when the Ct value is less than or equal to 35, an obvious amplification curve is a positive result; ct value > 40, no obvious amplification curve is negative result.
Example 5 detection of sensitivity of the kit of the invention
Respectively suspending the thallus of Yersinia pestis, Clara terrestris and Brucella with physiological saline to obtain bacterial suspension with concentration of 10 when OD600 is 0.6-0.88Based on the cfu/mL, 10-fold serial dilution is carried out by using sterile physiological saline until the concentration is 10cfu/mL, and the concentration of the thallus is 101～106Several dilution gradients of cfu/mL, plating counts were performed, plating plates at each concentration, and incubation at 26 ℃; at the same time, serial diluted bacteria solution (concentration is 10)1～106cfu/mL), heating at 100 deg.C for 10min, centrifuging at 12000rpm for 3min, using the supernatant as a template for quantitative PCR reaction, mixing 1 μ L each, and adding into the reaction system.
The kit prepared in example 3 was used to detect four pathogenic bacteria, Yersinia pestis, Clara terrestris, Burkholderia pseudomallei and Brucella, wherein,
1) NTC: nuclease-free water;
the reaction system adopts 25 mul reaction system, which is composed of 12.5 mul Premix EX Taq multiplied by 2, the upstream and downstream primers (20 mul) of Yersinia pestis and tularella are all 0.6 mul, and the upstream and downstream primers (20 mul) of Burkholderia melioides and Brucella are all 0.8 mul; yersinia pestis, tularella probe (20. mu.M) 0.13. mu.L, Burkholderia melioides and Brucella probe (20. mu.M) 0.17. mu.L, sample DNA 1.25. mu.L. The sample DNA is detected by adopting the diluted positive template, and the amplification conditions are preferably as follows: 95-10 min; 95-15 s, 60-60 s; 45 cycles. Real-time fluorescent quantitative PCR detection was performed on an ABI7500PCR instrument.
2) Three replicates were made for each gradient.
And (4) judging a result: the Ct value is less than or equal to 35, an obvious amplification curve is a positive result, and the Ct value is more than 40, and no obvious amplification curve is a negative result.
The fluorescence value chart of the detection results, wherein the sensitivity test result of Yersinia pestis is shown in FIG. 1, the sensitivity test result of Clara fungi is shown in FIG. 2, the sensitivity test result of Burkholderia pseudomallei is shown in FIG. 3, and the sensitivity test result of Brucella is shown in FIG. 4. The sensitivity of the method for detecting Yersinia pestis, Clara, Burkholderia pseudomallei and Brucella is respectively 100cfu/mL, 140cfu/mL, 80cfu/mL and 60 cfu/mL.
As can be seen from the standard curve chart 5, the amplification slopes of the four pathogenic bacteria, Yersinia pestis, Clara terrestris, Burkholderia farinae and Brucella melitensis, are-3.045, -3.238, -3.099 and-3.47, respectively. According to the formula of amplification efficiency E of 10-1/k-1, the amplification efficiencies are respectively calculated to be 112.8%, 103.7%, 109.8% and 94.1%, and the amplification efficiencies are within the theoretical fluctuation range (90% < R2< 120%), so that the method has good amplification effects. The r values are 0.998, 0.995, 0.99 and 0.997 respectively, and the linear relation is good.
Example 6 specific detection of the kit of the invention
1) Extracting DNA of the strains in the following table, extracting liver tissue DNA by using a QiagenDNA extraction kit, wherein the strains in the table are provided by the health quarantine research institute of Chinese inspection and quarantine science;
2) negative control: nuclease-free water;
3) template: DNA of 9 positive strains and 20 homologous strains extracted in the step 1 is used as a template,
4) the reaction system was prepared as in example 4, and then subjected to fluorescent quantitative PCR amplification.
The detection results are shown in the following table 1, 9 positive strains are positive, 20 homologous strains are negative, and the results show that the established fluorescent quantitative PCR method for the four pathogenic bacteria has strong specificity.
