CN105936907A - Seed breeding method for reducing cadmium content in rice grains - Google Patents
Seed breeding method for reducing cadmium content in rice grains Download PDFInfo
- Publication number
- CN105936907A CN105936907A CN201610269268.4A CN201610269268A CN105936907A CN 105936907 A CN105936907 A CN 105936907A CN 201610269268 A CN201610269268 A CN 201610269268A CN 105936907 A CN105936907 A CN 105936907A
- Authority
- CN
- China
- Prior art keywords
- breeding method
- rice
- sequence
- oslct1
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a seed breeding method for reducing the cadmium content in rice grains, wherein the method includes the steps: cloning an OsLCT1 exon of a rice receptor material; using a CRISPR/Cas9 system, selecting a target sequence according to an exon sequence, and constructing a pCRISPR/Cas9 recombinant vector; introducing the pCRISPR/Cas9 recombinant vector into a rice callus to obtain transgenic plants; screening a transgenic positive plant; obtaining a mutant plant; and carrying out seed propagation on the mutant plant, and separating a disfunction mutant containing no transgenic ingredients in future generation plants. The rice OsLCT1 is directionally knocked out by using the CRISPR/Cas9 technology, a cadmium transportprotein OsLCT1 is completely inactivated, and the rice material having no transgenic ingredients, having the content of cadmium in rice decreased significantly and having no significant variation of comprehensive agronomic characters is directionally bred; the method has the advantages of safety, high efficiency, time saving, low cost and the like.
Description
Technical field
The present invention relates to rice biological technology Breeding field, be specifically related to a kind of breeding side reducing rice grain cadmium content
Method.
Background technology
Along with the development of China's industrialization and urbanization, Industrial " three Waste ", municipal refuse and sewage irrigation etc. cause
Heavy metal pollution of soil constantly aggravates.Wherein, the heavy metal cadmium (Cadmium, Cd) active migration in soil food chain is
Human health is constituted a serious threat.In the last few years, rice cadmium exceed standard event repeatly show space in a newspaper, China's grain-production is caused seriously
Security challenge, cause the great attention of national each ministries and commissions.For this present situation, low cadmium-accumulation rice varieties is extensively carried out in the whole nation
Screening and relevant agronomic culture technical research, at aspects such as effect and side effect, cost and time cycles, there is also many needs
The problem solved.And the Cd accumulation character of orderly improvement Oryza sativa L., cultivate low cadmium kind be solve rice cadmium excessive problem environmental protection,
Most economical method.
Along with going deep into of research, rice absorbing, transport, distribute and the physiological process mechanism of Accumulation in Grains cadmium is the brightest
Clear: (1) root hair cell absorbs Cd from the soil liquid2+；(2) xylem mediation Cd is transported to stem and leaf by root；(3) at stipes
In, part Cd is transported in phloem by xylem, then by phloem mediation Cd preferential transport to top stipes, and finally transport
In seed；(4) in grouting parameter, leaf, the Cd of accumulation activates again, by phloem mediate transport to seed, and this part
Cd accounts for the nearly half of seed Cd accumulation.The most traditional seed cadmium content method improved the breed is for utilizing low cadmium material and being subject to
Body material hybridizes, backcrosses, and identifies many generation screenings in conjunction with offspring's Observation on Agronomic Characters and cadmium content, and such breeding method breeding is all
Phase is long, and how many how many generations that backcrosses all can penetrate into other genes chain with target gene, changes genetic background, impact
The economical character of receptor kind.
Summary of the invention
The technical problem to be solved in the present invention is to overcome the deficiencies in the prior art, it is provided that a kind of based on CRISPR/Cas9 system
System targeting sudden change OsLCT1 reduces the breeding method of rice grain cadmium content, utilizes CRISPR/Cas9 technology orientation to knock out Oryza sativa L.
OsLCT1, thoroughly inactivation cadmium transport protein OsLCT1, orientation is bred as without transgene component, and Cd concentration of brown rice significantly reduces, and combines
Close economical character without the rice material of significant variation, there is the advantages such as safe efficient, saving time, low cost.
To this end, the invention provides a kind of breeding method reducing rice grain cadmium content, comprise the following steps:
S1, the 3rd exon, the order-checking of OsLCT1 of cloning rice acceptor material；
S2, utilize CRISPR/Cas9 system, select target sequence according to the 3rd exon sequence of meter；
S3, the structure pCRISPR/Cas9 recombinant vector containing described target sequence fragment；
S4, the pCRISPR/Cas9 recombinant vector Introduced into Rice callus that will be obtained obtain transgenic seedling；
S5, the transgenic positive plant screened in described transgenic seedling；
S6, utilize described transgenic positive plant obtain mutant plant；
S7, described mutant plant is carried out breeding, in Progeny plants, separate the afunction without transgene component dash forward
Variant, is the Oryza sativa L. that Cd concentration of brown rice reduces.
Above-mentioned breeding method, it is preferred that in described step S2 the target sequence of design a chain have 5 '-
(N)X-NGG-3 ' structure, described N represents that any one in A, T, C and G, described X are 19 or 20.
Above-mentioned breeding method, it is preferred that described target sequence includes that TPS1 and TPS2, the DNA sequence of described TPS1 are
Sequence shown in SEQ ID NO.2, the DNA sequence of described TPS2 is the sequence shown in SEQ ID NO.3.
Above-mentioned breeding method, it is preferred that described step S3 specifically includes following steps:
S3-1, according to target sequence and restriction enzyme site information, the adapter-primer of design band sticky end；
S3-2, enzyme action initial carrier；
S3-3, the adapter-primer of described band sticky end is annealed after be connected on the initial carrier that enzyme action is crossed, obtain weight
Group gRNA expression cassette；
S3-4, described restructuring gRNA expression cassette is carried out PCR amplification obtain amplified production；
S3-5, enzyme action amplified production, be connected to the amplified production after enzyme action on the pCRISPR/Cas9 carrier that enzyme action is crossed,
Obtain recombinant vector.
Above-mentioned breeding method, it is preferred that adapter-primer described in described step S3-1 include TSP1-F, TSP1-R,
TSP2-F and TSP2-R, the DNA sequence of described TPS1-F is the sequence shown in SEQ ID NO.4, the DNA sequence of described TPS1-R
For the sequence shown in SEQ ID NO.5, the DNA sequence of described TPS2-F is the sequence shown in SEQ ID NO.6；Described TPS2-R
DNA sequence be the sequence shown in SEQ ID NO.7.
Above-mentioned breeding method, it is preferred that described initial carrier is pU3-gRNA or pU6a-gRNA.
Above-mentioned breeding method, it is preferred that use initial carrier described in Bsa I enzyme action in described step S3-2.
Above-mentioned breeding method, it is preferred that use amplified production described in Bsa I enzyme action in described step S3-5.
Mainly make use of the cleavage site of the Bsa I feature outside recognition site, it is simple to one time enzyme action produces multiple band
The DNA fragmentation of different sticky ends, once completes enzyme action, connection.
Above-mentioned breeding method, it is preferred that in described step S3-3, the adapter-primer of described band sticky end is positioned at described
Between two Bsa I restriction enzyme sites of expression vector, form the gRNA expression cassette of restructuring.
Above-mentioned breeding method, it is preferred that described step S6 step is particularly as follows: extract described transgenic positive plant
DNA, carries out PCR amplification and obtains amplified production；Described amplified production is checked order, selects two equipotential OsLCT1 that merit all occurs
The T of energy deletion mutation0For the plant of Mutants homozygous and double allelic variant bodies as mutant plant.
Compared with prior art, it is an advantage of the current invention that:
(1) the invention provides one to contain based on CRISPR/Cas9 system targeting sudden change OsLCT1 reduction rice grain cadmium
The breeding method of amount.OsLCT1 is that in Oryza sativa L., the crucial of unique authentication participation phloem transport Cd out transports egg at present
In vain, the Cd content of the seed of OsLCT1 RNAi strain can be down to about the 50% of comparison, its form phenotype, biological yield and warp
Ji yield relatively compares without marked difference.The present invention improves based on CRISPR/Cas9 system, rite-directed mutagenesis OsLCT1, slewing
The seed Cd accumulation character of Oryza sativa L., it is thus achieved that the significantly reduced rice material of cadmium content can be without transgene component.This technology
On the one hand method has evaded the potential safety hazard that transgenic may bring, and on the other hand owing to being targeting sudden change, has DNA damage
Little, that mutational site is controlled advantage.
(2) the invention provides one to contain based on CRISPR/Csa9 system targeting sudden change OsLCT1 reduction rice grain cadmium
The breeding method of amount, uses 5 '-(N)XThe target sequence of-NGG-3 ' structure, the 12bp of target sequence NGG upstream is at paddy gene
Group has preferable specificity, the probability that misses the target can be significantly reduced.
(3) the invention provides one to contain based on CRISPR/Cas9 system targeting sudden change OsLCT1 reduction rice grain cadmium
The breeding method of amount, substantially reduces breeding cycle, accelerates breeding process, save time and cost.
(4) the invention provides one to contain based on CRISPR/Cas9 system targeting sudden change OsLCT1 reduction rice grain cadmium
The breeding method of amount, owing to being targeting rite-directed mutagenesis, does not change the genetic background of acceptor material；And conventional hybridization, educating of backcrossing
The method of kind, backcrosses how many for all how much penetrating into other genes chain with target gene, and change genetic background, impact is subject to
The economical character of body kind.
Accompanying drawing explanation
For making the purpose of the embodiment of the present invention, technical scheme and advantage clearer, below in conjunction with the embodiment of the present invention
In accompanying drawing, the technical scheme in the embodiment of the present invention is carried out clear, complete description.
Fig. 1 is the T in embodiment 11For plant hygromycin positive test symbol；Wherein 1-20 represents that 20 strains are different respectively
T1For plant, CK+Represent positive control, CK-Represent negative control.
Fig. 2 is the mutant oslct1 in embodiment 1 and the brown rice Cd content of comparison WT；Material is in the Cd stress of 4mg/kg
Potted plant growth, repeats for three times.
Fig. 3 is the mutant oslct1 in embodiment 1 and brown rice Mn, Cu, Fe, Zn content of comparison WT；Material is in 4mg/
The Cd stress potted plant growth of kg, repeats for three times.
Detailed description of the invention
Below in conjunction with Figure of description and concrete preferred embodiment, the invention will be further described, but the most therefore and
Limit the scope of the invention.
Embodiment
Material and instrument employed in following example are commercially available.
Embodiment 1:
A kind of breeding method reducing rice grain cadmium content of the present invention, effectively improves the Cd accumulation of rice grain
Shape, step is as follows:
1) the 3rd exon of OsLCT1 of japonica rice variety 107 is cloned, i.e. after OsLCT1 translation initiation codon ATG the
The nucleotide sequence of 214～1533, checks order.Sequencing result is the sequence shown in SEQ ID NO.1:
ggtgcggaggccgcttctgcagcggggaggagtaacgagaaggaggaacaagtagaactccgcaaggtccagaagga
tatcgagttaggggcacttgttgccggcttctccttctccgtggcgatgaccggcttcttcctcagcccgcaagcga
cggggcggcaagccatatacatcgacatctcgatgttcctcgccttctcatctttcgtctgtggctgtacgttcatg
ttgctgagaatgcagcggctcagcgccagggaggagcacatctctggcttccaccacgccatctccaagtgcctctt
ctatctttgctgcgttctaccggtgctgacaatactttgtctgctgctggttatgccgcgcaagccttacatctacg
taggactcggcgtcctcgcggcggccgtggtgccggtggccctcatgcactggtacgtgagccgcaagacccagctg
gaaaccaacgacacggcacctgaggatgttgagcagaatgcaatgagccgcaagacccaggaaaccaacggcacggc
gcctgaggacgacgatgagcagaaggcgatggagtccagctataagatcacctcggccatcgtccccatgtcgttgg
cgggcctcgtcggcgtgctcttcggcgtctacaaggggggcagcagcagtggaggcgccggcggcgacatctccggc
tctgtccacgtcgtcatcatgtgcatgttcatcacctcgatgttaagcatgctcctgatgatgctgtggatgaaggt
cctggagagcaagaaaccgaagctccgggagttcttcgtcagagctactatcccgcgtgccaatgcggcccttctag
ccttgctcgcgatcgccgccttcgccgcgtcgtttgggatcctcaggtggtacatggtagccgcgttcctgactctc
gccttggctgccaccgtccaattcgtcatccagcactgcaccagagagcagaatgccgtgcgagctagccacaacga
gacgcagctcaagtggatggcggacatggcgagcaagacgacaccgtggtctctggggatagtcatggcgatctttg
gaggctttcttggagacgatgataaaagcaaggacaagatggtggcccttaaggtctgcatgttcttatcgacctcg
gcgttcacgtcgggccttgggctcatgtacctgaccatgcgaccgggagagtcagccagaggaggtacctccaaagc
ggccatgaccatactggcttggtctgtcatggtgttgctttctgcagccgcgcttgctatctatggcgtcgaagtta
tgaagtcatag
2) according to step 1) in the 3rd exon sequence, design two target sequence, respectively TPS1 and TPS2:
TPS1 (SEQ ID NO.2):CCGCGTCGTTTGGGATCCTCAGG；
TPS2 (SEQ ID NO.3):CCGTGGTCTCTGGGGATAGTCAT。
The reverse complemental chain of above two target sequence contains 5 '-(N)X-NGG-3 ' structure.Wherein, underscore part is
5’-(N)XThe complementary strand sequence of the NGG in-NGG-3 ' structure.
3) containing the structure of the double target spot pCRISPR/Cas9 recombinant vector of TPS1, TPS2:
3.1, the target sequence double-strand of anamorphic zone sticky end, as adapter-primer:
TPS1 includes synthesizing forward oligonucleotide chain TSP1-F (SEQ ID NO.4) and reverse oligonucleotide complementary therewith
Chain TSP1-R (SEQ ID NO.5), TPS2 include synthesizing forward oligonucleotide chain TSP2-F (SEQ ID NO.6) and complementation therewith
Reverse oligonucleotide chain TSP2-R (SEQ ID NO.7), particular sequence is:
TSP1-F (SEQ ID NO.4):GCCGCCTGAGGATCCCAAACGACG；
TSP1-R (SEQ ID NO.5):AAACCGTCGTTTGGGATCCTCAGG；
TSP2-F (SEQ ID NO.6):GGCATGACTATCCCCAGAGACCA；
TSP2-R (SEQ ID NO.7):AAACTGGTCTCTGGGGATAGTCA。
Wherein, remove during uncrossed part is target sequence TPS1 (SEQ ID NO.2), TPS2 (SEQ ID NO.3)
The sequence of NGG or its complementary series, underscore part is the sticky end for connecting carrier.
3.2, pCRISPR/Cas9 recombinant vector is built:
3.2.1 the preparation of joint: adapter-primer TSP1-F, TSP1-R, TSP2-F and TSP2-R are dissolved into 100 μMs respectively
Mother solution, respectively take 1 μ L, wherein TSP1-F with TSP1-R mixes, TSP2-F with TSP2-R mixes, and is diluted to 1 μM.Transfer at 95 DEG C
Put 30S, move to room temperature cooling, complete annealing.
3.2.2 enzyme action pU3-gRNA, pU6a-gRNA carrier: with 10U Bsa I enzyme action pU3-in 20 μ L reaction systems
GRNA, pU6a-gRNA carrier 20min, places 5min at 70 DEG C and makes enzyme inactivate, obtain pU3-gRNA, pU6a-after enzyme action
GRNA carrier.
3.2.3 pU3-gRNA, pU6a-gRNA carrier joint obtained in step 3.2.1 and step 3.2.2 obtained
Coupled reaction: take 1 μ L 10x T4 DNA ligase buffer, 0.5 μ L pU3-gRNA/pU6a-gRNA carrier (12ng), 1 μ
LTSP2/TSP1,1 μ L T4 DNA ligase (35U), finally add ddH2O to cumulative volume 10 μ l, connects at 20 DEG C～25 DEG C
15min, obtain restructuring sgRNA expression cassette: pU3-TSP2-gRNA, pU6a-TSP1-gRNA.
3.2.4PCR expand expression cassette: with KOD high-fidelity enzyme, and U3-F, U3-R primer is in, amplification step 3.2.3
The pU3-TSP2-gRNA arrived；With KOD high-fidelity enzyme, and U6a-F, U6a-R primer is to obtaining in, amplification step 3.2.3
PU6a-TSP1-gRNA expression cassette.Wherein the sequence of primer pair is respectively as follows:
U3-F (SEQ ID NO.8): TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG；
U3-R (SEQ ID NO.9): AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC；
U6a-F (SEQ ID NO.10): TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG；
U6a-R (SEQ ID NO.11): AGCGTGGGTCTCGACCGGGTCCATCCACTCCAAGCTC；
Reaction system is: 1 μ L pU3-TSP2-gRNA/pU6a-TSP1-gRNA carrier, 0.5 μ L U3-F/U6a-F, 0.5 μ
L U3-R/U6a-R, 4 μ L dNTP, 15 μ L 2xbuffer, 0.5 μ L KOD enzyme, adds ddH2O to cumulative volume 30 μ L.
Response procedures is: 95 DEG C of denaturations 1min, 28 circulations: 95 DEG C of degeneration 10s, 60 DEG C of annealing 15s, 68 DEG C of extensions
20s.Electrophoresis, pU3-TSP2-gRNA, pU6a-TSP1-gRNA expression cassette mixed in equal amounts after amplification, purifies examination by PCR primer
Agent box purification.
3.2.5 enzyme action amplified production, be connected on the pCRISPR/Cas9 carrier that enzyme action is crossed obtain pCRISPR/Cas9 weight
Group carrier.Concrete construction method uses the method that enzyme action limit, limit connects, with Bsa I as restriction endonuclease.
Reaction system is as follows: 1 μ L pU3-TSP2-gRNA (30ng), pU6a-TSP1-gRNA expression cassette mixture, 1 μ L
PCRISPR/Cas9 carrier (80ng), 1 μ L Bsa I (10U), 1.5 μ L 10xSmart Buffer, 1.5 μ L ATP (1mM), 1 μ
L T4 DNA ligase (35U), finally adds ddH2O to cumulative volume 15 μ L.
Response procedures: complete 12 circulations in PCR instrument: 37 DEG C of 5min, 10 DEG C of 5min, 20 DEG C of 5min.
Construction method can refer to the document A Robust CRISPR/Cas9 System for Convenient such as Ma,
High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants.Mol
Plant(2015)。
4) Agrobacterium tumefaciens-mediated Transformation Oryza sativa L.: by step 3) in the pCRISPR/Cas9 recombinant vector that builds import agriculture
Bacillus specie EHA105, with mature seed callus induction on inducing culture of japonica rice variety 107.Specifically comprise the following steps that
EHA105 containing pCRISPR/Cas9 recombinant vector is inoculated in YM agar culture medium 28 DEG C cultivation within 2 days, trained
Nutrient solution.The culture fluid collected is joined in the NB fluid medium of the acetosyringone containing 100mol/L, adjust OD600 to arrive
0.5 obtains bacterium solution.Rice Callus is soaked in above bacterium solution 30min, with aseptic water washing 3～5 times, uses sterilizing filter paper
Suck dry moisture, air-dries, after transfer to NB agar culture medium and cultivate 26 DEG C～28 DEG C of light culture 3 days.Then transfer callus is extremely
26 DEG C～28 DEG C light culture of culture medium containing 50mg/L hygromycin, every 15 days subcultures once, subculture 2 times.After resistance screening, turn
Enter to regeneration culture medium, differentiate transgenic seedling.Detect through hygromycin PCR, obtain 23 strain transgenic positive plant altogether.
5) qualification in mutational site:
5.1, the genomic DNA of above-mentioned transgenic positive plant is extracted.
5.2, for the DNA fragmentation within the 800bp containing target site, specific primer is designed, with T0For transgenic water
The genomic DNA of rice or cDNA are template, the amplification DNA fragmentation containing target site, concretely comprise the following steps:
The DNA extracted in step 5.1 is as template, with T-C-F4 and T-C-R4 as forward primer with downstream primer, with height
Fidelity enzymatic amplification comprises the DNA fragmentation in dual-target site.
T-C-F4:GTCGGCGTGCTCTTCGGCGT (SEQ ID NO.12)；
T-C-R4:CTCCCGGTCGCATGGTCAGGT (SEQ ID NO.13).
Reaction system: 0.5 μ L DNA profiling, 1 μ L T-C-F4,1 μ L T-C-R4,4 μ L dNTP, 15 μ L 2xbuffer,
0.5 μ L KOD enzyme, adds ddH2O to cumulative volume 30 μ L.
Response procedures: 95 DEG C of denaturations 3min, 30 circulations: 98 DEG C of degeneration 10s, 64 DEG C of annealing 30s, 68 DEG C extend 40s.
5.3, the PCR primer purified Hou Song company order-checking that amplification obtains, sequencing result and WT lines sequence alignment,
For the sample that sequencing result is folded peak, TA clones, about 10 monoclonals of picking, and sample genotype, portion are analyzed in order-checking comparison
Divide mutant analysis results as shown in table 1.
The T that table 1:CRISPR/Cas9 system introduces0For transfer-gen plant mutant nucleotide sequence analysis result table
Table 1 is the T that the CRISPR/Cas9 system in embodiment 1 introduces0Analyze for transfer-gen plant mutant nucleotide sequence；6-7、
7-1 etc. represent different transgenic lines, and CK represents comparison；WT represents wild type；The letter of mark underscore is NGG sequence
Reverse complementary sequence；"-//-" represent that base is omitted herein；"-" represents base deletion, and " Inv " represents inversion, numeral thereafter
Represent base number.
Show from the sequencing result of table 1, it is thus achieved that 23 strain T0All occur targeting InDel to suddenly change for transfer-gen plant, prominent
Variability is 100%, and Primary mutations type is the sequence deletion between two target sites or inversion.
6) according to order-checking comparison result, choose OsLCT1 open reading frame generation frameshift mutation or terminate in advance, causing two
The T of individual equipotential OsLCT1 equal generating function deletion mutation0For homozygous mutation strain 7-1 and double allelic variant strains 7-3, breeding,
In T1For transgenic element such as transgenic segregating population Molecular Detection hygromycin, Cas9, result sees Fig. 2, separates without turning base
Afunction mutant because of composition.
Two equipotential OsLCT1 gene equal generating function deletion mutations refer to that two equipotential OsLCT1 genes are in target position
All there is frameshift mutation or terminate in advance in place.Mutants homozygous refers to the sudden change of two equipotential OsLCT1 gene generation sames,
Double allelic variant bodies refer to that two equipotential OsLCT1 genes occur two kinds of different sudden changes.
7) taking the pot experiment of manual simulation Cd stress, soil takes from top layer, land for growing field crops, measures basic fertility, air-dried, mistake
Sieve, roguing, mixing, subpackage is to every basin 25mg/kg, by Cd (CdCl2) adding standby soil in the form of a solution, Cadmium treated concentration is
4mg/kg, balance 4 weeks stand-by.
Afunction mutant in step 7 and comparison are planted in cadmium pollution basin, every basin 6 cave, every cave 2 strain, three weights
Multiple.In rice maturity, investigate Other Main Agronomic Characters, and identify brown rice cadmium content and other relevant Mineral Elements Contents, result
See Fig. 2, Fig. 3.Result shows, oslct1 brown rice cadmium content relatively compares and significantly reduces, and other associated metal elements there is no aobvious
Writing impact, the method can be used for the molecular improvement of rice grain cadmium content.
The above, be only presently preferred embodiments of the present invention, and the present invention not makees any pro forma restriction.Though
So the present invention discloses as above with preferred embodiment, but is not limited to the present invention.Any it is familiar with those skilled in the art
Member, in the case of without departing from the spirit of the present invention and technical scheme, may utilize in method and the technology of the disclosure above
Hold and technical solution of the present invention is made many possible variations and modification, or be revised as the Equivalent embodiments of equivalent variations.Cause
This, every content without departing from technical solution of the present invention, the technical spirit of the foundation present invention is to made for any of the above embodiments any
Simple modification, equivalent, equivalence change and modification, all still fall within the range of technical solution of the present invention protection.
Claims (10)
1. the breeding method reducing rice grain cadmium content, it is characterised in that comprise the following steps:
S1, the 3rd exon of OsLCT1 of cloning rice acceptor material, order-checking；
S2, utilize CRISPR/Cas9 system, select target sequence according to the 3rd exon sequence of OsLCT1；
S3, the structure pCRISPR/Cas9 recombinant vector containing described target sequence fragment；
S4, the pCRISPR/Cas9 recombinant vector Introduced into Rice callus that will be obtained obtain transgenic seedling；
S5, the transgenic positive plant screened in described transgenic seedling；
S6, utilize described transgenic positive plant obtain mutant plant；
S7, described mutant plant is carried out breeding, in Progeny plants, separates the afunction mutant without transgene component,
It is the Oryza sativa L. that Cd concentration of brown rice reduces.
Breeding method the most according to claim 1, it is characterised in that in described step S2 design target sequence one
Bar chain has 5 '-(N)X-NGG-3 ' structure, described N represents that any one in A, T, C and G, described X are 19 or 20.
Breeding method the most according to claim 1, it is characterised in that described target sequence includes TPS1 and TPS2, described
The DNA sequence of TPS1 is the sequence shown in SEQ ID NO.2, and the DNA sequence of described TPS2 is the sequence shown in SEQ ID NO.3
Row.
Breeding method the most according to any one of claim 1 to 3, it is characterised in that described step S3 specifically include with
Lower step:
S3-1, according to target sequence and restriction enzyme site information, the adapter-primer of design band sticky end；
S3-2, enzyme action initial carrier；
S3-3, the adapter-primer of described band sticky end is annealed after be connected on the initial carrier that enzyme action is crossed, obtain restructuring
GRNA expression cassette；
S3-4, described restructuring gRNA expression cassette is carried out PCR amplification obtain amplified production；
S3-5, enzyme action amplified production, be connected to the amplified production after enzyme action on the pCRISPR/Cas9 carrier that enzyme action is crossed obtain
Recombinant vector.
Breeding method the most according to claim 4, it is characterised in that described in described step S3-1, adapter-primer includes
TSP1-F, TSP1-R, TSP2-F and TSP2-R, the DNA sequence of described TPS1-F is the sequence shown in SEQ ID NO.4, described
The DNA sequence of TPS1-R is the sequence shown in SEQ ID NO.5, and the DNA sequence of described TPS2-F is shown in SEQ ID NO.6
Sequence；The DNA sequence of described TPS2-R is the sequence shown in SEQ ID NO.7.
Breeding method the most according to claim 4, it is characterised in that described initial carrier is pU3-gRNA or pU6a-
gRNA。
Breeding method the most according to claim 4, it is characterised in that use described in Bsa I enzyme action in described step S3-2
Initial carrier.
Breeding method the most according to claim 4, it is characterised in that in described step S3-3, described band sticky end
Adapter-primer, between two Bsa I restriction enzyme sites of described expression vector, forms the gRNA expression cassette of restructuring.
Breeding method the most according to claim 4, it is characterised in that in described step S3-5, uses described in Bsa I enzyme action
Amplified production.
10. according to the breeding method according to any one of claim 1,2,3,5,6,7,8 and 9, it is characterised in that described step
S6 step, particularly as follows: extract the DNA of described transgenic positive plant, carries out PCR amplification and obtains amplified production；Described amplification is produced
Thing checks order, and selects the T of two equipotential OsLCT1 equal generating function deletion mutations0For Mutants homozygous and double allelic variant body
Plant as mutant plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610269268.4A CN105936907B (en) | 2016-04-27 | 2016-04-27 | A kind of breeding method for reducing rice grain cadmium content |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610269268.4A CN105936907B (en) | 2016-04-27 | 2016-04-27 | A kind of breeding method for reducing rice grain cadmium content |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105936907A true CN105936907A (en) | 2016-09-14 |
| CN105936907B CN105936907B (en) | 2017-12-12 |
Family
ID=57152504
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610269268.4A Active CN105936907B (en) | 2016-04-27 | 2016-04-27 | A kind of breeding method for reducing rice grain cadmium content |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105936907B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106701818A (en) * | 2017-01-09 | 2017-05-24 | 湖南杂交水稻研究中心 | Method for cultivating rice common nuclear sterile lines |
| CN108265077A (en) * | 2018-04-10 | 2018-07-10 | 湖南文理学院 | A kind of breeding method for reducing rice grain cadmium content |
| CN108794608A (en) * | 2018-03-07 | 2018-11-13 | 中国水稻研究所 | A kind of rice low cadmium-accumulation mutant lcd1 and its application |
| CN109306358A (en) * | 2018-12-17 | 2019-02-05 | 湖南杂交水稻研究中心 | The method for formulating not packet neck two-line sterile line of rice using CRISPR/Cas9 technology |
| CN114410658A (en) * | 2022-03-11 | 2022-04-29 | 四川农业大学 | Gene OsWNK9 for reducing cadmium content of brown rice of rice as well as encoding protein and application thereof |
| CN114540373A (en) * | 2022-03-11 | 2022-05-27 | 四川农业大学 | Gene for reducing cadmium content in rice grains and application thereof |
| CN116072214A (en) * | 2023-03-06 | 2023-05-05 | 之江实验室 | Phenotype intelligent prediction and training method and device based on gene significance enhancement |
-
2016
- 2016-04-27 CN CN201610269268.4A patent/CN105936907B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| SHIMPEI URAGUCHI等: "Low-affinity cation transporter (OsLCT1) regulates cadmium transport into rice grains", 《PNAS》 * |
| XINGLIANG MA等: "A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants.Mol Plant", 《MOLECULAR PLANT》 * |
| 刘仲齐: "水稻体内镉转运机理的研究进展", 《第五届全国农业环境科学学术研讨会论文集》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106701818A (en) * | 2017-01-09 | 2017-05-24 | 湖南杂交水稻研究中心 | Method for cultivating rice common nuclear sterile lines |
| CN106701818B (en) * | 2017-01-09 | 2020-04-24 | 湖南杂交水稻研究中心 | Method for cultivating common genic male sterile line of rice |
| CN108794608A (en) * | 2018-03-07 | 2018-11-13 | 中国水稻研究所 | A kind of rice low cadmium-accumulation mutant lcd1 and its application |
| CN108265077A (en) * | 2018-04-10 | 2018-07-10 | 湖南文理学院 | A kind of breeding method for reducing rice grain cadmium content |
| CN108265077B (en) * | 2018-04-10 | 2021-07-30 | 湖南文理学院 | Breeding method for reducing cadmium content of rice grains |
| CN109306358A (en) * | 2018-12-17 | 2019-02-05 | 湖南杂交水稻研究中心 | The method for formulating not packet neck two-line sterile line of rice using CRISPR/Cas9 technology |
| CN114410658A (en) * | 2022-03-11 | 2022-04-29 | 四川农业大学 | Gene OsWNK9 for reducing cadmium content of brown rice of rice as well as encoding protein and application thereof |
| CN114540373A (en) * | 2022-03-11 | 2022-05-27 | 四川农业大学 | Gene for reducing cadmium content in rice grains and application thereof |
| CN114540373B (en) * | 2022-03-11 | 2023-04-25 | 四川农业大学 | Gene for reducing cadmium content in rice grains and application thereof |
| CN116072214A (en) * | 2023-03-06 | 2023-05-05 | 之江实验室 | Phenotype intelligent prediction and training method and device based on gene significance enhancement |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105936907B (en) | 2017-12-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106544357B (en) | A method of cultivating low cadmium-accumulation rice variety | |
| CN105936907B (en) | A kind of breeding method for reducing rice grain cadmium content | |
| Zhou et al. | Multiplex QTL editing of grain-related genes improves yield in elite rice varieties | |
| CN107988229A (en) | A kind of method for obtaining the rice that tiller changes using CRISPR-Cas modification OsTAC1 genes | |
| CN105647962A (en) | Gene editing method for knocking out rice MIRNA393b stem-loop sequences with application of CRISPR(clustered regulatory interspersed short palindromic repeat)-Cas9 system | |
| CN110692507A (en) | Method for improving plant species | |
| CN107475210A (en) | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application | |
| CN104593380B (en) | For the gene ZmHKT1 for the coding corn HKT transport proteins for improving plant salt endurance;1a and its application | |
| JP2024520302A (en) | Mutation site, regulatory gene IBC, and its application in the rice ideal brittle stem mutant ibc | |
| CN104593381B (en) | A kind of corn resistant gene of salt and its application | |
| CN107058350A (en) | The rape obtained based on external rite-directed mutagenesis resists a variety of ALS inhibitor class herbicide resistance genes and application | |
| Kang et al. | A robust genome-editing method for wild plant species Nicotiana attenuata | |
| CN113046467A (en) | SNP loci significantly associated with wheat stripe rust resistance and application thereof in genetic breeding | |
| CN103834647A (en) | SSR marker Xgwm537 in close linkage with wheat dwarf gene RhtDC20 and application thereof | |
| CN108048599B (en) | Molecular marker closely linked with rape lateral root number major QTL site RtA07-2 and application | |
| CN116574731A (en) | Promoter for CRISPSR/Cas 9 gene editing of white birch and application thereof | |
| CN107686845A (en) | A kind of rice high efficient conversion carrier pCXUN Cas9 sgRNA and its construction method | |
| CN109306358A (en) | The method for formulating not packet neck two-line sterile line of rice using CRISPR/Cas9 technology | |
| BR112020023602A2 (en) | allele artificial marker | |
| CN108018286A (en) | Initiative, detection and the application of corn transformation event ZM8-143 | |
| CN111778274A (en) | Method for improving tomato storability through gene editing | |
| CN104805065B (en) | A kind of paddy rice histone deacetylase and its encoding gene and application | |
| CN118256651B (en) | Salt-tolerant molecular marker related to rice grain-type regulatory gene and application thereof | |
| US11965169B2 (en) | Transgenic safflower event stack IND-1ØØØ3-4 x IND-1ØØ15-7 and methods to use it | |
| CN107904323B (en) | Primer pair and method for identifying genotype of filial generation of tobacco low-cadmium mutant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |