CN105949317A - Anti-CD20 chimeric antigen receptor, encoding gene, recombinant expression vector, construction method of recombinant expression vector, and application - Google Patents

Abstract

The invention discloses an anti-CD20 chimeric antigen receptor, an encoding gene, a recombinant expression vector, a construction method of the recombinant expression vector and an application. The anti-CD20 chimeric antigen receptor comprises CD8 leader chimeric receptor signal peptide, CD20 VL, Optimal Linker C, a CD20 single-chain antibody heavy chain VH, a CD8 Hinge chimeric receptor hinge, a CD8 Transmembrane chimeric receptor transmembrane domain, a CD137 chimeric receptor co-stimulated factor and a TCR chimeric receptor T cell activating domain which are connected in series. Moreover, the invention discloses an encoding gene of the anti-CD20 chimeric antigen receptor, a recombinant expression vector, a construction method of the recombinant expression vector, and an application. Secretion of cell factors and an in-vitro killing effect of CAR-T cells are obviously improved, and the CAR-T cells have an outstanding clinical treatment effect.

Description

Anti-CD20 Chimeric antigen receptor, encoding gene, recombinant expression carrier and construction method thereof And application

Technical field

The invention belongs to immunotherapy of tumors technical field, be specifically related to a kind of anti-CD20 Chimeric antigen receptor, coding base Cause, recombinant expression carrier (a kind of CAR-T transgene carrier based on replication defective recombinant slow virus) and structure thereof Methods and applications.

Background technology

The theoretical basis of immunotherapy of tumors is that immune system has identification tumor associated antigen, regulation and control body attacks tumor The ability of cell (cell of high degree of specificity dissolves).This bioprocess is sufficiently complex, at present still in research among.Previous generation Recording the nineties, multiple computer MSR Information system have discovered that tumor antigen (t μm or antigens), and T lymphocyte can be by main Histocompatibility complex (major histocompatibility complex, MHC) dependency these tumors of mode identification Antigen.

Immunotherapy of tumors is generally divided into two classes, nonspecific immunity and specific immunity.Nonspecific immunotherapy for bronchus master Interleukin II to be included (interle μ kin-2, IL-2), interferon-ALPHA (interferon α, IFN-α), tumor necrosis factor Son (t μm or necrosis factor, TNF-α), cytokine and the toxin such as bacillus calmette-guerin vaccine, adoptive cellular immunotherapy etc.. Specific active immunotherapy is mainly tumor vaccine.

1.1 tumor Nonspecific immunotherapy for bronchus

Nonspecific immune response is inherent, and its formation is not required to antigenic stimulus, can be widely for many Plant antigen, be the basis of immunne response, but specificity is strong, tend not to certain specific antigen material produce sufficient intensity React nonspecific immunization therapy.In the cytokine profiles entering clinical trial, interleukin II and interferon should With the most extensively [Rosenberg S A, Lotze M T, M μ μ l L M, et al.A progress report on the treatment of 157 patients with advanced cancer μsing lymphokine-activated killer cells and interleμkin-2 or high-dose interleμkin-2 alone[J].N Engl J Med, 1987,316 (15): 889-897.].

The immunization therapy of 1.2 anti-cancer monoclonal antibody

Over nearly more than 20 years, monoclonal antibody is used widely at therapeutic field of tumor.Antitumor monoclonal antibody medicine typically wraps Including two classes: one is antitumor monoclonal antibody, two is antitumor monoclonal antibody conjugate, or claims immune conjugate.Immune conjugate molecule is by list Anti-and " bullet " medicine two parts form, and " bullet " mainly includes radionuclide, medicine and toxin, after being connected with monoclonal antibody respectively Constitute radioimmunity conjugate, chemo-immunity conjugate and immunotoxin.Divide in November, 1997 and in October, 1998 U.S. FDA Two monoclonal antibody Rit μ ximab (rit μ xan) for clinical cancer therapy and Trast μ z μm ab are not passed through (herceptin)[Dillman R O.Magic bμllets at last！Finally—approval of a Monoclonal antibody for the treatment of cancer [J] .Cancer Biother Radiopharm, 1997,12:223-225.].It is now recognized that the mechanism of action of monoclonal antibody has blocking effect, signal conduction and targeting Deng three kinds of mechanism of action, there is no direct lethal effect.Additionally there are the problem in terms of pharmacology, mainly arrive tumor Dose is not enough.Owing to conjugate is foreign protein, can be absorbed by reticuloendothelial system, have a great deal of will accumulate in liver, spleen and Bone marrow.Conjugate is macromolecular substances, by capillary endothelium layer and penetrate tumor cell external series gap and be all restricted.

The adoptive immunotherapy of 1.3 tumors

The adoptive immunotherapy of tumor refers to the autologous of Activation In Vitro or alloimmune effector lymphocyte's infusion to patient, with Kill tumor cell in the patient.A key issue in tumor adoptive immunotherapy is to find suitable tumor-killing Cell.Since the eighties in last century, including LAK, cell because of killing cell (the cytokine-ind μ ced of induction Killers, CIK), the cell such as TIL be successively applied to clinic, but owing to there is amplification speed being relatively low, cell derived is difficult, The most high problems of cytotoxicity, are restricted in clinical practice.The specific for tumour antigen how improving T cell has Important clinical meaning.The identification of tumor antigen is mainly by φt cell receptor (T cell receptor, TCR) by T cell Human leukocyte antigen (h μm an le μ kocyte antigen, the HLA)-peptide complexes on tumor cell surface, therefore, T The specificity of cells against tumor antigen recognition depends on the TCR on T cell surface.The means clonal tumours utilizing molecular biology is special The TCR of specific T cell, and by building containing the viral vector of TCR, TCR is proceeded in normal T cell, make these T cell because of Carry tumour-specific and become specific tumor killing cell [Johnson L A, Morgan R A, D μ dley M E, et al.Gene therapy with hμman and moμse T-cell receptors mediates cancer Regression and targets normal tiss μ es expressing cognate antigen [J] .Blood, 2009,114 (3): 535-546.].

1.4 tumor vaccine therapy

Tumor vaccine therapy is the specificity antineoplastic immunity by exciting patient to importing tumor antigen in the patient Reaction.Hold time the advantage such as long owing to vaccine therapy has specificity, in vivo immunological effect, the most become research heat Point.In recent years polypeptide vaccine, nucleic acid vaccine, whole protein vaccine, anti-unique antibody vaccine, recombinant viral vaccine, bacterial vaccine, The tumour-cell vaccine of genetic modification, dendritic cell (dendritic cells, DC) vaccine etc. are widely studied and apply [Robbins P F, Morgan R A, Feldman S A, et al.T μm or regression in patients with metastatic synovial cell sarcoma and melanoma μsing genetically engineered Lymphocytes reactive with NY-ESO-1 [J] .J Clin Oncol, 2011,29 (7): 917-924.].Tumor The large-scale application of vaccine therapy also has the problems demand of three aspects to solve.First, tumor associated antigen, each tumor, every Individual hypotype, each neoplasm staging, these relative antigen presentations are different, so making an accurate selection of antigen, the patient crowd that makes an accurate selection of is to cause Close important.Second, how to reach tumor antigen and in dendritic cell, imitate absorption and express？Antigen is inhaled by dendritic cell Receipts are with surface receptor for mediation.Dendritic cell has ten several receptors, how to be subject to accordingly according to specific selection of antigen Body？3rd, for the regulation and control that differentiation of dendritic cells is ripe.The differentiation and maturation of dendritic cell is an extremely complex mistake Journey, it both can move towards to activate T cell and can also move towards to suppress T cell.[the therapeutic type tumor vaccine of targeting DC cell: bright spot with Challenge and deposit.

http://www.biodiscover.com/news/research/115794.html]

1.5 tumor CAR-T treatments

CAR-T, full name is Chimeric Antigen Receptor T-Cell Imm μ notherapy, and chimeric antigen is subject to Body T cell immunotherapy, structure [Eleanor J.Cheadle, et al.CAR T cells:driving the as shown in Figure 1 road from the laboratory to the clinic.Immμnological Reviews 2014.Vol.257:91– 106]。

The t cell activation of first generation CAR mediation is to be completed by the Tyrosine Activating Motifs on CD3z chain or FceRIg. CD3z chain can provide the letter needed for t cell activation, cracking target cell, regulation IL-2 secretion and internal performance anti-tumor activity Number.But the anti-tumor activity of first generation CAR transformation T cell is restricted in vivo, it is thin that T cell propagation minimizing ultimately results in T The apoptosis of born of the same parents.

Second filial generation CAR adds a new costimulatory signal in intracellular, it is demonstrated experimentally that this makes original making be derived from " signal 1 " of TCR/CD3 complex expands, and many researchs all show, is equipped with second filial generation CAR and first generation CAR of " signal 2 " Comparing, antigenic specificity is constant, and T cell propagation, cytokine secretion increase, and Anti-apoptotic proteins secretion increases, and cell is dead Die delay.Conventional costimulatory molecules is CD28, but has research to be replaced by CD28 CD137 (4-1BB) afterwards, except this it Outward, the thinking of a kind of NK of use cell receptor CD244 is also suggested.Although which is better and which is worse for different second filial generations CAR, no actually With researcher be not quite similar with the result that obtains in external research in vivo by different tumors.[degree of depth full version: CAR- The present situation of T and future. biological paddy .2015-051-15]

In order to improve the design of CAR further, many seminar start to be conceived to develop third generation CAR, not only include " letter Number 1 ", " signal 2 ", further comprises extra costimulatory signal.Different researchers open with different target spots and costimulatory signal There is certain diversity in second filial generation CAR and the comparative result of third generation CAR that the institute of exhibition obtains.Some research report tables The restructuring T cell reaching third generation CAR is significantly increased in terms of anti-tumor activity, time to live and release of cytokines； Second filial generation CAR of the result of study display targeting M Μ C1 of Wilkie etc. and third generation CAR restructuring T cell are at antitumor cell poison Property aspect no significant difference, although express the T cell of third generation CAR can secrete more substantial IFN-γ (Wilkie S, Picco G,Foster J,et al.Retargeting of hμman T cells to tμmorassociated MΜC1: the evolμtion of a chimeric antigen receptor.J Immμnol 2008；180:4901–4909.). It should be noted that above-mentioned difference is only the conclusion obtained in experiment in vitro, compare the second filial generation and the most in vivo The report of three generations CAR.

Difference between this several generations CAR may come from signal transduction domain incessantly, the antigen binding domain (scFv) outside born of the same parents, weight The transfection method (slow virus VS retrovirus) of group T cell, feedback mode (the venous re-transfusion VS peritoneum VS tumor of restructuring T cell Body) etc. all may affect the final antitumous effect of CAR-T cell.

Summary of the invention

It is an object of the invention to overcome the deficiencies in the prior art, it is provided that a kind of anti-CD20 Chimeric antigen receptor, coding Gene, recombinant expression carrier and construction method thereof and application.

The purpose of the present invention is achieved through the following technical solutions:

The first object of the present invention is to provide a kind of anti-CD20 Chimeric antigen receptor (secondary CAR), including being sequentially connected in series The CD8 leader Chimerical receptor signal peptide as shown in SEQ ID NO.15, the CD20 strand as shown in SEQ ID NO.16 resist Body light chain VL, the Optimal Linker C as shown in SEQ ID NO.19, the CD20 strand as shown in SEQ ID NO.20 are anti- Body weight chain VH, the CD8 Hinge Chimerical receptor hinge as shown in SEQ ID NO.21, the CD8 as shown in SEQ ID NO.22 Transmembrane Chimerical receptor cross-film district, CD137 Chimerical receptor costimulating factor as shown in SEQ ID NO.23, and TCR Chimerical receptor t cell activation territory as shown in SEQ ID NO.24.

Further, the aminoacid sequence of described Chimeric antigen receptor is as shown in SEQ ID NO.50.

A kind of anti-CD20 Chimeric antigen receptor (three generations CAR), including the CD8 as shown in SEQ ID NO.15 being sequentially connected in series Leader Chimerical receptor signal peptide, the CD20VL as shown in SEQ ID NO.16, the Optimal as shown in SEQ ID NO.19 Linker C, the CD20 single-chain antibody heavy chain VH as shown in SEQ ID NO.20, the CD8 Hinge as shown in SEQ ID NO.21 Chimerical receptor hinge, CD8 Transmembrane Chimerical receptor cross-film district as shown in SEQ ID NO.22, such as SEQ ID CD28 Chimerical receptor costimulating factor shown in NO.25, CD137 Chimerical receptor costimulating factor as shown in SEQ ID NO.23 And the TCR Chimerical receptor t cell activation territory as shown in SEQ ID NO.24.

Further, the aminoacid sequence of described Chimeric antigen receptor is as shown in SEQ ID NO.51.

The second object of the present invention is to provide a kind of gene encoding above-mentioned anti-CD20 Chimeric antigen receptor.

Further, the nucleotide sequence of described gene such as SEQ ID NO.52 (secondary CAR) or SEQ ID NO.53 (three For CAR) shown in.

The third object of the present invention is to provide the recombinant expression carrier containing said gene.

Further, described recombinant expression carrier is Lentiviral, retrovirus expression vector, adenovirus table Reach carrier, glandular associated virus expression vector or plasmid.

Further, described Lentiviral comprises the gene of above-mentioned anti-CD20 Chimeric antigen receptor.

Further, described Lentiviral includes: for the prokaryotic replions pUC Ori sequence of plasmid replication Row, as shown in SEQ ID NO.2；For purpose bacterial strain expand in a large number containing ampicillin resistance gene AmpR sequence, such as SEQ Shown in ID NO.1；The Viral Replicon SV40 Ori sequence of the duplication in strengthening eukaryotic cell, such as SEQ ID NO.3 institute Show；Slow virus packaging cis element for slow virus packaging；Green for the ZsGreen1 of eukaryotic cell expression green fluorescence Fluorescin, as shown in SEQ ID NO.11；For the IRES ribosome binding sequence of common transcriptional expression protein, such as SEQ Shown in ID NO.12；For people's EF1 α promoter of the eukaryotic transcription of Chimeric antigen receptor gene, as shown in SEQ ID NO.14； For composition integrate identification, transmit, the encoding gene of the Chimeric antigen receptor of the secondary CAR that starts or three generations CAR, as Shown in SEQ ID NO.52 or SEQ ID NO.53；For strengthening the eWPRE enhancement mode marmot second of the expression efficiency of transgenic Hepatovirus posttranscriptional regulatory element, as shown in SEQ ID NO.13.

Further, described slow virus packaging cis element uses second filial generation slow virus carrier to include: such as SEQ ID NO.5 Shown slow virus 5 terminal LTR, the slow virus 3 terminal Self-as shown in SEQ ID NO.6 Inactivating LTR, the Gag cis element as shown in SEQ ID NO.7, the cis unit of RRE as shown in SEQ ID NO.8 Part, the env cis element as shown in SEQ ID NO.9, the cPPT cis element as shown in SEQ ID NO.10.

Further, described slow virus packaging cis element uses third generation slow virus carrier to include: such as SEQ ID NO.5 Shown slow virus 5 terminal LTR, the slow virus 3 terminal Self-as shown in SEQ ID NO.6 Inactivating LTR, the Gag cis element as shown in SEQ ID NO.7, the cis unit of RRE as shown in SEQ ID NO.8 Slow virus as described in part, the env cis element as shown in SEQ ID NO.9, the cPPT cis element shown in SEQ ID NO.10 Packaging cis element, and the RSV promoter as shown in SEQ ID NO.4.

Further, described eWPRE enhancement mode marmot hepatitis B virus posttranscriptional regulatory element has the enhancing of 6 nucleotide Sudden change, particularly as follows: g.396G > A, g.397C > T, g.398T > C, g.399G > A, g.400A > T, g.411A > T.

The fourth object of the present invention is to provide the construction method of a kind of above-mentioned Lentiviral, including following step Rapid:

(1) ampicillin resistance gene AmpR sequence (as shown in SEQ ID NO.1), prokaryotic replions pUC will be contained Ori sequence (as shown in SEQ ID NO.2), Viral Replicon SV40 Ori sequence (as shown in SEQ ID NO.3), for slow sick Slow virus packaging cis element, ZsGreen1 green fluorescent protein (as shown in SEQ ID NO.11), the IRES ribose of poison packaging Body binding sequence (as shown in SEQ ID NO.12), eWPRE enhancement mode marmot hepatitis B virus posttranscriptional regulatory element are (such as SEQ Shown in ID NO.13) it is stored on slow virus skeleton plasmid；

(2) by people's EF1 α promoter (as shown in SEQ ID NO.14), integrate identification for composition, transmit, start Secondary CAR or the Chimeric antigen receptor of three generations CAR be combined into secondary CAR or three generations's CAR design, through enzyme action, connection, Recombining reaction is cloned in slow virus skeleton plasmid, obtains the recombinant slow virus plasmid of secondary CAR or three generations CAR design；

(3) by the recombinant slow virus plasmid obtained and slow virus packaging plasmid pPac-GP, pPac-R and memebrane protein plasmid PEnv-G transfects HEK293T/17 cell jointly, after carrying out gene transcript expression, packs and successfully weighs in HEK293T/17 cell Group slow virus carrier can be discharged in cells and supernatant, collects the supernatant of the recombined lentivirus vector comprised；

(4) sucking filtration, absorption, the ion-exchange method of eluting is used to be purified the recombinant slow virus supernatant obtained, point Do not obtain recombined lentivirus vector.

Further, in step (1), described slow virus packaging cis element uses second filial generation slow virus carrier to include: as Slow virus 5 terminal LTR shown in SEQ ID NO.5, slow virus 3 terminal as shown in SEQ ID NO.6 Self-Inactivating LTR, the Gag cis element as shown in SEQ ID NO.7, the RRE as shown in SEQ ID NO.8 are suitable Formula element, the env cis element as shown in SEQ ID NO.9, the cPPT cis element as shown in SEQ ID NO.10；Described Slow virus packaging cis element uses third generation slow virus carrier to include: the slow virus 5 as shown in SEQ ID NO.5 Terminal LTR, slow virus 3 terminal Self-Inactivating LTR as shown in SEQ ID NO.6, such as SEQ Gag cis element shown in ID NO.7, RRE cis element as shown in SEQ ID NO.8, as shown in SEQ ID NO.9 Slow virus packaging cis element as described in env cis element, cPPT cis element shown in SEQ ID NO.10, and such as SEQ RSV promoter shown in ID NO.4.

Further, in step (2), described for composition integrate identifications, transmit, being fitted together to of the secondary CAR that starts Antigen receptor includes: CD8 leader Chimerical receptor signal peptide as shown in SEQ ID NO.15, as shown in SEQ ID NO.16 CD20 VL, the Optimal Linker C as shown in SEQ ID NO.19, the CD20 strand as shown in SEQ ID NO.20 resist Body weight chain VH, the CD8 Hinge Chimerical receptor hinge as shown in SEQ ID NO.21, the CD8 as shown in SEQ ID NO.22 Transmembrane Chimerical receptor cross-film district, CD137 Chimerical receptor costimulating factor as shown in SEQ ID NO.23, such as SEQ TCR Chimerical receptor t cell activation territory shown in ID NO.24；Described for composition integrate identification, the three generations transmitting, starting The Chimeric antigen receptor of CAR includes: CD8 leader Chimerical receptor signal peptide as shown in SEQ ID NO.15, such as SEQ ID CD20 VL shown in NO.16, Optimal Linker C as shown in SEQ ID NO.19, as shown in SEQ ID NO.20 CD20 single-chain antibody heavy chain VH, CD8 Hinge Chimerical receptor hinge as shown in SEQ ID NO.21, such as SEQ ID NO.22 institute The CD8 Transmembrane Chimerical receptor cross-film district shown, the CD28 Chimerical receptor as shown in SEQ ID NO.25 stimulate altogether because of Son, the CD137 Chimerical receptor costimulating factor as shown in SEQ ID NO.23 and the TCR as shown in SEQ ID NO.24 are embedding Close recipient T cells activation domain.

Further, in step (1), described eWPRE enhancement mode marmot hepatitis B virus posttranscriptional regulatory element has 6 cores The enhancing sudden change of thuja acid, particularly as follows: g.396G > A, g.397C > T, g.398T > C, g.399G > A, g.400A > T, g.411A > T.

Further, in step (2), people's EF1 α promoter start whole CAR gene expression；CD8 leader is chimeric to be subject to Body signal peptide is positioned at the N end of CAR coded sequence, is used for guiding CAR protein localization in cell membrane；CD20 single-chain antibody light chain VL, Optimal Linker C, CD20 single-chain antibody heavy chain VH is combined into scfv region, is used for identifying CD20 antigen；CD8 Hinge Chimerical receptor hinge is for being anchored to scfv outside cell membrane；CD8 Transmembrane Chimerical receptor cross-film district is used for will Whole Chimerical receptor is fixed on cell membrane；CD137 Chimerical receptor costimulating factor is used for stimulating T cell propagation and cytokine Secretion；TCR Chimerical receptor t cell activation territory is for activating the expression of downstream signaling pathway；When scfv region is tied with CD20 antigen During conjunction, signal is transferred to intracellular by Chimerical receptor, thus produces and include that T cell propagation, cytokine secretion increase, resist carefully The secretion of born of the same parents' apoptotic proteins increases, cell death postpones, a series of biological effects of cracking target cell.

Further, in step (4), described slow virus carrier has the version of band fluorescence labels zsGreen1 and without fluorescence Label zsGreen1 version, the version of band fluorescence labels is used for experiment in vitro, and the version without fluorescence labels is used for clinical experiment.

Further, in step (4), described sucking filtration step controls supernatant volume in 200ml～2000ml, vacuum degree control At-0.5MPA～-0.9MPA, prevent the carrier loss brought due to plug-hole；Described adsorption step control the pH value of solution 6～ 8, prevent the change of PH from causing carrier to inactivate；The ionic strength of described elution step control eluent, at 0.5M～1.0M, prevents The change of ionic strength causes eluting not exclusively or carrier inactivation.

Expression vector of the present invention includes that prokaryotic replions (pUC ori) is for plasmid replication；Protokaryon screening mark Note (AmpR) expands in a large number for purpose bacterial strain；Viral Replicon (SV40 Ori) is for strengthening the duplication in eukaryotic cell；Slowly Virus packaging cis element (RSV, 5 terminal LTR, 3 terminal Self-Inactivating LTR, Gag, RRE, Env, cPPT) pack for slow virus；Eucaryon fluorescence labels albumen (ZsGreen1) is used for eukaryotic cell expression green fluorescence；Altogether Expression element (IRES) is used for common transcriptional expression protein；Eukaryotic promoter (EF1 α) is true for Chimeric antigen receptor gene Consideration convey is recorded；Chimeric antigen receptor (CD8 leader, CD20 VL, Common Linker A (SEQ ID NO.17)/Common Linker B(SEQ ID NO.18)/Optimal Linker C(SEQ ID NO.19)、CD20 VH、CD8 Hinge、CD8 Transmembrane, CD137, TCR) integrate identification, the secondary and three generations CAR transmitting, starting for composition；After transcribing Controlling element (eWPRE) is for strengthening the expression efficiency of transgenic.

The fifth object of the present invention is to provide a kind of CART cell, and described CAR-T cell is embedding by above-mentioned anti-CD20 Close the T lymphocyte that antigen receptor is modified.

It is still another object of the present invention to provide the application in preparing lymphoma treating medicine of the above-mentioned CAR-T cell.

Further, described lymphoma treating medicine is lymphoma mantle cell medicine or follicular lymphoma curative Thing.

The present invention relates to the medical configuration product containing peptide, be specifically related to:

One, containing ampicillin resistance gene AmpR sequence, prokaryotic replions p Μ C Ori sequence, Viral Replicon SV40 Ori sequence, RSV promoter, people's EF1 α promoter, slow virus 5 terminal LTR, slow virus 3 terminal Self-Inactivating LTR, Gag cis element, RRE cis element, env cis element, cPPT cis element, IRES core Sugar body binding sequence, ZsGreen1 green fluorescent protein, the recombinant lentiviral disease of WPRE marmot hepatitis B virus posttranscriptional regulatory element Poisonous carrier skeleton, this recombined lentivirus vector skeleton can carry different therapeutic genes and be widely used in adoptive carefully Born of the same parents treat field.

Two, recombined lentivirus vector skeleton, CD8 leader Chimerical receptor signal peptide, CD20 single-chain antibody light chain VL, list Chain antibody hinge LinkerA, single-chain antibody hinge Linker B, single-chain antibody hinge Linker C, CD20 single-chain antibody heavy chain VH, CD8 Hinge Chimerical receptor hinge, CD8 Transmembrane Chimerical receptor cross-film district, CD28 Chimerical receptor stimulate altogether because of Son, CD137 Chimerical receptor costimulating factor, TCR Chimerical receptor t cell activation territory build and form recombined lentivirus vector, the party The recombined lentivirus vector that method obtains can be implemented in human T lymphocyte's upper expression CD20 Chimeric antigen receptor, guides and activates T The lymphocyte lethal effect to CD20 positive cell, is used clinically for treating B lymphoma.

CAR-T technology for CD20 of the present invention, is that a kind of immunity combining anti-cancer monoclonal antibody is controlled The targeted therapy new technique of the adoptive immunotherapy advantage for the treatment of and tumor.CD20 is as the composition pair of a kind of signal transduction complex The growth of bone-marrow-derived lymphocyte has regulation effect, and the specific expressed differentiation at pre B cell to mature B cell of CD20 Stage, the most most of lymphoma cell surfaces (Mohamed-Rachid Boulassel and Ahmed Galal.Immunotherapy for B-Cell Neoplasms using T Cells expressing Chimeric Antigen Receptors.Sultan Qaboos University Med J,August 2012,Vol.12,Iss.3, Pp.273-285.), therefore, have aobvious in the treatment of lymphoma mantle cell (MCL) and follicular lymphoma (FL) recent years The curative effect write is it is considered to be one of the most promising B cell lymphoma therapeutic modality.

Chimeric antigen receptor (CAR) is the core component (shown in Fig. 1) of CAR-T, gives T lymphocyte HLA non-dependent The ability of mode identification tumor antigen, this make through CAR transformation T cell can compared to nave T cell surface receptor TCR Identify widely target.The basic engineering of CAR includes a tumor associated antigen (tumor-associated Antigen, TAA) land (being typically derived from the scFV section of monoclonal antibody antigen calmodulin binding domain CaM), an outer hinge region of born of the same parents, One cross-film district and an intracellular signal transduction district.The design of scFV section is for specificity, effectiveness and the genetic modification of CAR The safety of T cell self is crucial determiner.

Compared with prior art, there is advantages that

The linker design of the scFV section that the present invention uses, is the Linkers pool using Shi Ao company, through albumen The analysis of matter Structure bioinformatics data base (https: //www.predictprotein.org/), by protein two The comparison of the protein properties such as level structure, Solvent accessibility, protein pliability, disulfide bond bridge, binding site, preferably Go out.Proved, compared with external design by the detection test of cell in vitro cytokine secretion and killing-efficiency test, it is possible to notable Improve the killing effect in vitro of CAR-T cell.Further, also effective than external clinical experiment in the effect of clinical treatment. The linker design of this scFV section, can be applied equally to third generation CAR design.Third generation CAR design sets with the second filial generation Meter is compared, and adds CD28 Chimerical receptor costimulating factor (SEQ ID NO.25), has higher signal amplification.

Slow virus carrier column purification mode of the present invention be different from generally employing ultracentrifugation or at a high speed from The mode of the heart, semiautomation operation, it is to avoid manually-operated loaded down with trivial details and error, the slow virus carrier reclaimed endotoxin, It is fully achieved clinical criteria in the indexs such as substance, host DNA residual.

The present invention used CAR design can also be applied in second filial generation slow virus carrier structure.The second filial generation and The difference (as shown in Figure 2 B) structurally of three generations's slow virus carrier, mainly third generation slow virus carrier is second filial generation carrier 5 ' The U3 region of LTR replaces with RSV promoter, thus eliminating the need the dependence to Tat albumen when U3 transcribes, both can be slow virus Structural gene in remove Tat sequence, also improve lentiviral gene group transcriptional level and transcribe persistence.The second filial generation and the 3rd Be mainly the difference of subgenomic transcription mode for slow virus carrier, therefore the present invention used CAR design can apply to This two generations slow virus carrier.

The third generation slow virus skeleton plasmid pLenti-3G basic that the present invention uses, with University of Pennsylvania Carl H.June Et al. (Porter DL, Levine BL, Kalos M, Bagg A, June CH.Chimeric antigen receptormodified T cells in chronic lymphoid leukemia.N Engl J Med 2011；365: Third generation slow virus carrier 725-33.) used is compared, and eliminates phage f1 origin of replication, uses eukaryotic viral SV40 Replicon, adds genes of interest copy number in eukaryotic cell, enhances eukaryotic expression effect.

The third generation slow virus skeleton plasmid pLenti-3G basic that the present invention uses, uses enhancedWPRE element, With University of Pennsylvania Carl H.June et al. (Porter DL, Levine BL, Kalos M, Bagg A, June CH.Chimeric antigen receptormodified T cells in chronic lymphoid leukemia.N Engl J Med 2011；WPRE element 365:725-33.) used is compared, have the enhancing of 6 nucleotide suddenly change (g.396G > A, g.397C > T, g.398T > C, g.399G > A, g.400A > T, g.411A > T), it is possible to strengthen the poly-adenosine of primary transcript, increase The content of intracellular mRNA, strengthens the expression efficiency of transgenic.

The Lentival packaging system that the present invention uses is four plasmid packaging systems of non-auxiliary virus, by four kinds of plasmids Jointly transfect to HEK293T/17 cell, produce recombined lentivirus vector.Slow virus carrier after restructuring is replication defect type Carrier, can be integrated into host gene, single use, it is impossible to replicating and breed, safety improves a lot by exogenous sequences.

The slow virus carrier that the present invention uses has the version of band fluorescence labels zsGreen1 and without fluorescence labels ZsGreen1 version, the version of band fluorescence labels is used for experiment in vitro, and the version without fluorescence labels is used for clinical experiment.

Present invention preferably employs third generation slow virus carrier (shown in Fig. 2 A), 3 ' SIN LTR eliminate U3 region, eliminate The probability of slow virus carrier self replication, substantially increases safety；Add cPPT and WPRE element, improve transduction effect Rate and the expression efficiency of transgenic；When slow virus carrier is packed, the lasting of core RNA efficiently turns to use RSV promoter ensure that Record；Use the EF1 α promoter of people self, enable CAR gene long lasting for expression in human body.

Visible, recombined lentivirus vector of the present invention provides treating to the CAR-T of B cell lymph tumor reliably Transgenic ensures.

Accompanying drawing explanation

Fig. 1 is the schematic diagram of CAR of the present invention, and wherein, Fig. 1 (A) is the basic block diagram of CAR, Fig. 1 (B) is The generation of CAR improves schematic diagram；

Fig. 2 is slow virus carrier structural representation of the present invention；Wherein, Fig. 2 (A) is the third generation that the present invention uses Slow virus carrier structural representation, Fig. 2 (B) is the second filial generation and third generation slow virus carrier structure comparison；

Fig. 3 is the structure flow chart building recombined lentivirus vector of the present invention in the embodiment of the present invention 1, wherein, Fig. 3 (A) is the structural representation of slow virus skeleton plasmid pLenti-3G basic；Fig. 3 (B) is the knot of pCAR20-CLA plasmid Structure schematic diagram；Fig. 3 (C) figure is the structural representation of pCAR20-CLB plasmid；Fig. 3 (D) figure is the structure of pCAR20-OLC plasmid Schematic diagram；Fig. 3 (E) figure is the structural representation of slow virus packaging plasmid pPac-GP；Fig. 3 (F) figure is slow virus packaging plasmid The structural representation of pPac-R；Fig. 3 (G) figure is the structural representation of memebrane protein pEnv-G；

Fig. 4 be recombinant slow virus plasmid pCAR20-CLA in the embodiment of the present invention 1 enzyme action prediction and enzyme action agarose coagulate Gel electrophoresis figure；Wherein, Fig. 4 A is the enzyme action prediction schematic diagram of recombinant slow virus plasmid pCAR20-CLA, and wherein lane1 is 1kb DNA ladder Marker: band is followed successively by from top to bottom: 10kb, 8Kb, 6kb, 5Kb, 4kb, 3.5Kb, 3Kb, 2.5kb, 2Kb、1.5kb、1Kb、750bp、500bp、250bp；Lane2 is the Kpn I enzyme action prediction of pCAR20-CLA: band is from top to bottom It is followed successively by: 6589bp, 1749bp, 1426bp；Fig. 4 B is the enzyme action agarose gel electricity of recombinant slow virus plasmid pCAR20-CLA Swimming figure, wherein lane1 is the electrophoresis result of 1kb DNA ladder Marker；Lane2 is the Kpn I enzyme action of pCAR20-CLA Electrophoresis result；

Fig. 5 be recombinant slow virus plasmid pCAR20-CLB in the embodiment of the present invention 1 enzyme action prediction and enzyme action agarose coagulate Gel electrophoresis figure；Wherein, Fig. 5 A is the enzyme action prediction schematic diagram of recombinant slow virus plasmid pCAR20-CLB, and wherein, lane1 is 1kb DNA ladder Marker: band is followed successively by from top to bottom: 10kb, 8Kb, 6kb, 5Kb, 4kb, 3.5Kb, 3Kb, 2.5kb, 2Kb、1.5kb、1Kb、750bp、500bp、250bp；Lane2 is the Nco I enzyme action prediction of pCAR20-CLB: band is from top to bottom It is followed successively by: 5867bp, 3897bp；Fig. 5 B is the enzyme action agarose gel electrophoresis figure of recombinant slow virus plasmid pCAR20-CLB, its In, lane1 is the electrophoresis result of 1kb DNA ladder Marker；Lane2 is the Nco I restriction enzyme digestion and electrophoresis knot of pCAR20-CLB Really；

Fig. 6 be recombinant slow virus plasmid pCAR20-OLC in the embodiment of the present invention 1 enzyme action prediction and enzyme action agarose coagulate Gel electrophoresis figure；Wherein, Fig. 6 A is the enzyme action prediction schematic diagram of recombinant slow virus plasmid pCAR20-OLC, and wherein, lane1 is 1kb DNA ladder Marker: band is followed successively by from top to bottom: 10kb, 8Kb, 6kb, 5Kb, 4kb, 3.5Kb, 3Kb, 2.5kb, 2Kb、1.5kb、1Kb、750bp、500bp、250bp；Lane2 be pCAR20-OLC Sac II enzyme action prediction: band to Under be followed successively by: 5577bp, 3840bp, 377bp；Fig. 6 B is the enzyme action agarose gel electricity of recombinant slow virus plasmid pCAR20-OLC Swimming figure, wherein, lane1 is the electrophoresis result of 1kb DNA ladder Marker；Lane2 is the Sac II enzyme of pCAR20-OLC Cut electrophoresis result；

Fig. 7 is the flow chart of the embodiment of the present invention 2 intermediate ion exchange chromatography purification of Recombinant slow virus carrier；

Fig. 8 is the titre testing result schematic diagram of the different way of purification of recombined lentivirus vector in the embodiment of the present invention 2；

Fig. 9 is the detection of mycoplasma result signal of the different way of purification of recombined lentivirus vector in the embodiment of the present invention 2 Figure；Wherein, lane1 is DL2000 marker, and bar counterband tape is followed successively by from top to bottom from top to bottom: 2kb, 1kb, 750bp, 500bp、250bp、100bp；Lane2 is positive control；Lane3 is negative control；Lane4 is PBS；Lane5 is water；lane6 For lysate；Lane7 is the slow virus of ultracentrifugation purification；Lane8 is the slow virus of high speed centrifugation purification；Lane9 is ion The slow virus of exchange chromatography purification；Lane10 is ghost；

Figure 10 is the block diagram of mRNA relative expression quantity in the embodiment of the present invention 3, and RT-QPCR result shows that CAR is at PBMC Intracellular efficient transcription；

Figure 11 is the WB detection figure of CAR expressing quantity in the embodiment of the present invention 3, and result shows that CAR albumen is thin at PBMC Intracellular height efficient expression；Wherein, in Figure 11 A, lane1 is PBMC ghost, and lane2 for comparison virus MOCK, lane3 is LvCAR20-CLA, lane4 be lvCAR20-CLB, lane5 be lvCAR20-OLC；Figure 11 B is beta-actin internal reference band；

Figure 12 is the killing-efficiency in the embodiment of the present invention 3 under the conditions of LDH detection difference effect target ratio, and E is effector lymphocyte, T For target cell；

Figure 13 is that in the embodiment of the present invention 3, qPCR detection difference imitates Cytokine Expression Level schematic diagram under the conditions of target ratio, E For effector lymphocyte, T is target cell；Wherein, Figure 13 A represents the mRNA transcriptional level of IL-2；Figure 13 B represents that the mRNA of IFN-γ turns Record level；

Figure 14 is CAR20-T cell situation of change comparison diagram in vitro and in vivo in the embodiment of the present invention 3；Wherein, figure 14A represents the CAR20-T cell of the different patient lethal effect curve in vitro to CD20+ cell；Figure 14 B represents feedback collare The versus time curve of portion's lymph node volume；Figure 14 C represents gross tumor volume situation over time after feedback；

Figure 15 is the second filial generation and the titre of third generation recombined lentivirus vector of continuous 3 batches in the embodiment of the present invention 4 Results contrast；

Figure 16 is the killing-efficiency in the embodiment of the present invention 5 under the conditions of LDH detection difference effect target ratio, and E is effector lymphocyte, T For target cell.

Detailed description of the invention

Following example are merely to illustrate the present invention rather than limit the scope of the present invention.In embodiment unreceipted specifically The experimental technique of condition, generally according to normal condition, or according to the condition proposed by manufacturer.

Embodiment 1 builds recombined lentivirus vector

One, material

1, slow virus skeleton plasmid pLenti-3G basic, slow virus packaging plasmid pPac-GP, pPac-R and film egg White matter grain pEnv-G, HEK293T/17 cell, homologous recombination enzyme by generation take wing (Shanghai) biological medicine Science and Technology Ltd. provide；

2, primer: according to the primer needed for design of primers principle design amplification of DNA fragments and target site, this primer is by Shanghai Biotech firm synthesizes, particularly as follows:

EF1 α-F:5 '-attcaaaattttatcgatgctccggtgcccgtcagt-3 ' (SEQ ID NO.26)

EF1 α-R:5 '-TCACGACACCTGAAATGGAAGA-3 ' (SEQ ID NO.27)

CD8 leader-F:5 '-ggtgtcgtgaggatccgccaccatggccttaccagtgaccgc-3 ' (SEQ ID NO.28)

CD8 leader-R:5 '-GTGTCATCTGGATGTCCGGCCTGGCGGCGTG-3 ' (SEQ ID NO.29)

VL-F:5 '-cacgccgccaggccggacattgtgctgacccaatctcc-3 ' (SEQ ID NO.30)

VL-R:5 '-ACCTTTTATTTCCAGCTTGGTCC-3 ' (SEQ ID NO.31)

CLA-VH-F:5 '-caagctggaaataaaaggcggtggctcgggtggtgggtcgggcggcggatctgggg g aggttctgaggtgcagctgcagcagtct-3’(SEQ ID NO.32)

CLB-VH-F:5 '-caagctggaaataaaaggatccacctccggatccggaaaacccggatccggagaag g atccaccaaaggagaggtgcagctgcagcagtct-3’(SEQ ID NO.33)

OLC-VH-F:5 '-caagctggaaataaaaggtggcggtggctcgggcggtggtgggtcg ggtggcggcggatctgaggtgcagctgcagcagtct-3’(SEQ ID NO.34)

VH-R:5 '-TGAGGAGACGGTGACCGTGG-3 ' (SEQ ID NO.35)

CD8 Hinge-F:5 '-GGTCACCGTCTCCTCAACCACGACGCCAGCGCC-3 ' (SEQ ID NO.36)

CD8 Hinge-R:5 '-GTAGATATCACAGGCGAAGTCCA-3 ' (SEQ ID NO.37)

CD8 Transmembrane-F:5 '-cgcctgtgatatctacatctgggcgcccttggc-3 ' (SEQ ID NO.38)

CD8 Transmembrane-R:5 '-TCTTTCTGCCCCGTTTGCAGTAAAGGGTGATAACCAGTG-3 ' (SEQ ID NO.39)

CD137-F:5 '-aaacggggcagaaagaaactc-3 ' (SEQ ID NO.40)

CD137-R:5 '-TGCTGAACTTCACTCTCAGTTCACATCCTCCTTCTTCTTC-3 ' (SEQ ID NO.41)

TCR-F:5 '-agagtgaagttcagcaggagcg-3 ' (SEQ ID NO.42)

TCR-R:5 '-GGAGAGGGGCGTCGACTTAGCGAGGGGGCAGGGC-3 ' (SEQ ID NO.43)

WPRE-QPCR-F:5 '-CCTTTCCGGGACTTTCGCTTT-3 ' (SEQ ID NO.44)

WPRE-QPCR-R:5 '-GCAGAATCCAGGTGGCAACA-3 ' (SEQ ID NO.45)

Actin-QPCR-F:5 '-CATGTACGTTGCTATCCAGGC-3 ' (SEQ ID NO.46)

Actin-QPCR-R:5 '-CTCCTTAATGTCACGCACGAT-3 ' (SEQ ID NO.47)

CAR-QPCR-F:5 '-GACTTGTGGGGTCCTTCTCCT-3 ' (SEQ ID NO.48)

CAR-QPCR-R:5 '-GCAGCTACAGCCATCTTCCTC-3 ' (SEQ ID NO.49)

3、SEQ ID NO.14、SEQ ID NO.15、SEQ ID NO.16、SEQ ID NO.17、SEQ ID NO.18、 SEQ ID NO.19、SEQ ID NO.20、SEQ ID NO.21、SEQ ID NO.22、SEQ ID NO.23、SEQ ID NO.24、SEQ ID NO.25、SEQ ID NO.26、SEQ ID NO.27、SEQ ID NO.28、SEQ ID NO.29、SEQ ID NO.30、SEQ ID NO.31、、SEQ ID NO.32、SEQ ID NO.33、SEQ ID NO.34、SEQ ID NO.35、SEQ ID NO.36、SEQ ID NO.37、SEQ ID NO.38、SEQ ID NO.39、SEQ ID NO.40、SEQ ID NO.41、SEQ ID NO.42、SEQ ID NO.43、SEQ ID NO.44、SEQ ID NO.45、SEQ ID NO.46、SEQ ID NO.47、SEQ ID NO.48、SEQ ID NO.49、

Shown DNA sequence is synthesized by Shanghai Jierui Biology Engineering Co., Ltd, and with oligonucleotide dry powder or plasmid Form preserves；SEQ ID NO.52, SEQ ID NO.53 are synthesized by Ji Yu bio tech ltd, Changzhou.

4, toolenzyme Kpn I, Nco I, Sac II, ApaL I, Sac I, Cla I, Sal I, T4DNA ligase are purchased from NEB company；

5, high-fidelity enzyme PrimeSTAR, RN are purchased from Takara company；

6,0.22 μm-0.8 μm PES filter is purchased from millipore company；

7, plasmid extraction test kit, agarose gel reclaim test kit and are purchased from MN company；

8, competent cell TOP10 is purchased from tiangen company；

9, NaCl, KCl, Na2HPO4.12H2O, KH2PO4, Trypsin, EDTA, CaCl2, NaOH, PEG6000 are purchased from The raw work in Shanghai；

10, Opti-MEM, FBS, DMEM, 1640, Hepes, purchased from invitrogen company；

11, Biotinylated protein L is purchased from GeneScript company；

12, the two of horseradish peroxidase-labeled resist, DAB working solution is purchased from Beijing Zhong Shan Golden Bridge；

13, ECL+plusTM Western blotting system is purchased from Amersham company；

DNeasy test kit is purchased from Shanghai JaRa company；

15, lymphocyte separation medium reaches section purchased from Shenzhen is company；

16, phycoerythrin (PE)-conjugated streptavidin is purchased from BD Bioscience company；

17, SA-HRP is purchased from Shanghai Yi Sheng company；

18, mycoplasma test reagent box, endotoxin detection kit, CD20+K562 cell are taken wing (Shanghai) company purchased from generation；

19, LDH detection kit is purchased from promega company；

Two, the construction method of recombined lentivirus vector lvCAR20-CLA, lvCAR20-CLB, lvCAR20-OLC.

Seeing Fig. 3, the construction method of recombined lentivirus vector of the present invention is as follows:

1, by people's EF1 α promoter, CD8 leader Chimerical receptor signal peptide, CD20 single-chain antibody light chain VL, Common Linker A, Common Linker B, Optimal Linker C, CD20 single-chain antibody heavy chain VH, CD8 Hinge are chimeric to be subject to Body hinge, CD8 Transmembrane Chimerical receptor cross-film district, CD137 Chimerical receptor costimulating factor, TCR Chimerical receptor T are thin Born of the same parents' activation domain fragment is cloned into slow virus skeleton plasmid pLenti-3G basic, respectively obtains recombinant slow virus plasmid pCAR20- CLA, pCAR20-CLB, pCAR20-OLC.

(1) Cla I and Sal I restricted enzyme is used to carry out slow virus skeleton plasmid pLenti-3G basic double Enzyme action, product, through the agarose gel electrophoresis of 1.5%, confirms fragment V1 (shown in Fig. 4) of 8303bp, and recovery of tapping rubber is placed in In Eppendorf pipe, reclaim test kit with the agarose gel of MN company and reclaim corresponding fragment (being shown in Table 1), and measure product Purity and concentration；

1, colloidal sol	Adding sol solutions in 200 μ l NTI/100mg gel ratios, 50 DEG C of water-baths are placed 5-10 minute.
		2, DNA is combined	11000g is centrifuged 30 seconds, discards filtrate.
3, film is washed	Adding 700 μ l NT3,11000g is centrifuged 30 seconds, discards filtrate.
		4, film is washed	Repeat the 3rd step once
5, dry	11000g is centrifuged 1 minute, the collecting pipe renewed, and room temperature is placed 1 minute.
		6, eluted dna	Adding 15-30 μ l NE, room temperature is placed 1 minute, and 11000g is centrifuged 1 minute, collects filtrate.

Table 1 agarose gel recycling step

(2) use primer EF1 α-F and EF1 α-R with the SEQ ID NO.14 of synthesis as template, use the system in table 2, PCR Cycling condition is: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 2min) * 35cycle, 72 DEG C of 10min.Produce Thing, through the agarose gel electrophoresis of 1.5%, confirms fragment a of 1208bp, and recovery of tapping rubber is placed in Eppendorf pipe, uses The agarose gel of MN company reclaims test kit and reclaims corresponding fragment (being shown in Table 1), and measures purity and the concentration of product；

Reagent	Volume (μ l)
		H2O	32.5
5×Buffer(with Mg2+)	10
		DNTP (each 2.5mM)	4
Primer1(+)(10μM)	1
		Primer2 (-) (10 μMs)	1
Template	1
		PrimeSTAR	0.5

Table 2 50 μ l PCR reaction system

(3) use primer CD8 leader-F and CD8 leader-R with the SEQ ID NO.15 of synthesis as template, use table 2 In system, PCR cycle condition is: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72℃ 5min.Product, through the agarose gel electrophoresis of 1.5%, confirms fragment b of 101bp, and recovery of tapping rubber is placed in In Eppendorf pipe, reclaim test kit with the agarose gel of MN company and reclaim corresponding fragment (being shown in Table 1), and measure product Purity and concentration；

(4) use primer VL-F and VL-R with the SEQ ID NO.16 of synthesis as template, use the system in table 2, PCR cycle Condition is: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product warp Cross the agarose gel electrophoresis of 1.5%, confirm fragment c of 336bp, and recovery of tapping rubber is placed in Eppendorf pipe, uses MN company Agarose gel reclaim test kit and reclaim corresponding fragment (being shown in Table 1), and measure purity and the concentration of product；

(5) use primer CLA-VH-F and VH-R with the SEQ ID NO.20 of synthesis as template, use the system in table 2, PCR Cycling condition is: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Produce Thing, through the agarose gel electrophoresis of 1.5%, confirms fragment d of 424bp, and recovery of tapping rubber is placed in Eppendorf pipe, uses MN The agarose gel of company reclaims test kit and reclaims corresponding fragment (being shown in Table 1), and measures purity and the concentration of product；

(6) use primer CLB-VH-F and VH-R with the SEQ ID NO.20 of synthesis as template, use the system in table 2, PCR Cycling condition is: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Produce Thing, through the agarose gel electrophoresis of 1.5%, confirms fragment e of 430bp, and recovery of tapping rubber is placed in Eppendorf pipe, uses MN The agarose gel of company reclaims test kit and reclaims corresponding fragment (being shown in Table 1), and measures purity and the concentration of product；

(7) use primer OLC-VH-F and VH-R with the SEQ ID NO.20 of synthesis as template, use the system in table 2, PCR Cycling condition is: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Produce Thing, through the agarose gel electrophoresis of 1.5%, confirms fragment f of 421bp, and recovery of tapping rubber is placed in Eppendorf pipe, uses The agarose gel of MN company reclaims test kit and reclaims corresponding fragment (being shown in Table 1), and measures purity and the concentration of product；

(8) use primer CD8 Hinge-F and CD8 Hinge-R with the SEQ ID NO.21 of synthesis as template, use in table 2 System, PCR cycle condition is: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 ℃ 5min.Product, through the agarose gel electrophoresis of 1.5%, confirms fragment g of 147bp, and recovery of tapping rubber is placed in In Eppendorf pipe, reclaim test kit with the agarose gel of MN company and reclaim corresponding fragment (being shown in Table 1), and measure product Purity and concentration；

(9) with primer CD8 Transmembrane-F and CD8 Transmembrane-R with the SEQ ID NO.22 synthesized For template, using the system in table 2, PCR cycle condition is: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C 30sec) * 35cycle, 72 DEG C of 5min.Product, through the agarose gel electrophoresis of 1.5%, confirms fragment h of 100bp, and cuts Glue reclaims and is placed in Eppendorf pipe, reclaims test kit with the agarose gel of MN company and reclaims corresponding fragment (being shown in Table 1), And measure purity and the concentration of product；

(10) use primer CD137-F and CD137-R with the SEQ ID NO.23 of synthesis as template, use the system in table 2, PCR cycle condition is: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min. Product, through the agarose gel electrophoresis of 1.5%, confirms fragment i of 142bp, and recovery of tapping rubber is placed in Eppendorf pipe, uses The agarose gel of MN company reclaims test kit and reclaims corresponding fragment (being shown in Table 1), and measures purity and the concentration of product；

(11) use primer TCR-F and TCR-R with the SEQ ID NO.24 of synthesis as template, use the system in table 2, PCR Cycling condition is: 98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Produce Thing, through the agarose gel electrophoresis of 1.5%, confirms fragment j of 355bp, and recovery of tapping rubber is placed in Eppendorf pipe, uses MN The agarose gel of company reclaims test kit and reclaims corresponding fragment (being shown in Table 1), and measures purity and the concentration of product；

(12) using each to DNA fragmentation b, c, d 1 μ l as template, use the system in table 3, in addition to primer, add Eppendorf In pipe, PCR cycle condition is: 98 DEG C of 3min, and (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 30sec) * 6cycle, addition is drawn Thing CD8 leader-F/VL-R, (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 40sec) * 24cycle, 72 DEG C of 5min.Product Through the agarose gel electrophoresis of 1.5%, confirm fragment k of 814bp, and recovery of tapping rubber is placed in Eppendorf pipe, public with MN The agarose gel of department reclaims test kit and reclaims corresponding fragment (being shown in Table 1), and measures purity and the concentration of product；

Table 3 50 μ l over-lap PCR reaction system

(13) using each to DNA fragmentation b, c, e 1 μ l as template, use the system in table 3, in addition to primer, add Eppendorf In pipe, PCR cycle condition is: 98 DEG C of 3min, and (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 30sec) * 6cycle, addition is drawn Thing CD8 leader-F/VL-R, (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 40sec) * 24cycle, 72 DEG C of 5min.Product Through the agarose gel electrophoresis of 1.5%, confirm fragment l of 820bp, and recovery of tapping rubber is placed in Eppendorf pipe, public with MN The agarose gel of department reclaims test kit and reclaims corresponding fragment (being shown in Table 1), and measures purity and the concentration of product；

(14) using each to DNA fragmentation b, c, f 1 μ l as template, use the system in table 3, in addition to primer, add Eppendorf In pipe, PCR cycle condition is: 98 DEG C of 3min, and (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 30sec) * 6cycle, addition is drawn Thing CD8 leader-F/VL-R, (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 40sec) * 24cycle, 72 DEG C of 5min.Product Through the agarose gel electrophoresis of 1.5%, confirm fragment m of 811bp, and recovery of tapping rubber is placed in Eppendorf pipe, public with MN The agarose gel of department reclaims test kit and reclaims corresponding fragment (being shown in Table 1), and measures purity and the concentration of product；

(15) using each to DNA fragmentation g, h, i, j 1 μ l as template, use the system in table 3, add in addition to primer In Eppendorf pipe, PCR cycle condition is: 98 DEG C of 3min, (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 30sec) * 6cycle, adds primer CD8 Hinge-F/TCR-R, (98 DEG C of 10sec, 60 DEG C of 10sec, 72 DEG C of 30sec) * 24cycle, 72℃ 5min.Product, through the agarose gel electrophoresis of 1.5%, confirms fragment n of 704bp, and recovery of tapping rubber is placed in In Eppendorf pipe, reclaim test kit with the agarose gel of MN company and reclaim corresponding fragment (being shown in Table 1), and measure product Purity and concentration；

(16) DNA fragmentation V1, a, k, n are added Eppendorf pipe with the ratio of 5 μ l cumulative volumes and mol ratio 1:1:1:1 In, add homologous recombination enzyme reaction solution 15 μ l, hatch 30 minutes at 42 DEG C after mixing, be transferred to place on ice 2-3 minute, will be anti- Answer liquid to add in 50 μ l TOP10, rotate gently to mix content, place 30 minutes in ice, pipe is put into pre-heating to 42 DEG C thermostat water bath in heat shock 90 seconds, quickly pipe is transferred in ice bath, makes cell cool down 2-3 minute, often pipe adds 900 μ l LB culture fluid, then transfers to pipe on 37 DEG C of shaking tables, and incubation makes bacteria resuscitation in 1 hour, and the conversion bacterium solution taking 100 μ l is coated On Amp LB agar plate, inversion plate, 37 DEG C of cultivations in constant incubator, 16 hours.

Picked clones carries out bacterium colony PCR qualification, identifies that correct clone is recombinant slow virus plasmid pCAR20-CLA, right Correct clone carries out enzyme action qualification (see Fig. 4)；

(17) DNA fragmentation V1, a, l, n are added Eppendorf pipe with the ratio of 5 μ l cumulative volumes and mol ratio 1:1:1:1 In, add homologous recombination enzyme reaction solution 15 μ l, hatch 30 minutes at 42 DEG C after mixing, be transferred to place on ice 2-3 minute, will be anti- Answer liquid to add in 50 μ l TOP10, rotate gently to mix content, place 30 minutes in ice, pipe is put into pre-heating to 42 DEG C thermostat water bath in heat shock 90 seconds, quickly pipe is transferred in ice bath, makes cell cool down 2-3 minute, often pipe adds 900 μ l LB culture fluid, then transfers to pipe on 37 DEG C of shaking tables, and incubation makes bacteria resuscitation in 1 hour, and the conversion bacterium solution taking 100 μ l is coated On Amp LB agar plate, inversion plate, 37 DEG C of cultivations in constant incubator, 16 hours.

Picked clones carries out bacterium colony PCR qualification, identifies that correct clone is recombinant slow virus plasmid pCAR20-CLB, right Correct clone carries out enzyme action qualification (see Fig. 5)；

(18) DNA fragmentation V1, a, m, n are added Eppendorf pipe with the ratio of 5 μ l cumulative volumes and mol ratio 1:1:1:1 In, add homologous recombination enzyme reaction solution 15 μ l, hatch 30 minutes at 42 DEG C after mixing, be transferred to place on ice 2-3 minute, will be anti- Answer liquid to add in 50 μ l TOP10, rotate gently to mix content, place 30 minutes in ice, pipe is put into pre-heating to 42 DEG C thermostat water bath in heat shock 90 seconds, quickly pipe is transferred in ice bath, makes cell cool down 2-3 minute, often pipe adds 900 μ l LB culture fluid, then transfers to pipe on 37 DEG C of shaking tables, and incubation makes bacteria resuscitation in 1 hour, and the conversion bacterium solution taking 100 μ l is coated On Amp LB agar plate, inversion plate, 37 DEG C of cultivations in constant incubator, 16 hours.Picked clones carries out bacterium colony PCR mirror Fixed, identify that correct clone is recombinant slow virus plasmid pCAR20-OLC, correct clone is carried out enzyme action qualification (see figure 6)。

2, the packaging of recombined lentivirus vector lvCAR20-CLA, lvCAR20-CLB, lvCAR20-OLC.

(1) complete medium: take out preheated fresh culture, adds 10%FBS+5ml Pen-Srep, runs up and down Mix；

(2) 1XPBS solution: weigh NaCl 8g, KCl 0.2, Na2HPO4.12H2O 3.58g, KH2PO4 0.24g

It is placed in 1000ml beaker, adds 900ml Milli-Q grade ultra-pure water and dissolve, after having dissolved, use 1000ml graduated cylinder is settled to 1000ml, 121 DEG C of high-temperature heat sterilization 20min；

(3) 0.25%Trypsin solution: weigh Trypsin 2.5g, EDTA 0.19729g and be placed in 1000ml beaker, Add 900ml 1XPBS to dissolve, after having dissolved, use 1000ml graduated cylinder to be settled to 1000ml, 0.22 μM of filtration sterilization, for a long time Use can preserve to-20 DEG C of refrigerators；

(4) 0.5M CaCl2 solution: weigh 36.75g CaCl2 400ml Milli-Q grade ultra-pure water and dissolve；With Cumulative volume is settled to 500ml by Milli-Q grade ultra-pure water, mixing；0.22 μm filtration sterilization, subpackage is saved in 50ml and is centrifuged Guan Zhong, often pipe about 45ml, 4 DEG C of preservations.

(5) 2XHBS solution: weigh 4.09g NaCl, 0.269g Na2HPO4,5.96g Hepes, use 400ml Milli- Q grade ultra-pure water dissolves；After calibration pH instrument, by 2M NaOH solution, the pH of HBS solution is transferred to 7.05.Adjust every bottle of HBS's It is about 3ml that PH consumes 2M NaOH；

(6) from liquid nitrogen container, take out frozen HEK293T/17 cell, be quickly transferred in 37 DEG C of water-baths, after 1～2min Transferring in super-clean bench, the liquid in cryopreservation tube is fully transferred in 10cm2 culture dish by sterile working, supplies containing 10%FBS DMEM to 8mL/10cm2 dish, microscope observation of cell after 24h, the degree of cell confluency passes on more than 80%；

(7) selecting cell state HEK293T/17 cell good, free of contamination, every 2-6 culture dish is one group, by cell After trypsinization, draw 4-12ml complete medium with electric pipettor, in each postdigestive culture dish, add 2ml, it is to avoid Culture dish becomes dry；Use 1ml pipettor that all cells is blown and beaten into single cell suspension, transfer in medium bottle；

(8) remaining cell in above-mentioned 2-6 culture dish is transferred in medium bottle, and rinse again by culture medium once Culture dish；

(9) cover tightly culture medium bottle cap, turn upside down about 10 times and fully mix cell suspension, cell is passed to 8-24 In 10cm2 culture dish, the cell density of every ware should be about about 4 × 106/10ml complete medium.If cell density and Intended difference is relatively big, then need to count cell, then according to the amount inoculation of 4 × 106/ware；

(10) every 6 culture dishs arrange is a pile, notes keeping the cooperation between upper and lower ware.By about culture dish, front and back Rock for several times, make cell fully spread out, be then placed in 5%CO2 incubator.Remaining cell does same process；

(11) checking institute passage cell, cell confluency degree should be 70-80%, and profile is full, adherent well, train at cell Support in ware and be uniformly distributed；

(12) it is that cell changes liquid, culture medium is replaced with fresh complete medium, every ware 9ml, and by dense for the CO2 of incubator Degree setting value brings up to 8%；

(13) DNA/CaCl2 solution is joined according to N+0.5.Every ware HEK293T/17 cell transfecting plasmid amount is according to following ratio Use: recombinant slow virus plasmid (20 μ g), pPac-GP (15 μ g), pPac-R (10 μ g), pEnv-G (7.5 μ g).Take one new 5ml centrifuge tube, addition 0.5M CaCl2:0.25ml, recombinant slow virus plasmid 20 μ g:pPac-GP 15 μ g:pPac-R 10 μ g: PEnv-G 7.5 μ g, supplements ultra-pure water and closes the lid to 0.5ml, fully mix；

(14) separately take a 5ml centrifuge tube, add 0.5ml DNA/CaCl2 solution.Opening turbula shaker, one hand-held Living the upper end of 5ml centrifuge tube, make to contact at the bottom of pipe oscillating end, make liquid scatter on tube wall flowing, the hand-held 1mL of another moves Liquid rifle, draws 0.5mL 2 × HBS solution, is slowly added dropwise entrance centrifuge tube, coutroi velocity, drips off with half a minute and be advisable.2×HBS After addition, continue vibration 5 seconds, stop oscillation, can be directly added in the cell needing transfection；

(15) take a ware cell, the 1mL calcium in centrifuge tube is turned drop and adds, make calcium turn reagent as far as possible and be distributed to whole In individual culture dish；

(16), after calcium turns liquid addition, ware lid carries out labelling, culture dish is released in another 5%CO2 incubator. Guaranteeing culture dish horizontal positioned, often pile culture dish does not exceeds 6.(6 8h) is placed in 5%CO2 incubator；

(17) the CO2 concentration set point of first incubator is adjusted back to 5%；

After (18) 24 hours, check cell state.Cell confluency degree should be about 80 85%, in good condition.To cultivate Base siphons away, and changes the fresh DMEM complete medium of 10ml；

After (19) 48 hours, observe transfection efficiency.Most cells remain adherent.It can be seen that it is thin more than 95% Born of the same parents can be with green fluorescence.By same virus packaging supernatant collection to together, and in culture dish, continue interpolation 10mL Fresh culture；

After (20) 72 hours, again collecting together by same vial supernatant, the virus of twice collection can be placed on Together, culture dish is abandoned；Contain in the supernatant now collected recombined lentivirus vector lvCAR20-CLA, lvCAR20-CLB, lvCAR20-OLC。

The concentration of embodiment 2 recombined lentivirus vector and detection

Supercentrifugation purification of Recombinant slow virus carrier；

(1) being dispensed in 50ml centrifuge tube by the supernatant of collection, 500g room temperature is centrifuged 10min, removes cell and big Fragment；

(2) by 0.22 μm-0.8 μm filter filtering supernatant；

(3) take 6 Hitachi 40PA ultracentrifugation pipes, surface sprinkling 70% ethanol disinfection, be placed on super-clean bench ultraviolet Light irradiation sterilizes 30 minutes.High-temperature heat sterilization can also be passed through；

(4) the cell conditioned medium sample subpackage 32ml the 2nd step handled well is in centrifuge tube；

(5) cover crown cap, by centrifuge tube together with crown cap trim, adjust with 1XPBS and make deviation of weight at 0.02g In the range of；

(6) by symmetrically placed for the centrifuge tube of trim in ultracentrifugation rotor P50AT2.Centrifugal rotational speed 100,000g is set, 4 DEG C are centrifuged 2 hours；

(7) after centrifugal end, carefully centrifuge tube is taken out from rotor, it can be seen that sink there being a little group at the bottom of centrifuge tube Form sediment, make marks on outer tube wall with Marker pen, outwell supernatant.Centrifuge tube is tipped upside down on the napkin completed in advance, makes remnants Liquid pours off.With liquid-transfering gun, the drop hung on wall can be siphoned away；

(8) in each centrifuge tube, add the Opti-MEM of 200 μ l, make resolution of precipitate, as far as possible with 200 μ l pipettor piping and druming Reduce the generation of foam；

(9) ultracentrifugation pipe is inserted in 50ml centrifuge tube, close the lid, put into 4 DEG C of refrigerator overnight；

(10) 500g, room temperature is centrifuged 1min, makes virus liquid focus at the bottom of pipe；

(11) all identical viral concentration liquid are brought together, filter with the PES filter of 0.22 μm-0.8 μm；By disease Poison is divided into 25 to 50 μ l mono-pipes, frozen to-80 DEG C refrigerators, preserves for a long time；

Two, supercentrifugal process purification of Recombinant slow virus carrier；

(1) the PES filter that the supernatant 204ml of collection uses 0.22 μm-0.8 μm filters；

(2) PEG 6000 solution of 51ml 50% is added；

(3) 21.7ml 4M NaCl solution is added；

(4) add 23.3ml PBS solution, at this moment overall solution volume be 300ml.PEG 6000 final concentration 8.5%, NaCl final concentration 0.3M；

(5) solution subpackage is entered in 250ml wide mouthed bottle, every part of 150ml；

Placing 1.5 hours for (6) 4 DEG C, mixing in every 20-30 minute is once；

(7) 4 DEG C, 7000g be centrifuged 10min；

(8) can see at the bottom of pipe, there is white precipitate after being centrifuged；

(9) careful abandoning supernatant, every bottle adds 1.2ml 50mM Tris-HCl (pH 7.4), and it is resuspended heavy acutely to rock Form sediment；

(10) vortex shakes 20 30 seconds further resuspended precipitations；

(11) virus is divided into 25 to 50 μ l mono-pipes, frozen to-80 DEG C refrigerators, preserves for a long time；

Three, ion exchange chromatography recombined lentivirus vector (as shown in Figure 7)；

(1) supernatant collected is used Thermo vacuum pump, through the PES filter sucking filtration of 0.22 μm-0.8 μm, remove miscellaneous Matter；

(2) in supernatant, 1.5M NaCl 250mM Tris-HCl (pH 6-8) is added in the ratio of 1:1-1:10；

(3) 2 ion exchange column are placed in series, with 4ml 1M NaOH, 4ml 1M NaCl, 5ml 0.15M NaCl 25mM Tris-HCl (pH 6-8) solution crosses post successively；

(4) solution obtained in step 2 is passed through the peristaltic pump speed with 1-10ml/min to ion exchange column loading；

(5), after all supernatant crosses post, 10ml 0.15M NaCl 25mM Tris-HCl (pH 6-8) solution is used to clean One time；

(6) using 1-5ml 1.5M NaCl 25mM Tris-HCl (pH 6-8) to carry out eluting according to applied sample amount, collection is washed De-liquid；

(7) eluent is divided into 25 to 50 μ l mono-pipes, frozen to-80 DEG C refrigerators, preserves for a long time；

Four, titer determination and comparing；

(1) 24 orifice plate inoculation 293T cells are taken.Every porocyte is 5 × 104, and added culture volume is 500ul, different The vitro growth rates of kind difference, carrying out cell confluency when virus infects is 40%-60%；

(2) prepare 3 aseptic EP pipes, each pipe adds the fresh complete medium (DMEM in high glucose+10% of 90ul FBS) inoculating cell is after 24 hours, and the cell blood counting chamber taking two holes counts, the actual number of cell when determining infection, It is designated as N；

(3) take virus stock solution used 10ul to be determined and join in first pipe, gently after mixing, take 10ul and join second In individual pipe, operate a to the last pipe the most successively；410ul complete medium (DMEM in high glucose+10% is added in often pipe FBS), final volume is 500ul；

(4) infection starts latter 20 hours, removes culture supernatant, is replaced by 500 μ l complete medium (DMEM in high glucoses+10% FBS), 5%CO2 continues to cultivate 48 hours；

After (5) 72 hours, observing luciferase expression situation, under normal circumstances, fluorecyte number increases and phase with extension rate Should reduce, and take pictures；

(6) with 0.2ml 0.25% pancreas enzyme-EDTA solution digestion cell, place 1 minute at 37 DEG C.Whole with culture medium purging Individual cell face, centrifugal collecting cell.Genomic DNA is extracted according to the explanation of DNeasy test kit.Each sample cell adds 200 μ l eluent washes lower DNA the most quantitatively；

(7) (QPCR primer sequence is SEQ ID NO.44---SEQ ID to prepare target DNA detection house steward qPCRmix I NO.45):

N=number of reactions. is such as: overall reaction number is 40, by 1ml 2 × TaqMan Universal PCR Master Mix, 4 μ l forward primer, 4 μ l reverse primer, 4 μ l probe and 788 μ l H2O are mixed With.It is placed on ice after concussion；

(8) (QPCR primer sequence is SEQ ID NO.46---SEQ ID to prepare internal reference DNA detection qPCRmix pipe II NO.47):

2×TaqMan Master Mix 25μl×n

10×RNaseP primer/probe mix 2.5μl×n

H2O 17.5μl×n

N=number of reactions. is such as: overall reaction number is 40, by 1ml 2 × TaqMan Universal PCR Master Mix, 100 μ l 10 × RNaseP primer/probe mix and 700 μ l H2O mix.Ice it is placed on after concussion On；

(9) in 96 hole PCR plate of pre-cooling, complete PCR system set up.From house steward I, respectively take 45 μ l join each row of A-D Hole in, respectively take from house steward II in the hole that 45 μ l join each row of E-G.

(10) taking 5 μ l plasmid standards respectively and testing sample genomic DNA joins in A-D row, each sample repeats 1 Secondary.1 hole is separately stayed to add the water of 5 μ l as no template control (no-template control).

(11) take 5 μ l genome standard substance respectively and testing sample genomic DNA joins in E-G row, each sample weight Multiple 1 time.1 hole is separately stayed to add the water of 5 μ l as no template control (no-template control).

(12) used quantitative PCR apparatus is ABI PRISM 7500 quantitative system.Cycling condition is set as: 50 DEG C 2 points Clock, 95 DEG C 10 minutes, followed by 95 DEG C 15 seconds, 60 DEG C of 40 circulations of 1 minute.

Data analysis: the slow virus carrier copy number genome number integrated in the DNA sample recorded is demarcated, and obtains The viral copy number of every genome conformity.

The computing formula of titre (integration units per ml, IU ml-1) is as follows:

IU ml-1=(C × N × D × 1000)/V

Wherein: the viral copy number of the averagely every genome conformity of C=

The number (about 1 × 105) of cell when N=infects

The extension rate of D=viral vector

The volume number of the virus dilution that V=adds

(13) titre results of recombined lentivirus vector lvCAR20-CLA, lvCAR20-CLB, lvCAR20-OLC is (such as Fig. 8 Shown in), the result of ion exchange chromatography is substantially better than supercentrifugation and supercentrifugal process；

Five, endotoxin measurement and comparing；

(1), endotoxin working standard is that 15EU/ props up；

(2), sensitivity of the limulus reagent λ=0.25EU/ml, 0.5ml/ pipe

(3), endotoxin standard dilution: take endotoxin standard one, be diluted to 4 λ and 2 λ in proportion with BET water respectively Dissolving, sealed membrane seal, concussion dissolve 15min；Often dilute a step during dilution and all should mix 30s on eddy mixer；

(4), sample-adding: if taking the tachypleus amebocyte lysate Heavenly Stems and Earthly Branches, every adds BET water 0.5ml and dissolves, and the subpackage as Heavenly Stems and Earthly Branches try without endotoxin Guan Zhong, often pipe 0.1ml.Wherein 2 is negative control pipe, adds BET water 0.1ml；

2 is positive control pipe, adds the endotoxin working standard solution 0.1ml of 2 λ concentration；

2 is Sample Positive control tube, adds the 0.1ml sample solution containing 2 λ endotoxin standards and (dilutes 20 times treat The endotoxin standard solution 1ml=2ml of test sample product 1ml+4 λ 40 times of samples of dilution containing 2 λ endotoxin standards).

Adding 0.1ml sample in sample cell, dilution ratio is shown in Table 4, and 37 ± 1 DEG C of water-baths (or incubator) are incubated 60 ± 1min；

(5), the endotoxin testing result of recombined lentivirus vector lvCAR20-CLA, lvCAR20-CLB, lvCAR20-OLC (as shown in table 4), the endotoxin content of supercentrifugation is between 20～40EU/ml, and the endotoxin content of supercentrifugal process exists Between 20～40EU/ml, the endotoxin content of ion exchange chromatography be substantially better than between 1.25～2.5EU/ml hypervelocity from Heart method and supercentrifugal process；

The endotoxin testing result of table 4 recombined lentivirus vector

Six, mycoplasma measures and compares；

(1) on pretreatment three days, cell sample antibiotic-free culture medium was cultivated；

(2) collect 1ml cell suspending liquid (cell number is more than 1*105), be placed in 1.5ml centrifuge tube；

(3) 13000 × g are centrifuged 1min, collect precipitation, discard culture medium；

(4) 500ul PBS rifle head pressure-vaccum or vortex oscillation, resuspended precipitation are added.13000 × g is centrifuged 5min；

(5) step 4 is repeated once；

(6) add 50 μ l Cell Lysis Buffer, after rifle head pressure-vaccum, fully mixing, hatch in 55 DEG C of water-baths 20min；

(7) sample is placed in 95 DEG C heating 5min；

After (8) 13000 × g are centrifuged 5min, taking 5 μ l supernatants as template, 25 μ lPCR reaction systems are: ddH20 6.5 μ L, Myco Mix 1 μ l, 2x Taq Plus Mix Master (Dye Plus) 12.5 μ l, template 5 μ l；PCR cycle condition is: 95 DEG C of 30sec, (95 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 30sec) * 30cycle, 72 DEG C of 5min.

(9) detection of mycoplasma result shows (as shown in Figure 9 with shown in table 5), supercentrifugation, supercentrifugal process, ion The recombined lentivirus vector of exchange chromatography purification is all without mycoplasma.

Table 5 detection of mycoplasma

The Function detection of embodiment 3 recombined lentivirus vector lvCAR20-CLA, lvCAR20-CLB, lvCAR20-OLC

One, the cellular level detection of expression of CAR gene:

(1), after recombined lentivirus vector lvCAR20-CLA, lvCAR20-CLB, lvCAR20-OLC infection of PBMCs cell, receive Collection cell uses RT-PCR to carry out the detection of CAR mRNA transcriptional level, and the expression of checking CAR gene, if CAR mRNA transcribes Level increases, then the transcriptional level of explanation CAR gene is expressed successfully；

(2), after recombined lentivirus vector lvCAR20-CLA, lvCAR20-CLB, lvCAR20-OLC infection of PBMCs cell, receive Collection cell uses western blot to carry out the detection of CAR protein expression level, verifies the expression of CAR gene, if CAR albumen Expression increases, then the translation skill of explanation CAR gene is expressed successfully；

(3) respectively by lvCAR20-CLA, lvCAR20-CLB, lvCAR20-OLC and the sense of comparison virus MOCK of MOI=15 Dye cell, extracts the total serum IgE of cell in 6 orifice plates and total protein carries out fluorescent quantitative PCR experiment respectively and immunoblotting is real after 48h Test.Concrete steps: be coated four holes of 6 orifice plates, each hole adds corresponding PBS and RN, and 4 DEG C overnight.MOI=is pressed after 12 hours 15 are coated virus, and 37 DEG C of incubators place 5h；6 orifice plates taken out, discard viral supernatants, wash twice with PBS, by 1*106/ hole, It is coated PBMC (separating from human blood with lymphocyte separation medium), adds 500ul culture medium (containing 10% serum, 20U/ml IL- 2、 Polybrene 8ug/ml).Stand 20 DEG C of centrifugal 30min of 20min, 1000g, cultivate 48h for 37 DEG C.

(4) total serum IgE of PBMC cell during Trizol method extracts 6 orifice plates, reverse transcription amplification cDNA, by QPCR primer (sequence For SEQ ID NO.46---SEQ ID NO.49) carry out fluorescent quantitative PCR experiment, reaction system is shown in Table 6, with internal reference Actin is Matched group, that verifies its mRNA transcribes situation.

Reagent	Volume (μ l)
		SYBR premix ex taq:	10μl
ROX Reverse Dye(50x)	0.4μl
		Forward primer (2.5 μMs):	0.5μl
Downstream primer (2.5 μMs):	0.5μl
		cDNA	1.0μl
ddH2O	7.6μl

Table 6 20 μ l qPCR reaction system

(5) protein immunoblot (Western Blot) is total by extract from PBMC by polyacrylamide gel electrophoresis Protein is pressed relative molecular mass and is separated.Use wet turn (4 DEG C, 400mA, 120min), by protein delivery to pvdf membrane.By envelope Close liquid (the TBST solution containing 5% skim milk) room temperature closing pvdf membrane 1h, confining liquid 1:1000 and dilute Biotinylated Protein L, then with the pvdf membrane incubated at room closed 4 DEG C overnight.TBST washes film 3 times, each 10min.Confining liquid 1: 500 dilute corresponding SA-HRP, and incubated at room temperature pvdf membrane 2h, TBST wash film 3 times, each 10min.Use Amersham company ECL+plusTM Western blotting system test kit develops the color.X-ray development obtains the film of display band.

(6) RT-QPCR detection display, the expression of the CAR after recombined lentivirus vector infection of PBMCs is than comparison virus MOCK and ghost are increased significantly (as shown in Figure 10 with shown in table 7), illustrate that the transcriptional level of CAR gene is expressed successfully.

Table 7 RT-QPCR testing result

(7) result of protein immunoblot (Western Blot) shows, CAR albumen is expressed in recombinant slow virus system (as shown in figure 11), illustrate that the translation skill of CAR gene is expressed successfully.

Two, cytokine secretion and fragmentation effect assessment.

(1) cultivate respectively CD20+K562 cell and effector lymphocyte lvCAR20-CLA-PBMC, lvCAR20-CLB-PBMC, lvCAR20-OLC-PBMC；

(2) target cell (CD20+K562) 4x105cells and effector lymphocyte's (CART cell) 2.8x106cells is collected, 800g, 6min are centrifugal, abandon supernatant；

(3) with 1ml 1xPBS solution resuspended target cell and effector lymphocyte respectively, 800g, 6min are centrifugal, abandon supernatant；

(4) step 3 is repeated once；

(5) with 700ul culture medium (1640 culture medium+10%FBS) resuspended effector lymphocyte, by 2ml culture medium, (1640 cultivate Base+10%FBS) resuspended target cell；

(6) effect target is set than the experimental port for 1:1,5:1,10:1, and matched group is set, often the multiple holes of group 3；

(7) 250xg, 5min flat board is centrifuged；

(8) 37 DEG C of 5%CO2 incubators are cultivated 4 hours；

(9) 250xg, 5min flat board is centrifuged；

(10) take the 50ul supernatant in each hole in new 96 orifice plates, and every hole adds 50ul substrate solution, and (lucifuge is grasped Make)；

(11) lucifuge hatches 25 minutes；

(12) every hole adds 50ul stop buffer；

(13) microplate reader detection 490nm absorbance；

(14) are averaged in 3 multiple holes；The light absorption value in all experimental ports, Target cell wells and effector lymphocyte hole is deducted training Support the average of base background light absorption value；The light absorption value of target cell maximum is deducted the average of volume correction comparison light absorption value.

(15) by step 14 obtain corrected value bring formula below into, calculate each effect target than produced carefully Cellular toxicity percentage ratio.As shown in figure 12, the PBMC cell of recombined lentivirus vector lvCAR20-OLC transduction imitates target in difference to result The PBMC cell that under the conditions of Bi, killing-efficiency is transduceed apparently higher than lvCAR20-CLA and lvCAR20-CLB；

Killing-efficiency=(experimental port-effector lymphocyte hole-Target cell wells)/(target cell largest hole-Target cell wells) X100%

(16) sample repeating to prepare a step 6 detects Cytokine Expression Level for qPCR, result such as Figure 13 institute Showing, the PBMC cell of recombined lentivirus vector lvCAR20-OLC transduction is IL-2 and IFN-γ under the conditions of difference effect target ratio The PBMC cell that mRNA transcriptional level is transduceed apparently higher than lvCAR20-CLA and lvCAR20-CLB；

Three, root (CD20-specific adoptive immunotherapy for lymphoma according to the literature using a chimeric antigen receptor with both CD28 and 4-1BB domains:pilot clinical trial results.Brian G.Till,et al.Blood.2012；119 (17): 3940-3950.), CAR20 carrier pin has good effect to B lymphoma.

This research is #NCT00621452 at the number of registration of www.clinicaltrials.gov.This research uses and expresses The T lymphocyte of CAR20 gene is for treating CD20+ lymphoma mantle cell (MCL) and the inertia B cell lymphoma of recurrence refractory Patient.CAR20-T lymphocyte cell line to CD20+ in vitro has obvious lethal effect compared with the control (such as Figure 14 A Shown in)；After feeding back patient, increasing over time, the lymph node of patient's neck is obviously reduced；CT scan shows, CAR20-T Lymphocyte feeds back 1 month, within 6 months, 12 months, later compared with before feedback, lymphoma lump substantially disappears (such as Figure 14 B institute Show)；The increase in time after CAR20-T lymphocyte feeds back of the volume of tumor has significantly reduces (as shown in Figure 14 C).Adopt Property CAR20-T cell therapy has good prospect in terms of the treatment for B cell malignant tumor.

Embodiment 4 third generation slow virus skeleton carrier 3rdLV-CAR20 and second filial generation slow virus skeleton carrier 2ndLV- CAR20 titre compares.

Build 3rdLV-CAR20 and 2ndLV-CAR20 respectively；Plasmid construction, virus are packed, virus ultracentrifugation concentrates, Titration procedure reference example 1；The titre results of continuous 3 batches as shown in figure 15, third generation slow virus skeleton carrier The titre of 3rdLV-CAR20 is better than second filial generation slow virus skeleton carrier 2ndLV-CAR20；Therefore, this patent selects use the Three generations's slow virus skeleton carrier is as the lift-launch skeleton of CAR gene.

Embodiment 5 second filial generation CAR slow virus carrier 3rdLV-2ndCAR20 and third generation CAR slow virus carrier 3rdLV- 3rd CAR20 killing-efficiency compares.

Build 3rdLV-2ndCAR20 and 3rdLV-3rdCAR20 respectively；Plasmid construction, virus packaging, virus ultracentrifugation Concentration, titration procedure reference example 1；Killing experiments reference example 3；Second filial generation CAR slow virus carrier 3rdLV- 2ndCAR20 and third generation CAR slow virus carrier 3rdLV-3rd CAR20 killing-efficiency results contrast as shown in figure 16,3rdLV- 3rd CAR20 is higher for killing-efficiency ratio 3rdLV-2ndCAR20 of not showing under the conditions of difference effect target ratio of target cell Effect；Therefore, this patent selects the slow virus carrier using the design of second filial generation CAR as clinical experiment carrier.

Below preferred embodiment to the invention is illustrated, but the invention is not limited to described Embodiment, those of ordinary skill in the art also can make all equivalents on the premise of the invention spirit Modification or replacement, modification or the replacement of these equivalents are all contained in the application claim limited range.

Claims (18)

1. an anti-CD20 Chimeric antigen receptor, including the CD8 leader Chimerical receptor signal peptide being sequentially connected in series, CD20 strand Light chain of antibody VL, Optimal Linker C, CD20 single-chain antibody heavy chain VH, CD8 Hinge Chimerical receptor hinge, CD8 Transmembrane Chimerical receptor cross-film district, CD137 Chimerical receptor costimulating factor as shown in SEQ ID NO.23, and TCR Chimerical receptor t cell activation territory as shown in SEQ ID NO.24.

Anti-CD20 Chimeric antigen receptor the most according to claim 1, it is characterised in that: the amino of described Chimeric antigen receptor Acid sequence is as shown in SEQ ID NO.50.

3. an anti-CD20 Chimeric antigen receptor, including the CD8 leader Chimerical receptor signal peptide being sequentially connected in series, CD20 strand Light chain of antibody VL, Optimal Linker C, CD20 single-chain antibody heavy chain VH, CD8 Hinge Chimerical receptor hinge, CD8 Transmembrane Chimerical receptor cross-film district, CD28 Chimerical receptor costimulating factor, CD137 Chimerical receptor costimulating factor, with And TCR Chimerical receptor t cell activation territory.

Anti-CD20 Chimeric antigen receptor the most according to claim 3, it is characterised in that: the amino of described Chimeric antigen receptor Acid sequence is as shown in SEQ ID NO.51.

5. the gene of the coding anti-CD20 Chimeric antigen receptor described in any one of claim 1-4.

Gene the most according to claim 5, it is characterised in that: the nucleotide sequence of described gene such as SEQ ID NO.52 or Shown in SEQ ID NO.53.

7. contain the recombinant expression carrier of gene described in claim 5 or 6.

Recombinant expression carrier the most according to claim 7, it is characterised in that: described expression vector is that slow virus expresses load Body, retrovirus expression vector, adenovirus expression carrier, glandular associated virus expression vector or plasmid.

Recombinant expression carrier the most according to claim 8, it is characterised in that: described Lentiviral comprises right Require the gene described in 5.

Recombinant expression carrier the most according to claim 9, it is characterised in that: described Lentiviral includes: use Prokaryotic replions pUC Ori sequence in plasmid replication；For purpose bacterial strain expand in a large number containing ampicillin resistance gene AmpR sequence；The Viral Replicon SV40 Ori sequence of the duplication in strengthening eukaryotic cell；For slow virus packaging slow Virus packaging cis element；ZsGreen1 green fluorescent protein for eukaryotic cell expression green fluorescence；For jointly transcribing The IRES ribosome binding sequence of marking protein；People's EF1 α promoter for the eukaryotic transcription of Chimeric antigen receptor gene； For composition integrate identification, transmit, the encoding gene of the Chimeric antigen receptor of the secondary CAR that starts or three generations CAR；For Strengthen the eWPRE enhancement mode marmot hepatitis B virus posttranscriptional regulatory element of the expression efficiency of transgenic.

11. recombinant expression carriers according to claim 9, it is characterised in that described slow virus packaging cis element uses Second filial generation slow virus carrier includes: slow virus 5 terminal LTR, slow virus 3 terminal Self-Inactivating LTR, Gag cis element, RRE cis element, env cis element, cPPT cis element.

12. recombinant expression carriers according to claim 9, it is characterised in that described slow virus packaging cis element uses Third generation slow virus carrier includes: slow virus 5 terminal LTR, slow virus 3 terminal Self-Inactivating Slow virus packaging cis element described in LTR, Gag cis element, RRE cis element, env cis element, cPPT cis element, with And RSV promoter.

13. according to the recombinant expression carrier described in any one of claim 9-12, it is characterised in that described eWPRE enhancement mode soil Dialling Mus hepatitis B virus posttranscriptional regulatory element has the enhancing of 6 nucleotide to suddenly change, particularly as follows: g.396G > A, g.397C > T, g.398T>C、g.399G>A、g.400A>T、g.411A>T。

The construction method of 14. 1 kinds of recombinant expression carriers as according to any one of claim 9-13, comprises the following steps:

(1) ampicillin resistance gene AmpR sequence, prokaryotic replions pUC Ori sequence, Viral Replicon SV40 will be contained Ori sequence, the slow virus packaging cis element for slow virus packaging, ZsGreen1 green fluorescent protein, IRES ribosome knot Close sequence, eWPRE enhancement mode marmot hepatitis B virus posttranscriptional regulatory element is stored on slow virus skeleton plasmid；

(2) by people's EF1 α promoter, be used for forming integrate identification, transmit, the secondary CAR that starts or three generations CAR chimeric Antigen receptor is combined into secondary CAR or three generations's CAR design, is cloned into slow virus skeleton through enzyme action, connection, recombining reaction In plasmid, obtain the recombinant slow virus plasmid of secondary CAR or three generations CAR design；

(3) by the recombinant slow virus plasmid obtained and slow virus packaging plasmid pPac-GP, pPac-R and memebrane protein plasmid PEnv-G transfects HEK293T/17 cell jointly, after carrying out gene transcript expression, packs and successfully weighs in HEK293T/17 cell Group slow virus carrier can be discharged in cells and supernatant, collects the supernatant of the recombined lentivirus vector comprised；

(4) sucking filtration, absorption, the ion-exchange method of eluting is used to be purified the recombinant slow virus supernatant obtained, respectively To recombined lentivirus vector.

15. construction methods according to claim 14, it is characterised in that in step (4), described sucking filtration step controls supernatant Volume at 200ml～2000ml, vacuum degree control at-0.5MPA～-0.9MPA,；Described adsorption step controls the pH value of solution 6～8；Described elution step controls the ionic strength of eluent at 0.5M～1.0M.

16. 1 kinds of CAR-T cells, described CAR-T cell is by the anti-CD20 chimeric antigen described in any one of claim 1-4 The T lymphocyte that receptor is modified.

The application in preparing lymphoma treating medicine of the 17. CAR-T cells according to claim 16.

18. application according to claim 17, it is characterised in that described lymphoma treating medicine is that lymphoma mantle cell is controlled Treat medicine or follicular lymphoma medicine.