TABLE 1 test results
Example 7: detection of samples Using the kit of the invention
The livers of 3 healthy BALB/C mice weighing about 20g were harvested and injected into 0.05ml of each of four pathogenic bacteria (0.45X 10) per 1g of liver6cfu/mL thalli), standing for 1 hour at room temperature, extracting liver tissue DNA by using a QiagenDNA extraction kit as a detection template, wherein the specific DNA extraction operation is described in the kit specification. The kit provided by the invention is used for detecting the pathogenic bacteria extracting solution. The result of the rat liver simulation DNA sample detected by the method described in example 4 shows that Yersinia pestis, Clara, Burkholderia pseudomallei and Brucella all have obvious amplification curves and positive results show that the detection methodThe kit has good applicability to the detection of samples, and the detection is carried out in an ABI7500 fluorescence quantitative PCR instrument.
Claims (9)
1. A group of nucleic acids for fluorescence quantitative PCR simultaneous detection of four pathogenic bacteria is characterized by comprising upstream and downstream primers of Yersinia pestis, Clara, Burkholderia pseudomallei and Brucella and probes corresponding to the pathogenic bacteria, wherein the upstream primer sequence of Yersinia pestis is shown as SEQ ID No.1, and the downstream primer sequence is shown as SEQ ID No. 2;
the sequence of an upstream primer of the tularaemia speciosa is shown as SEQ ID No.5, and the sequence of a downstream primer is shown as SEQ ID No. 6;
the sequence of the upstream primer of the burkholderia melioidis is shown as SEQ ID No.9, and the sequence of the downstream primer is shown as SEQ ID No. 10;
the upstream primer sequence of the Brucella is shown as SEQ ID No.14, and the downstream primer sequence is shown as SEQ ID No. 13;
the probe sequence of the Yersinia pestis is shown in SEQ ID No. 3;
the probe sequence of the tularaemia speciosa is shown as SEQ ID No. 7;
the probe sequence of the burkholderia melioidea is shown as SEQ ID No. 11;
the probe sequence of the Brucella is shown as SEQ ID No. 15.
2. The nucleic acid of claim 1, wherein the set of nucleic acids further comprises a sequence of positive amplification products comprising detection of four pathogenic bacteria, Yersinia pestis, Clara, Burkholderia pseudomallei, and Brucella,
the positive amplification product sequence for detecting Yersinia pestis comprises a sequence shown as SEQ ID No. 4;
the positive amplification product sequence for detecting the tularaemia comprises a sequence shown as SEQ ID No. 8;
the positive amplification product sequence for detecting burkholderia melioidis contains a sequence shown as SEQ ID No. 12;
the positive amplification product sequence for detecting Brucella contains a sequence shown as SEQ ID No. 16.
3. A kit for simultaneously detecting four pathogenic bacteria by fluorescent quantitative PCR, which is characterized by comprising: the Yersinia pestis, Clara neri, Burkholderia pseudomallei and Brucella as claimed in claim 1, wherein the 5 'end and 3' end of each probe are labeled FAM-BHQ1, Texred-BHQ2, JOE-TAMRA and CY5-BHQ 3.
4. The kit of claim 3, further comprising a sequence of positive amplification products for detecting four pathogenic bacteria, Yersinia pestis, Clara, Burkholderia pseudomallei, and Brucella,
the positive amplification product sequence for detecting Yersinia pestis comprises a sequence shown as SEQ ID No. 4;
the positive amplification product sequence for detecting the tularaemia comprises a sequence shown as SEQ ID No. 8;
the positive amplification product sequence for detecting burkholderia melioidis contains a sequence shown as SEQ ID No. 12;
the positive amplification product sequence for detecting Brucella contains a sequence shown as SEQ ID No. 16.
5. The kit of claim 3, further comprising Premix EX Taq x 2.
6. A non-diagnostic detection method for simultaneously detecting four pathogenic bacteria by fluorescent quantitative PCR is characterized in that the method is used for detecting four pathogenic bacteria, namely Yersinia pestis, Clara, Burkholderia pseudomallei and Brucella, and specifically comprises the following steps:
(1) extracting bacterial DNA from the sample;
(2) performing fluorescent quantitative PCR amplification on the extracted bacterial DNA; wherein, during fluorescent quantitative PCR amplification, in a reaction system, the nucleotide sequences of upstream and downstream primers and probes of the Yersinia pestis are shown as SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, and the 5 'end and the 3' end of the probes are respectively and correspondingly marked with FAM and BHQ 1; the nucleotide sequences of the upstream primer, the downstream primer and the probe of the tularaemia are shown as SEQ ID No.5, SEQ ID No.6 and SEQ ID No.7, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with Texred and BHQ 2; the nucleotide sequences of the upstream primer, the downstream primer and the probe of the burkholderia melioidis are shown as SEQ ID No.9, SEQ ID No.10 and SEQ ID No.11, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with JOE and TAMRA; the nucleotide sequences of the upstream primer, the downstream primer and the probe of the brucella are shown as SEQ ID No.14, SEQ ID No.13 and SEQ ID No.15, and the 5 'end and the 3' end of the probe are respectively and correspondingly marked with CY5 and BHQ 3;
(3) collecting fluorescence signals, selecting a fluorescence detection mode of the fluorescent group in the step (2), adjusting a base line, taking 3-15 circulating fluorescence signals, and setting a threshold line by the highest point of the threshold line just exceeding the normal negative control;
(4) and (4) judging a result: and if the fluorescence increase curve of the sample to be detected exceeds a threshold value line and shows exponential increase, judging the sample to be detected to be positive, and if no typical amplification curve exists, judging the sample to be detected to be negative.
7. The non-diagnostic test method according to claim 6, wherein the reaction system for the fluorescent quantitative PCR amplification in step (2) is as follows:
1×Premix EX Taq，
the final concentration of the Yersinia pestis upstream primer is 0.48 mu mol/L, the final concentration of the downstream primer is 0.48 mu mol/L, and the final concentration of the probe is 0.104 mu mol/L; the final concentration of the tularaemia speciosa upstream primer is 0.48 mu mol/L, the final concentration of the downstream primer is 0.48 mu mol/L, and the final concentration of the probe is 0.104 mu mol/L; the final concentration of the forward primer of the burkholderia melioidis is 0.64 mu mol/L, the final concentration of the backward primer is 0.64 mu mol/L, and the final concentration of the probe is 0.136 mu mol/L; the final concentration of the upstream primer of the Brucella is 0.64 mu mol/L, the final concentration of the downstream primer is 0.64 mu mol/L, and the final concentration of the probe is 0.136 mu mol/L;
the DNA of the sample is 1 mu L;
meanwhile, setting water without nuclease as a negative control;
meanwhile, genes comprising a sequence shown as SEQ ID No.4, a sequence shown as SEQ ID No.8, a sequence shown as SEQ ID No.12 and a sequence shown as SEQ ID No.16 are respectively set as positive controls.
8. The non-diagnostic test method according to claim 6, wherein the reaction procedure of the fluorescent quantitative PCR amplification in step (2) is as follows: pre-denaturation stage at 95 deg.C for 5 min; amplification stage 94 ℃, 15 sec; 60 ℃ for 30 sec; 72 ℃, 1min, 45 cycles; 72 ℃ for 10 min; keeping the temperature at 4 ℃.
9. The non-diagnostic test method according to claim 6, wherein in the determination of the result in step (4), when the Ct value is less than or equal to 35, a significant amplification curve is a positive result; when the Ct value is more than 40, no obvious amplification curve is a negative result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610461677.4A CN105950759B (en) | 2016-06-23 | 2016-06-23 | Kit for simultaneously detecting four pathogenic bacteria and non-diagnostic detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610461677.4A CN105950759B (en) | 2016-06-23 | 2016-06-23 | Kit for simultaneously detecting four pathogenic bacteria and non-diagnostic detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105950759A CN105950759A (en) | 2016-09-21 |
| CN105950759B true CN105950759B (en) | 2019-12-24 |
Family
ID=56904135
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610461677.4A Active CN105950759B (en) | 2016-06-23 | 2016-06-23 | Kit for simultaneously detecting four pathogenic bacteria and non-diagnostic detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105950759B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107723374A (en) * | 2017-01-18 | 2018-02-23 | 内蒙古农业大学 | A kind of identification experiment kit and its detection method of animal cattle and sheep brucella |
| CN106995855B (en) * | 2017-05-27 | 2020-04-14 | 广州医科大学附属第三医院 | Primer and kit for detecting burkholderia melioidea |
| CN110714091A (en) * | 2019-12-04 | 2020-01-21 | 军事科学院军事医学研究院军事兽医研究所 | Nucleic acid duplex detection test strip for Brucella and tubercle bacillus |
| CN110734993A (en) * | 2019-12-04 | 2020-01-31 | 军事科学院军事医学研究院军事兽医研究所 | nucleic acid detection test paper strip for distinguishing Brucella vaccine strain S19 from naturally infected strain |
| CN113046452B (en) * | 2021-03-23 | 2022-02-25 | 中国人民解放军陆军军医大学 | Composition for detecting Boeck hollandia farci and application thereof |
| WO2023077489A1 (en) * | 2021-11-06 | 2023-05-11 | 江汉大学 | Mnp marker combination of yersinia pestis, primer pair combination, kit, and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134594A (en) * | 2010-12-23 | 2011-07-27 | 中国人民解放军南京军区军事医学研究所 | Primer and probe sequences and method for detecting Bacillus anthracis, Yersinia pestis and legionella pneumophilia through multiple real-time fluorescence polymerase chain reaction (PCR) |
| CN102191338A (en) * | 2010-12-24 | 2011-09-21 | 中国检验检疫科学研究院 | Fluorescence quantitative polymerase chain reaction (PCR) new method for detecting multiple viruses of yellow fever, dengue fever and epidemicencephalitis B and multiple virus detection PCR system |
| CN101560557B (en) * | 2009-03-04 | 2012-07-04 | 中国检验检疫科学研究院 | Genetic liquid phase chip for joint detection of five drastic pathogenic bacteria and detection method thereof |
| WO2013173491A1 (en) * | 2012-05-15 | 2013-11-21 | The Translational Genomics Research Institute | Primers, assays and methods for detecting burkholderia pseudomallei and burkholderia mallei |
-
2016
- 2016-06-23 CN CN201610461677.4A patent/CN105950759B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101560557B (en) * | 2009-03-04 | 2012-07-04 | 中国检验检疫科学研究院 | Genetic liquid phase chip for joint detection of five drastic pathogenic bacteria and detection method thereof |
| CN102134594A (en) * | 2010-12-23 | 2011-07-27 | 中国人民解放军南京军区军事医学研究所 | Primer and probe sequences and method for detecting Bacillus anthracis, Yersinia pestis and legionella pneumophilia through multiple real-time fluorescence polymerase chain reaction (PCR) |
| CN102191338A (en) * | 2010-12-24 | 2011-09-21 | 中国检验检疫科学研究院 | Fluorescence quantitative polymerase chain reaction (PCR) new method for detecting multiple viruses of yellow fever, dengue fever and epidemicencephalitis B and multiple virus detection PCR system |
| WO2013173491A1 (en) * | 2012-05-15 | 2013-11-21 | The Translational Genomics Research Institute | Primers, assays and methods for detecting burkholderia pseudomallei and burkholderia mallei |
Non-Patent Citations (4)
| Title |
|---|
| Development of a Multitarget Real-Time TaqMan PCR Assay for;Versage JL等;《J Clin Microbiol》;20031230;第41卷(第12期);摘要和第5493页表1 * |
| 中国土拉弗朗西斯菌B型亚种新亚型的发现与溯源分析;王艳华等;《中华预防医学杂志》;20151130;第49卷(第11期);全文 * |
| 五种生物恐怖细菌基因悬浮芯片多重检测方法的建立;文海燕等;《四川大学学报(医学版)》;20090315;第40卷(第2期);全文 * |
| 类鼻疽伯克霍尔德菌Ⅲ型分泌系统蛋白BsaL 的制备和免疫反应性分析;方瑶等;《第三军医大学学报》;20160330;第38卷(第6期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105950759A (en) | 2016-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105950759B (en) | Kit for simultaneously detecting four pathogenic bacteria and non-diagnostic detection method thereof | |
| CN112522429B (en) | Method and reagent set for detecting bacillus anthracis by RPA (reverse transcriptase polymerase chain reaction) combined CRISPR (clustered regularly interspaced short palindromic repeats) technology | |
| Tao et al. | Application of CRISPR-Cas12a enhanced fluorescence assay coupled with nucleic acid amplification for the sensitive detection of African swine fever virus | |
| CN111394490B (en) | CRISPR-Cas12a detection primer group for eupolyphaga and application thereof | |
| CN107299155B (en) | Primer and probe for real-time fluorescence quantitative PCR detection of goose astrovirus | |
| CN111074000B (en) | Triple fluorescence quantitative PCR detection material and kit for distinguishing ASFV wild strain from double gene deletion strain | |
| Prescott et al. | Rapid detection of Cyprinid herpesvirus 3 in latently infected koi by recombinase polymerase amplification | |
| CN109136410B (en) | LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method for feline panleukopenia virus | |
| CN113308577B (en) | Visual rapid nucleic acid detection method for bovine sarcoidosis virus | |
| KR102338861B1 (en) | PNA Probe and Primer for Detecting SARS-CoV-2 Causing Covid-19 Using RT-LAMP and Method for Detecting SARS-CoV-2 Infection Using Thereof | |
| CN107988427A (en) | Prawn hepatopancreatic parvovirus（HPV）RAA constant temperature fluorescence detection method and reagent | |
| CN113046484B (en) | Primer probe, kit and method for detecting African swine fever virus p72 gene | |
| CN107400736A (en) | The type adenovirus ring mediated isothermal amplification detection primer group of duck 2 and kit | |
| Wang et al. | Development of a naked eye CRISPR-Cas12a and-Cas13a multiplex point-of-care detection of genetically modified swine | |
| CN109439801A (en) | A kind of honeybee Israel acute paralysis virus real-time fluorescent RT-PCR detection reagent box and its detection method | |
| CN116814857A (en) | Cat parvovirus and kit thereof and fluorescent recombinase polymerase amplification method | |
| CN107604101B (en) | Novel pigeon adenovirus real-time fluorescent quantitative PCR detection kit | |
| Selim et al. | Development of real time reverse transcription loop-mediated isothermal amplification assay for rapid detection of genotype VII of Newcastle disease viruses | |
| US20180371527A1 (en) | Detection of live attenuated influenza vaccine viruses | |
| CN106521038A (en) | High-sensitivity BHV-2 (bovine herpes virus 2) quantitative real-time PCR (polymerase chain reaction) detection method and kit | |
| CN111778343A (en) | Primer pair and kit for detecting Brucella S2 vaccine strain and application of primer pair and kit | |
| KR102009326B1 (en) | DEVELOPMENT OF SINGLEPLEX REAL-TIME PCR KIT FOR RAPID DETECTION OF CLOSTRIDIUM PERFRINGENS USING cpa, cpe TARGET GENE | |
| Ji et al. | Simple and visible detection of novel Astroviruses causing fatal gout in goslings using one-step reverse transcription polymerase spiral reaction method | |
| Kim et al. | Diagnostic performance of cross-priming amplification-based lateral flow assay (CPA-LFA) and real-time PCR for koi herpesvirus (KHV) detection | |
| KR20200059766A (en) | Development of a Singleplex Real-Time PCR Kit for Rapid Detection of Campylobacter coli ceuE target gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |