CN105950637A - Trehalose-6-phosphate synthase gene of Litopenaeus vannamei and detection and application of trehalose-6-phosphate synthase gene of Litopenaeus vannamei - Google Patents

Trehalose-6-phosphate synthase gene of Litopenaeus vannamei and detection and application of trehalose-6-phosphate synthase gene of Litopenaeus vannamei Download PDF

Info

Publication number
CN105950637A
CN105950637A CN201610489793.7A CN201610489793A CN105950637A CN 105950637 A CN105950637 A CN 105950637A CN 201610489793 A CN201610489793 A CN 201610489793A CN 105950637 A CN105950637 A CN 105950637A
Authority
CN
China
Prior art keywords
trehalose
vannamei
phosphate synthase
litopenaeus vannamei
synthase gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610489793.7A
Other languages
Chinese (zh)
Other versions
CN105950637B (en
Inventor
阮灵伟
施泓
徐洵
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Third Institute of Oceanography SOA
Original Assignee
Third Institute of Oceanography SOA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Third Institute of Oceanography SOA filed Critical Third Institute of Oceanography SOA
Priority to CN201610489793.7A priority Critical patent/CN105950637B/en
Publication of CN105950637A publication Critical patent/CN105950637A/en
Application granted granted Critical
Publication of CN105950637B publication Critical patent/CN105950637B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/01—Hexosyltransferases (2.4.1)
    • C12Y204/01015—Alpha,alpha-trehalose-phosphate synthase (UDP-forming) (2.4.1.15)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a trehalose-6-phosphate synthase gene of Litopenaeus vannamei and detection and an application of the trehalose-6-phosphate synthase gene of Litopenaeus vannamei, and relates to trehalose. Total RNA (Ribonucleic Acid) of Litopenaeus vannamei is extracted, reverse transcription is carried out on the total RNA, and primer amplification is performed, so that one trehalose-6-phosphate synthase gene is identified, according to the sequence information, optimal primers are designed for a real-time quantitative PCR ((Polymerase Chain Reaction) method to provide a basis for the detection of the transcriptional expression level of the gene in Litopenaeus vannamei. The transcription level of the trehalose-6-phosphate synthase gene in Litopenaeus vannamei is detected through the real-time quantitative PCR method, so that the transcription level of the trehalose-6-phosphate synthase gene of Litopenaeus vannamei can be used for evaluating the anti-hyperosmotic ability of Litopenaeus vannamei to provide information and methods in fields of fine breeding of Litopenaeus vannamei, germplasm resource evaluation and the like.

Description

Penaeus vannamei trehalose-6-phosphate synthase gene and detection with application
Technical field
The present invention relates to trehalose, especially relate to Penaeus vannamei (Litopenaeus vannamei) trehalose-6- Phosphate synthase gene and detection with application.
Background technology
Trehalose is a kind of natural, safe saccharide, and it is made up of with a, a-1,1-glycosidic bond two glucose molecules Nonreducing sugar, self property is highly stable, has the special biological functions such as excellent degeneration-resistant protection.Many at inverse property ring The living species of outstanding tolerance is showed (such as states such as drying and dehydrating, high temperature, freezing, height ooze), all with they internal conjunctions under border Become, accumulate a large amount of trehalose and have direct relation.Trehalose is not denatured mistake by the protection macromole such as biomembrane, protein Live, the life process of the body that sustains life and biological characteristic.Ectogenic trehalose is big to organism and biomembrane, protein etc. Molecule has prominent protective effect equally so that trehalose can be as the excellent guarantor of the active macromolecules of biological and medical field Protect agent, and also play a role at food processing field.Trehalose-6-phosphate synthase is the key in trehalose route of synthesis Enzyme, clone and the research to this enzyme gene, contribute to realizing trehalose enrichment in vivo, be that people study trehalose conjunction The focus of one-tenth approach.
China's cultured prawn face kind of matter degenerate serious, cultivation territorial environment difference is big, primary cultivated species genetic diversity Property decline, growth is slow and the problem such as specification heterogeneity, kind resistance poor (including resistance to ammonia nitrogen and Intensity-stress etc.).Healthy high-quality Seed breeding lacks unified codes and standards, and breeding Collocation cultivation technical research is delayed, and because territorial environment difference is big, breeding shows Model promotion effect is barely satisfactory.It addition, in recent years, owing to the hardship of EI Nino is endured in some prawn culturing areas to the fullest extent, summer is lasting Arid without rain so that the most quick-fried table of sea area salinity, salinity has broken through 35 ‰ high pointes, and pond salinity that What is more is on 40 ‰ Under hover, this supports shrimp to sea water and has buried many hidden danger.Therefore, detection trehalose-6-phosphate synthase transcriptional level is utilized to make Ooze for the anti-height of prawn, the method for degeneration-resistant evaluation, it will help prawn fine-variety breeding and germplasm resource evaluation.
Summary of the invention
First purpose of the present invention is to provide Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate and closes Become enzyme gene；
Second object of the present invention is to provide Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate and closes Become pheron sequence；
Third object of the present invention is to provide Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate and closes Become the detection method of the gene transcription level of enzyme.
Fourth object of the present invention is to provide Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate and closes Enzyme is become to evaluate the application that the anti-height of prawn oozes.
The molecule of described Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene Lvtps Type is cDNA, sequence signature: a length of 2535bp, and type is nucleic acid, and chain is double-strand, and topological structure is linear, described south The sequence of Penaeus vannamei Boone Litopenaeus vannamei trehalose-6-phosphate synthase gene Lvtps is as follows, is designated as SEQ ID No.1:
Penaeus vannamei Litopenaeus vannamei its nucleotide sequence of trehalose-6-phosphate synthase gene uses Following methods obtains: extract the RNA of Penaeus vannamei Litopenaeus vannamei, and RNA reverse transcription is become cDNA, enter one Step, with cDNA as template, obtains the sequence of SEQ ID No.1 through PCR amplification；Relevant nucleotide sequence obtains base by prediction Polypeptide SEQ ID No.2 because of coding:
The molecule type of Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase LvTPS is egg White matter, sequence signature: a length of 844aa, type is aminoacid, described Penaeus vannamei Litopenaeus vannamei Sargassum The sequence of sugar-6-phosphate synthase LvTPS is as follows, is designated as SEQ ID No.2.
The detection method of Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene Lvtps, Comprise the following steps:
The step of one Penaeus vannamei Litopenaeus vannamei Total RNAs extraction；
The step of one Penaeus vannamei Litopenaeus vannamei cDNA reverse transcription；
The inspection of one Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene transcription level Survey step.
The nucleotide sequence of described Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene Employing following methods obtains: extract the RNA of Penaeus vannamei Litopenaeus vannamei, and RNA reverse transcription is become cDNA, Further with cDNA as template, obtain the sequence of SEQ ID No.1 through PCR amplification.Optimal drawing is designed according to nucleotide sequence Thing SEQ ID No.3 and SEQ ID No.4, for real time quantitative PCR method, the transcriptional expression level of detection gene.
Described primer sequence SEQ ID No.3:ACAGGTGATTCCCGTGAGGCTGCCT
Described primer sequence SEQ ID No.4:AATGCTCGTTGACTTGCCTGTAAGC
The present invention, by extracting the total serum IgE of Penaeus vannamei Litopenaeus vannamei, carries out reverse transcription, by drawing Thing expands and identifies 1 trehalose-6-phosphate synthase gene, according to this sequence information, designs optimal primer, for real Time quantifying PCR method, provide the foundation for detecting this gene transcriptional expression level in prawn.By real-time quantitative PCR side Method detection trehalose-6-phosphate synthase gene transcriptional level in prawn, can be applied to evaluate the anti-height of prawn and ooze Ability, provide information and method for it in fields such as prawn fine-variety breeding and germplasm resource evaluations.
The present invention is with Penaeus vannamei Litopenaeus vannamei as research material, to high salinity prawn and Low-salinity The gene transcript expression difference of shrimp compares research, and screening obtains a kind of trehalose-6-phosphate synthase gene.Research is sent out In existing high salinity prawn, this gene transcript expression level is apparently higher than Low-salinity shrimp, averagely reaches 2 times of level above, South America is described Express and the anti-height of prawn of white shrimp Litopenaeus vannamei trehalose-6-phosphate synthase ooze and there is close connection System, has important using value.
Accompanying drawing explanation
Fig. 1 is Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene real-time quantitative PCR Sepharose electrophoresis collection of illustrative plates (the 1:1kb DNA Marker of amplified production；2: the PCR primer with prawn cDNA as masterplate).
Fig. 2 is Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene real-time quantitative PCR The solubility curve collection of illustrative plates of amplified production.
Fig. 3 is that Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene is in high salinity pair (high salinity prawn is to cultivate prawn in the sea water of salinity 32 ‰, Low-salinity to the situation of shrimp and complex immunoenhancer for low salinity prawn transcription level Prawn is to cultivate prawn in the sea water of salinity 5 ‰).
Detailed description of the invention
Below in conjunction with specific embodiment, the present invention is expanded on further.Should be understood that these embodiments are merely to illustrate the present invention Rather than restriction the scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, generally according to conventional strip Part such as Molecular Cloning: A Laboratory room handbook (1, Pehanorm Brooker, Russell (writes), and Huang Peitang (translates), " Molecular Cloning: A Laboratory guide ", Science Press, 2002, the third edition. the experiment condition described in), or according to the bar proposed by reagent or instrument manufacturer facility business Part.
For achieving the above object, the present invention uses techniques below measure, and it comprises the concrete steps that:
1. the extraction of Penaeus vannamei Litopenaeus vannamei total serum IgE
Take 100mg Penaeus vannamei Litopenaeus vannamei muscular tissue, add liquid nitrogen and clay into power, add Proceeding to 1.5mL centrifuge tube after 1mL TRIzol (Invitrogen company) mixing, room temperature stands 5min cell lysis；Add 0.2mL chloroform, acutely vibrate 15s, and room temperature stands 10min；4 DEG C, 12000g is centrifuged 15min；Supernatant liquid is transferred to one new Centrifuge tube without RNase in, add 0.5mL isopropanol, mixing, room temperature place 8min；4 DEG C, 12000g is centrifuged 10min；Discard Liquid, adds 1mL 75% ethanol rinse；4 DEG C, 7500g is centrifuged 5min；Discarding liquid, precipitation is dissolved in appropriate the most after drying In the water of RNase-free；Total serum IgE is measured at OD with trace ultraviolet spectrophotometer230、OD260And OD280Absorbance, it is determined that The concentration of total serum IgE and purity.
2. Penaeus vannamei Litopenaeus vannamei cDNA reverse transcription
CDNA inverse transcription reaction liquid is prepared, including 2 μ g total serum IgE, 1 μ L 6mer random primer at 0.5mL centrifuge tube (200ng), 1 μ L dNTP (10mM), the H processed with DEPC2Cumulative volume is mended to 13 μ L by O；Reaction system 65 DEG C process 5min, is immediately placed in 1min in ice bath；The most centrifugal, addition following component: 4 μ L 5 × First-Strand Buffer, 1 μ L DTT (0.1M), 1 μ L RNase Inhibitor (40U/ μ L) (TaKaRa company) and 1 μ L SuperScriptTM III Reverse transcriptase (200U/ μ L) (Invitrogen company)；Reaction system flicks mixing, the most centrifugal；25℃ 5min, 50 DEG C of incubation 60min, 70 DEG C process 15min and terminate reaction.
3. the PCR amplification of Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene Lvtps
With Penaeus vannamei Litopenaeus vannamei cDNA as template, expanded respectively by primer and obtain Sargassum The open reading frame of sugar-6-phosphate synthase gene.
Containing 1 μ L template in the reaction system of 25 μ L, the 1 positive anti-primer of μ L (20 μMs), 2 μ L dNTP (each 2.5mM), 5 μ L 5 ×PrimerSTARTMBuffer, 0.5 μ L PrimerSTARTM(TaKARa is public for HS DNA Polymerase (2.5U/ μ L) Department), use H2Cumulative volume is mended to 25 μ L by O.PCR reaction condition is: 98 DEG C of 10s, 58 DEG C of 10s, 72 DEG C of 2min (30cycles)；4 DEG C preserve.It is connected with carrier T after PCR primer is purified, is transformed in competent escherichia coli cell Top10, select after bacterium colony PCR Take the positive colony order-checking of DNA fragmentation.
Derive aminoacid sequence according to the nucleotide sequence that amplification obtains, contain 844 amino acid whose polypeptide respectively, its Aminoacid sequence refers to SEQ ID No.2.
4. Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene Lvtps transcriptional level Detection method
Forward primer: ACAGGTGATTCCCGTGAGGCTGCCT (SEQ ID No.3)
Reverse primer: AATGCTCGTTGACTTGCCTGTAAGC (SEQ ID No.4)
Containing 1 μ L template in the reaction system of 20 μ L, 0.5 μ L forward primer (20 μMs), 0.5 μ L reverse primer (20 μMs), 0.5μLPremix Ex TaqTM(Tli RNaseH Plus) (2 ×) (TaKARa company), uses H2Cumulative volume is mended extremely by O 20μL.PCR reaction condition is: 95 DEG C of 15s, 55 DEG C of 20s, 72 DEG C of 20s (30cycles)；4 DEG C of preservations.With Penaeus vannamei The transcriptional level of Litopenaeus vannamei house-keeping gene tubulin compares as internal reference.
5. the sound of Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene pairs salinity altercation Should
After prawn culturing field (seawater salinity 2.8%) fetches Litopenaeus vannamei, the most right in high salt pond and low salt pond Prawn is raised and train, and improves every day or reduces by 0.2%, until salinity respectively reaches 3.2% or 0.5%, treating that prawn fully adapts to After environment, respectively take high salt shrimp and less salt shrimp 5, take muscular tissue liquid nitrogen cryopreservation, extract total serum IgE, remove genomic DNA, Reverse transcription is cDNA, determines transcribing of different salinity environment prawn trehalose-6-phosphate synthase gene by real-time quantitative PCR Expression, finds this gene level in high salinity prawn higher (Fig. 1,2,3), thus it is speculated that its height anti-to prawn oozes relevant.Should Gene and detection method can be applied as the index evaluating prawn impermeability.

Claims (7)

1. Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene Lvtps, it is characterised in that its Molecule type is cDNA, sequence signature: a length of 2535bp, and type is nucleic acid, and chain is double-strand, and topological structure is linear, institute The sequence stating Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene Lvtps is as follows, note For SEQID No.1:
2. Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene as claimed in claim 1 Lvtps, it is characterised in that its nucleotide sequence uses following methods to obtain: extract Penaeus vannamei Litopenaeus The RNA of vannamei, and RNA reverse transcription is become cDNA, further with cDNA as template, obtain SEQ ID No.1 through PCR amplification Sequence；Relevant nucleotide sequence is by the polypeptide SEQ ID No.2 of prediction acquisition gene code:
3. Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase LvTPS, it is characterised in that its molecule Type is protein, sequence signature: a length of 844aa, and type is aminoacid, described Penaeus vannamei The sequence of Litopenaeusvannamei trehalose-6-phosphate synthase LvTPS is SEQ ID No.2.
4. the detection method of Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene Lvtps, its It is characterised by comprising the following steps:
The step of one Penaeus vannamei Litopenaeus vannamei Total RNAs extraction；
The step of one Penaeus vannamei Litopenaeus vannamei cDNA reverse transcription；
The detection step of one Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene transcription level Suddenly.
5. the nucleotide sequence of Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene, it is special Levy and be to use following methods to obtain: extract the RNA of Penaeus vannamei Litopenaeus vannamei, and by RNA reverse transcription Become cDNA, further with cDNA as template, obtain the sequence of SEQ ID No.1 through PCR amplification.Design according to nucleotide sequence Good primer SEQ ID No.3 and SEQ ID No.4, for real time quantitative PCR method, the transcriptional expression level of detection gene:
Described primer sequence SEQ ID No.3:ACAGGTGATTCCCGTGAGGCTGCCT
Described primer sequence SEQ ID No.4:AATGCTCGTTGACTTGCCTGTAAGC.
6. Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene as claimed in claim 1 Lvtps oozes in ability at the evaluation anti-height of prawn and applies.
7. Penaeus vannamei Litopenaeus vannamei trehalose-6-phosphate synthase gene as claimed in claim 1 Lvtps applies in prawn fine-variety breeding with germplasm resource evaluation.
CN201610489793.7A 2016-06-28 2016-06-28 Penaeus Vannmei trehalose-6-phosphate synthase gene and its detection and application Active CN105950637B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610489793.7A CN105950637B (en) 2016-06-28 2016-06-28 Penaeus Vannmei trehalose-6-phosphate synthase gene and its detection and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610489793.7A CN105950637B (en) 2016-06-28 2016-06-28 Penaeus Vannmei trehalose-6-phosphate synthase gene and its detection and application

Publications (2)

Publication Number Publication Date
CN105950637A true CN105950637A (en) 2016-09-21
CN105950637B CN105950637B (en) 2019-05-24

Family

ID=56902520

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610489793.7A Active CN105950637B (en) 2016-06-28 2016-06-28 Penaeus Vannmei trehalose-6-phosphate synthase gene and its detection and application

Country Status (1)

Country Link
CN (1) CN105950637B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108220266A (en) * 2018-03-14 2018-06-29 国家海洋局第三海洋研究所 Prawn liver sausage born of the same parents' worm trehalose-6-phosphate synthase and preparation method thereof
CN114807157A (en) * 2022-04-29 2022-07-29 浙江海洋大学 Transcription factor PvMyc from penaeus vannamei boone and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103614383A (en) * 2013-11-15 2014-03-05 中国科学院南海海洋研究所 Litopenaeus vannamei sodium-calcium exchanger LvNCX gene and coding protein thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103614383A (en) * 2013-11-15 2014-03-05 中国科学院南海海洋研究所 Litopenaeus vannamei sodium-calcium exchanger LvNCX gene and coding protein thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
任媛媛等: "海藻糖代谢途径相关基因及生物工程", 《微生物学报》 *
郭蓓等: "海藻糖-6-磷酸合成酶转基因烟草提高耐盐性的研究", 《植物学通报》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108220266A (en) * 2018-03-14 2018-06-29 国家海洋局第三海洋研究所 Prawn liver sausage born of the same parents' worm trehalose-6-phosphate synthase and preparation method thereof
CN114807157A (en) * 2022-04-29 2022-07-29 浙江海洋大学 Transcription factor PvMyc from penaeus vannamei boone and application thereof
CN114807157B (en) * 2022-04-29 2023-10-31 浙江海洋大学 Transcription factor PvMyc derived from penaeus vannamei boone and application thereof

Also Published As

Publication number Publication date
CN105950637B (en) 2019-05-24

Similar Documents

Publication Publication Date Title
CN102719531B (en) Macrobrachium rosenbergii sex specific molecular marker, screening method and application
CN103937822B (en) The sequence of locust I type chitinase gene and the application of dsRNA thereof
Smolina et al. Variation in thermal stress response in two populations of the brown seaweed, Fucus distichus, from the Arctic and subarctic intertidal
CN104419706B (en) Snp marker and application thereof
CN103740698B (en) A kind of tropical plants polysaccharide polyphenol tiny RNA extracting method
CN104630247A (en) Insect chitin deacetylate enzyme genes 1 and application of insect chitin deacetylate enzyme genes 1 in pest control
Guerriero et al. Temperature changes and marine fish species (Epinephelus coioides and Sparus aurata): Role of oxidative stress biomarkers in toxicological food studies
CN105950637A (en) Trehalose-6-phosphate synthase gene of Litopenaeus vannamei and detection and application of trehalose-6-phosphate synthase gene of Litopenaeus vannamei
Niaz et al. Identification of valid reference genes for the normalization of RT-qPCR gene expression data in Alexandrium catenella under different nutritional conditions
CN103498002B (en) Primer and method for detecting leuciscus waleckii in Dalai Nur lake basin
Coyne et al. Molecular Approaches to the Investigation of Viable Dinoflagellate Cysts in Natural Sediments from Estuarine Environments 1
CN102181523A (en) Method for identifying sex of early embryo of goat
CN104789571A (en) Retroactive gene and application of dsRNA (double-stranded ribonucleic acid) of Retroactive gene in pest control
CN102382876A (en) Method for detecting avermectin pesticide resistance produced by diamondback moth
CN104404042B (en) The application of a kind of Asiatic migrotory locust atp synthase beta subunit gene and its dsRNA in control of insect
CN104004750A (en) Eriocheir sinensis sexual precocity property related SNP marker and its application
CN104450755B (en) The application of a kind of Asiatic migrotory locust atp synthase α subunit genes and its dsRNA in control of insect
Manaffar et al. SNP detection in Na/K ATP‐ase gene α1 subunit of bisexual and parthenogenetic Artemia strains by RFLP screening
CN105950748A (en) Method for identifying high-homology marine vibrios based on rpoB genes
Cao et al. High temporal variability in bacterial community, silicatein and hsp70 expression during the annual life cycle of Hymeniacidon sinapium (Demospongiae) in China's Yellow Sea
CN104073557A (en) Fluorescence quantitative reference genes for crassostrea gigas Poly (I:C) stress experiment as well as primers and applications of fluorescence quantitative reference genes
Rubin et al. Differential gene expression in five isolates of the clam pathogen, quahog parasite unknown (qpx)
CN106319050A (en) Application of GmGAPC1 gene segment as reference gene stably expressed in different growth periods of gentiana macrophylla
Donato et al. Population structure and the conservation status of the rough-toothed dolphins based on the analysis of the mitochondrial control region
Malina et al. Genetic variation in the Asian seabass (Lates calcarifer Bloch, 1790) from Wallacea Region estimated using random amplified polymorphic DNA (RAPD) markers

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information
CB02 Change of applicant information

Address after: 361005 No. 178 University Road, Siming District, Xiamen City, Fujian Province

Applicant after: Third Institute of Oceanography, Ministry of Natural Resources

Address before: 361005 No. 178 University Road, Siming District, Xiamen City, Fujian Province

Applicant before: Oceanography Inst. No.3, State Bureau of Oceanography

GR01 Patent grant
GR01 Patent grant