CN105925520B - One plant of Efficient Conversion fumaric acid is the recombination bacillus coli and its construction method of altheine and application - Google Patents

One plant of Efficient Conversion fumaric acid is the recombination bacillus coli and its construction method of altheine and application Download PDF

Info

Publication number
CN105925520B
CN105925520B CN201610430229.8A CN201610430229A CN105925520B CN 105925520 B CN105925520 B CN 105925520B CN 201610430229 A CN201610430229 A CN 201610430229A CN 105925520 B CN105925520 B CN 105925520B
Authority
CN
China
Prior art keywords
gene
fumaric acid
bew308
seq
fum
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610430229.8A
Other languages
Chinese (zh)
Other versions
CN105925520A (en
Inventor
马江锋
周慧媛
姜岷
董维亮
章文明
陈可泉
吴昊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Tech University
Original Assignee
Nanjing Tech University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Tech University filed Critical Nanjing Tech University
Priority to CN201610430229.8A priority Critical patent/CN105925520B/en
Publication of CN105925520A publication Critical patent/CN105925520A/en
Application granted granted Critical
Publication of CN105925520B publication Critical patent/CN105925520B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • C12N9/82—Asparaginase (3.5.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/20—Aspartic acid; Asparagine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/01—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
    • C12Y305/01001—Asparaginase (3.5.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/01—Hydro-lyases (4.2.1)
    • C12Y402/01002—Fumarate hydratase (4.2.1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y403/00—Carbon-nitrogen lyases (4.3)
    • C12Y403/01—Ammonia-lyases (4.3.1)
    • C12Y403/01001—Aspartate ammonia-lyase (4.3.1.1), i.e. aspartase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses one plant can Efficient Conversion fumaric acid be altheine recombination bacillus coli, gene fumA, fumB, fumC inactivation of fumarase will be encoded in resistance to ammonium type Escherichia coli BEW308, L-Aspartic acid enzyme will be encoded again and altheine enzyme coding gene is inserted into the position of coding fumarase fumAC gene to get the recombination bacillus coli of simultaneously main product altheine is accumulated to no malic acid by-product, a small amount of L-Aspartic acid.The invention also discloses the construction method of above-mentioned bacterial strains and applications.The composing type high-activity expression of L-Aspartic acid enzyme and L-ASP can be achieved in the present invention, and finally realizes the conversion of fumaric acid to altheine.

Description

One plant of Efficient Conversion fumaric acid is the recombination bacillus coli and its structure of altheine Construction method and application
Technical field
The invention belongs to technical field of bioengineering, and in particular to one plant of conversion fumaric acid synthesis altheine production Bacterial strain and its construction method and application.
Background technique
Altheine is the hydroxyamide compounds of L-Aspartic acid, in terms of medicine, food, light industry and water environmental protection Tool has been widely used, and in pharmaceuticals industry mainly as one of 20 kinds in amino acid transfusion, and has treatment dermopathic Effect.As long as anti-alcoholism agent can also further derive and make flavouring agent in food service industry as nutritional supplement.In chemical industry Industry mainly does the stabilizer of molysite and the film of ceramic surface.In the important source material that environmental protection industry (epi) is membrane for water treatment.
The production of altheine at present is mainly raw material through being esterified ammonolysis using L-Aspartic acid, is refined, but its mistake Journey product yield is relatively low, and is related to a large amount of organic solvent, and pollution is big, and waste water is difficult.Bioanalysis, which has, reacts mild, conversion The advantages that rate is high, the three wastes are easy to handle, is the optimal production method of altheine, but L-Aspartic acid is converted into altheine It is related to the participation of coenzyme in the process, it is therefore desirable to which the supply for solving the problems, such as coenzyme, constructing the present invention is based on this has efficiently The bacterial strain of Synthesis altheine, and its zymotechnique is established, production target has significant economy.
Summary of the invention
The technical problem to be solved by the present invention is to provide one plant of recombination large intestine using fumaric acid synthesis altheine Bacillus.
The present invention also technical problems to be solved be to provide it is above-mentioned can Efficient Conversion fumaric acid synthesis altheine Recombination bacillus coli is preparing the application in altheine.
In order to solve the above technical problems, the present invention adopts the following technical scheme:
One plant of Efficient Conversion fumaric acid is-recombination bacillus coli of asparagine, by resistance to ammonium type Escherichia coli BEW308 Gene fumA, fumB, fumC inactivation of middle coding fumarase, then will coding L-Aspartic acid enzyme gene and coding L- asparagus fern acyl It is-the weight of asparagine that adnosine deaminase gene, which is inserted into the fumAC gene location of coding fumarase to get Efficient Conversion fumaric acid, Group Escherichia coli.The resistance to ammonium type Escherichia coli BEW308, the deposit number of the bacterial strain are CCTCC NO:M2013157, the bacterium The details of strain disclose in the Chinese patent application No. is 201310279778.6.
Wherein, the gene order of the coding L-Aspartic acid enzyme is as shown in SEQ ID NO:1, the coding L- asparagus fern acyl The gene order of amine enzyme is as shown in SEQ ID NO:2.
Wherein, the upstream from start codon of L-Aspartic acid enzyme gene has a segment signal peptide, the gene order of the signal peptide As shown in SEQ ID NO:3, the terminator codon of L-Aspartic acid enzyme gene is deleted, in the end of L-Aspartic acid enzyme gene There is one section of catenation sequence between L- asparagine enzyme gene, the catenation sequence is as shown in SEQ ID NO:4.
Above-mentioned Efficient Conversion fumaric acid is the preparation method of the recombination bacillus coli of asparagine, which is characterized in that packet Include following steps:
(1) pKD46 plasmid is transferred in resistance to ammonium type Escherichia coli BEW308, filters out positive transformant Escherichia coli BEW308-pKD46 induces it to express λ recombinase, then Escherichia coli BEW308-pKD46 is prepared into sense using L-arabinose By state cell；
(2) using pIJ773 plasmid as template, sequence shown in SEQ ID NO:5 and SEQ ID NO:6 is primer, and PCR expands Increasing obtains fumB gene knockout segment；
(3) fumB gene knockout segment electrotransformation that step (2) obtains to Escherichia coli BEW308-pKD46 is prepared into In competent cell, positive recombinant is screened on pacifying general resistant panel；
(4) positive recombinant that step (3) obtains is prepared into competent cell, wherein by the conversion of pCP20 plasmid, 42 DEG C FLP is induced to recombinate expression of enzymes, progress is double on the plate of apramycin resistant panel and non-resistant chooses experiment, in the flat of object resistance The bacterial strain for growing, but cannot being grown on plate on the plate for having apramycin resistance is the bacterial strain BEW308- of fumB gene inactivation △fumB；
(5) it synthesizes homologous recombination segment: increasing signal peptide sequence SEQ ID before SEQ ID NO:1 initiation codon ATG NO:3 deletes the terminator codon of L-Aspartic acid enzyme gene, and catenation sequence SEQ is added after L-Aspartic acid enzyme gene ID NO:4, the segment further include apramycin resistance gene sequence, and are added to the homology arm of fumAC at the both ends of the segment, Particular sequence is as shown in SEQ ID NO:7；
(6) the bacterial strain BEW308- △ fumB for the fumB gene inactivation that step (4) obtains is prepared into competent cell, it will PKD46 plasmid converts wherein, induces it to express λ recombinase using L-arabinose, then be prepared into competent cell；
(7) the homologous recombination segment in step (5) is converted into the competent cell containing λ recombinase of step (6), Positive recombinant is screened on pacifying general resistant panel；
(8) positive recombinant in step (7) is prepared into competent cell, wherein by the conversion of pCP20 plasmid, 42 DEG C lure FLP recombination expression of enzymes is led, progress is double on the plate of apramycin resistant panel and non-resistant chooses experiment, in the plate of non-resistant Upper growth, but the bacterial strain that cannot be grown on the plate for having apramycin resistance be can Efficient Conversion fumaric acid be asparagus fern The recombination bacillus coli BEW308 △ fumB- △ fumAC-aspC2-30-asnA of amide.
Above-mentioned conversion fumaric acid is the-application of the recombination bacillus coli of asparagine in production altheine.
Wherein, fermentation process is divided into induction period and transformation stage.
Wherein, induction period culture medium prescription are as follows: fumaric acid 20g/L, yeast powder 24g/L, peptone 10g/L, K2HPO4 36mmol/L, MgSO410mmol/L, trace elements of Ca Cl2·6H2O 0.74g/L, ZnSO4·7H2O 0.18g/L, MnSO4· H2O 20g/L, Na2- EDTA 20.1g/L, CuSO40.1g/L, CoCl2 0.104g/L,FeSO4·7H2O 2g/L 2mL/L, Solvent is water, and pH is 7.2~7.5.
Transformation stage fed-batch fermentation: it is added by several times after induction period and amounts to 40~60g/L of glucose, fumaric acid 150~200g/L.
Wherein, induction period temperature is 28~30 DEG C, and pH is 7.2~7.8, and dissolved oxygen is 5~40%；Transformation stage temperature is 30~37 DEG C, pH is 7.2~7.8, and dissolved oxygen is 5~40%.
Wherein, glucose fed mode is the liquid storage that glucose is configured to 600g/L, and according to fermented liquid integral two It is secondary to add, amount to 40~60g/L；The additional way of fumaric acid is the fumaric acid suspension for being made into 400g/L, and uses ammonium hydroxide PH is adjusted to neutrality, divides 5 fumaric acids for adding a total of about 150~200g/L.
The utility model has the advantages that
(1) the composing type high-activity expression of the present invention achievable L-Aspartic acid enzyme and L-ASP, and training of fermenting The cell obtained after supporting has low fumarase activity.
(2) by induction-conversion two stages fermentation process, mainly (substrate rubs altheine in converted product Your conversion ratio is more than 97.5%), to have a small amount of L-Aspartic acid to accumulate, no apple acid accumulation.This method can effectively improve substrate and prolong The conversion yields of fumarate reduce the production of by-product, production cost are effectively reduced.
Detailed description of the invention
Fig. 1 knocks out the linear fragment PCR figure of fumB gene, and swimming lane M is marker, and swimming lane 1 is linear fragment.
Fig. 2 bacterium colony PCR qualification figure, wherein BEW308 swimming lane is starting strain, and M Marker, 1~8 is the single bacterium of identification It falls.
Specific embodiment
According to following embodiments, the present invention may be better understood.However, as it will be easily appreciated by one skilled in the art that real It applies content described in example and is merely to illustrate the present invention, without sheet described in detail in claims should will not be limited Invention.
Embodiment 1:
This example demonstrates that knocking out fumarase in the resistance to ammonium type Escherichia coli BEW308 of parent using homologous recombination technique FumB gene, the process for the apramycin resistant strain that is eliminated.
(1) LB culture medium is utilized, Escherichia coli BEW308 to OD is cultivated under 37 DEG C, aerobic conditions600=0.4~0.6, It is prepared into electricity and turns competence；
(2) pKD46 plasmid electricity is transferred to the Escherichia coli BEW308 of competence.Electric shock condition are as follows: 200 Ω, 25 μ F, electric shock Voltage 2.3kv, shock by electricity 4~5ms of time.Thallus is added to rapidly the SOC culture medium of pre-cooling 1mL, 150r/min, 30 DEG C after electric shock The LB culture medium flat plate with ampicillin (amp), which is coated on, after culture 1h filters out positive transformant BEW308 (pKD46)；
(3) L-arabinose of 10mM is added in LB culture medium, inducing plasmid pKD46 gives expression to λ recombination at 30 DEG C Enzyme is made electricity and turns competence；
(4) apramycin resistance gene using two sides with the site FRT is template, using high-fidelity PCR amplification system, with Plasmid pIJ773 is template, and designs the amplimer that both ends have fumB homologous fragment, amplifies linear DNA homologous fragment, Primer sequence is as follows:
Upstream belt homology arm primer H1-P1 (SEQ ID NO:5):
5’-CGGCACGCCATTTTCGAATAACAAATACAGAGTTACAGGCTGGAAGCTATTCCGGGGATCCGTCG ACC-3’
Downstream belt homology arm primer H2-P2 (SEQ ID NO:6):
5’-TTACTTAGTGCAGTTCGCGCACTGTTTGTTGACGATTTGCTGGAAGAATGTAGGCTGGAGCTGCT TC-3’
Reaction system: each 0.5 μ l of upstream and downstream primer (100pmol/ μ l) with homology arm；Template DNA (100ng/ μ l) 0.5 μl；10×buffer 5μl；Each 1 μ l of dNTPs (10mM)；(100%) 2.5 μ l of DMSO；Pyrobest archaeal dna polymerase (2.5U/ μ l)1μl；ddH2O 36/35.5μl；50 μ l of total volume.
Reaction condition: 94 DEG C, 2min；(94 DEG C, 45sec；50 DEG C, 45sec；72 DEG C, 90sec；10 circulations)；(94 DEG C, 45sec；55 DEG C, 45sec；72 DEG C, 90sec；15 circulations)；72 DEG C, 5min.
The identification of linear DNA fragment such as Fig. 1.
(5) electricity turns BEW308 (pKD46) competence of linear DNA fragment to inducing expression λ recombinase, and is coated on band The LB flat screen of apramycin selects positive recombinant, and has carried out PCR identification, and electrophoretogram is as shown in Figure 2.
(6) positive recombinant pours into the plasmid pCP20 that can induce expression FLP recombinase after being prepared into competence, in 42 DEG C Apramycin resistance can be eliminated after heat shock expression FLP recombinase.Using a pair of plates, parallel point sample is carried out, it can be in nonreactive The bacterium for growing, but cannot being grown on mild-natured plate in resistant panel has as knocked out the bacterial strain of resistance, is named as BEW308 (△ fumB)。
Embodiment 2: the present embodiment has investigated the L-Aspartic acid enzyme gene of mutation Escherichia coli K12 (aspC) to the influence of the enzymatic activity after.Specific operation process are as follows: based on original aspC, by 236 and 249 amino acids It is mutated (Lys236Asn, Gly249Thr), which is synthesized by artificial synthesized mode, is named as aspC2.It will mutation Gene be connected to pTrc99a expression plasmid and import BEW308 (△ fumB), building obtain BEW308 (△ fumB, aspC2), Think that the recombinant bacterium BEW308 (△ fumB, aspC) of mutation is compared, as a result such as table 1:
Zymologic property situation of change before and after 1 aspartic acid enzyme mutant of table
Enzyme Specific enzyme activity Optimal reactive temperature Optimal reaction pH
ASPC 38090 37℃ 8.2
ASPC2 45500 37℃ 7.8
Embodiment 3:
This example demonstrates that further knocking out fumaric acid in Escherichia coli BEW308 (△ fumB) using homologous recombination technique Enzyme fumAC gene, and introduce the high activity L-Aspartic acid enzyme and altheine enzyme gene of mutation.
Entire experimental implementation process and embodiment 1 are consistent, and only homologous sequence is different.
(1) the present embodiment is sequence of setting out with the L-Aspartic acid enzyme gene (aspC) of Escherichia coli K12, 236 and 249 amino acids carry out mutation and obtain aspC2, i.e. Lys236Asn, Gly249Thr simultaneously, while in atg start codon The upstream ATP increases a segment signal peptide sequence: atgttgaatccgaaggttgcctacatggtctggatgacgtgcctgggt Ttaacgttgcccagccaggca (shown in SEQ ID NO:3), downstream deletes terminator codon；The coding L- asparagus fern acyl Amine enzyme gene (asnA) has the catenation sequence of one section of 30bp between initiation codon and L-Aspartic acid enzyme gene terminal gene To ensure two enzymes while have high activity, which is CAATCTGGACCGTGGCATCCTGGAAGCATT (SEQ ID Shown in NO:4).
Finally increase the homology arm and apramycin resistance gene sequence of fumAC at both ends, whole section of gene is closed using artificial At mode synthesize, specific nucleotide sequence is as shown in SEQ ID NO:5.
(2) electricity turns the BEW308 (△ fumB, pKD46) of artificial synthesized linear DNA fragment to inducing expression λ recombinase Competence, and be coated on the LB flat screen with apramycin and select positive recombinant, and carried out PCR identification, positive recombinant The plasmid pCP20 that can induce expression FLP recombinase is poured into after being prepared into competence, after FLP recombinase is expressed in 42 DEG C of heat shocks i.e. Apramycin resistance can be eliminated.Using a pair of plates, parallel point sample is carried out, can be grown on non-resistant plate, but cannot be The bacterium grown in resistant panel has as knocked out the bacterial strain of resistance, is named as BEW308 (△ fumB- △ fumAC-aspC2- 30-asnA)
Embodiment 4:
Starting strain Escherichia coli BEW308 and recombinant bacterium Escherichia have been investigated in the present embodiment comparison Coli BEW308 (the △ fumB- △ fumAC-aspC2-30-asnA) fumaric acid after Fiber differentiation 5h in the fermentation medium The active correlation data of enzyme, Aspartase, L-ASP.
And the number of passes excessively of BEW308 (△ fumB- △ fumAC-aspC2-30-asnA) two-step method synthesis altheine According to.
Specific steps and result are as follows:
(1) use LB culture medium, by 1~2% (v/v) inoculum concentration from cryopreservation tube access triangular flask in, it is aerobic cultivate 10~ 12h is further seeded to shaking flask or seed fermentation tank (culture medium is also LB), seed culture by 1~2% (v/v) inoculum concentration Process temperature control is not required to adjust pH at 30 DEG C, in culture, and dissolved oxygen control is after 5~40%, 4~6h of culture to thallus OD600Extremely Between 2.5~4, by 5~10% inoculation fermentation culture mediums, the control of fermentation process temperature is at 30 DEG C, incubation pH ammonium hydroxide control For system 7.2~7.8, dissolved oxygen control cultivates 5h 5~40%.
(2) addition 30g/L glucose and 150g/L fumaric acid (are mended in three times after being adjusted to neutrality with ammonium hydroxide after induction Add), temperature is improved to 37 DEG C and enters the transformation stage, collects conversion 12h, 16h, 20h and bacterium solution product analysis for 24 hours.Experiment knot Fruit is shown in Table 2.
2 Escherichia coli BEW308 of table (△ fumB- △ fumAC-aspC2-30-asnA) fermentation liquid process

Claims (7)

1. the recombination bacillus coli that one plant of Efficient Conversion fumaric acid is asparagine, which is characterized in that by the large intestine of resistance to ammonium type bar Fumarase is encoded in bacterium BEW308fumA、fumB、fumC gene inactivation, then the gene and volume that L-Aspartic acid enzyme will be encoded The gene of code L- asparagine enzyme is inserted into coding fumarasefumAC gene location to get Efficient Conversion fumaric acid be- The recombination bacillus coli of asparagine；
The gene order of the coding L-Aspartic acid enzyme is as shown in SEQ ID NO:1, the base of the coding L-ASP Because sequence is as shown in SEQ ID NO:2；
The upstream from start codon of the gene of the coding L-Aspartic acid enzyme has a segment signal peptide, the gene order of the signal peptide As shown in SEQ ID NO:3, the terminator codon of L-Aspartic acid enzyme gene is deleted, in the end of L-Aspartic acid enzyme gene There is one section of catenation sequence between L- asparagine enzyme gene, the catenation sequence is as shown in SEQ ID NO:4.
2. Efficient Conversion fumaric acid described in claim 1 is the preparation method of the recombination bacillus coli of asparagine, special Sign is, includes the following steps:
(1) pKD46 plasmid is transferred in resistance to ammonium type Escherichia coli BEW308, filters out positive transformant Escherichia coli BEW308 - pKD46 induces its to express λ recombinase using L-arabinose, then that Escherichia coli BEW308-pKD46 is prepared into competence is thin Born of the same parents；
(2) using pIJ773 plasmid as template, sequence shown in SEQ ID NO:5 and SEQ ID NO:6 is primer, and PCR amplification obtains It arrivesfum1 B gene knocks out segment；
(3) step (2) is obtainedfum1 B gene knocks out segment electrotransformation and is prepared into impression to Escherichia coli BEW308-pKD46 In state cell, positive recombinant is screened in apramycin resistant panel；
(4) positive recombinant that step (3) obtains is prepared into competent cell, wherein by the conversion of pCP20 plasmid, 42 DEG C lure FLP recombination expression of enzymes is led, progress is double on the plate of apramycin resistant panel and non-resistant chooses experiment, in the plate of non-resistant Upper growth, but the bacterial strain that cannot be grown on the plate for having apramycin resistance isfumThe bacterial strain BEW308- △ of 1 B gene inactivationfumB；
(5) it synthesizes homologous recombination segment: increasing signal peptide sequence SEQ ID NO before SEQ ID NO:1 initiation codon ATG: 3, the terminator codon of L-Aspartic acid enzyme gene is deleted, and catenation sequence SEQ ID is added after L-Aspartic acid enzyme gene NO:4, the segment further include apramycin resistance gene sequence, and are added at the both ends of the segmentfumThe homology arm of AC, institute Homologous recombination fragment sequence is stated as shown in SEQ ID NO:7；
(6) step (4) is obtainedfumThe bacterial strain BEW308- △ of 1 B gene inactivationfumB is prepared into competent cell, will PKD46 plasmid converts wherein, induces it to express λ recombinase using L-arabinose, then be prepared into competent cell；
(7) the homologous recombination segment in step (5) is converted into the competent cell containing λ recombinase of step (6), Positive recombinant is screened in apramycin resistant panel；
(8) positive recombinant in step (7) is prepared into competent cell, wherein by the conversion of pCP20 plasmid, 42 DEG C of inductions FLP recombinates expression of enzymes, and progress is double on the plate of apramycin resistant panel and non-resistant chooses experiment, on the plate of non-resistant Growth, but the bacterial strain that cannot be grown on the plate for having apramycin resistance be can Efficient Conversion fumaric acid be asparagus fern acyl The recombination bacillus coli BEW308 △ of aminefumB-△fumAC-aspC2-30-asnA。
3. conversion fumaric acid described in claim 1 is the recombination bacillus coli of asparagine in preparing altheine Using.
4. application according to claim 3, which is characterized in that its fermentation process is divided into induction period and transformation stage.
5. application according to claim 4, which is characterized in that induction period culture medium prescription are as follows: 20 g/L of fumaric acid, Yeast powder 24g/L, peptone 10g/L, K2HPO436mmol/L, MgSO410 mmol/L, 2 mL/L of microelement, solvent are Water, pH are 7.2~7.5；
The composition of the microelement are as follows: CaCl2·6H2O 0.74 g/L、ZnSO4·7H2O 0.18 g/L、MnSO4·H2O 20 g/L、Na2-EDTA 20.1 g/L、CuSO4 0.1 g/L、CoCl2 0.104 g/L、FeSO4·7H2O 2 g/L；
Transformation stage fed-batch fermentation: adding by several times after induction period and amount to 40 ~ 60 g/L of glucose, and fumaric acid 150 ~ 200 g/L。
6. application according to claim 4, which is characterized in that induction period temperature is 28 ~ 30 DEG C, and pH is 7.2 ~ 7.8, molten Oxygen is 5~40%；Transformation stage temperature is 30~37 DEG C, and pH is 7.2 ~ 7.8, and dissolved oxygen is 5~40%.
7. application according to claim 5, which is characterized in that glucose fed mode is that glucose is configured to 600g/L Liquid storage, and added in two times according to fermentating liquid volume, amount to 40 ~ 60g/L；The additional way of fumaric acid is to be made into 400g/L Fumaric acid suspension, and adjust pH to neutrality with ammonium hydroxide, add the fumaric acids of 150 ~ 200 g/L of total points for 5 times.
CN201610430229.8A 2016-06-16 2016-06-16 One plant of Efficient Conversion fumaric acid is the recombination bacillus coli and its construction method of altheine and application Active CN105925520B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610430229.8A CN105925520B (en) 2016-06-16 2016-06-16 One plant of Efficient Conversion fumaric acid is the recombination bacillus coli and its construction method of altheine and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610430229.8A CN105925520B (en) 2016-06-16 2016-06-16 One plant of Efficient Conversion fumaric acid is the recombination bacillus coli and its construction method of altheine and application

Publications (2)

Publication Number Publication Date
CN105925520A CN105925520A (en) 2016-09-07
CN105925520B true CN105925520B (en) 2019-08-23

Family

ID=56831355

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610430229.8A Active CN105925520B (en) 2016-06-16 2016-06-16 One plant of Efficient Conversion fumaric acid is the recombination bacillus coli and its construction method of altheine and application

Country Status (1)

Country Link
CN (1) CN105925520B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110003039A (en) * 2019-03-28 2019-07-12 新泰市佳禾生物科技有限公司 The isolation and purification method of altheine in a kind of conversion fluid
CN110218691A (en) * 2019-05-21 2019-09-10 南京工业大学 One plant of genetic engineering bacterium for synthesizing altheine and its construction method and application
CN111088193B (en) * 2020-01-10 2022-09-09 南京工业大学 Method for improving electrotransformation frequency of methylotrophic butyric acid bacillus

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105154379A (en) * 2015-07-27 2015-12-16 中国食品发酵工业研究院 Engineering bacterium capable of efficiently converting fumaric acid to produce L-asparaginate, and application of engineering bacterium
CN105316273A (en) * 2015-11-24 2016-02-10 南京工业大学 L-aspartase recombinant escherichia coli free of malic acid byproducts and construction method and application of L-aspartase recombinant escherichia coli

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105154379A (en) * 2015-07-27 2015-12-16 中国食品发酵工业研究院 Engineering bacterium capable of efficiently converting fumaric acid to produce L-asparaginate, and application of engineering bacterium
CN105316273A (en) * 2015-11-24 2016-02-10 南京工业大学 L-aspartase recombinant escherichia coli free of malic acid byproducts and construction method and application of L-aspartase recombinant escherichia coli

Also Published As

Publication number Publication date
CN105925520A (en) 2016-09-07

Similar Documents

Publication Publication Date Title
CN105296411B (en) One plant utilizes the genetic engineering bacterium and its construction method of monosaccharide fermentation production L-Aspartic acid and application
CN107022515B (en) Genetically engineered bacterium for producing L-aspartic acid by utilizing anaerobic fermentation of lignocellulose hydrolysate and construction method and application thereof
CN106434510B (en) One plant of fermentation produces the genetic engineering bacterium of L-Aspartic acid
CN108060114B (en) A kind of Escherichia coli of fermenting and producing l-Alanine and its application
CN107815446B (en) A kind of fermentation process in high density of recombination nitrile hydratase Recombinant organism
CN110468092A (en) The genetic engineering bacterium and its construction method of one plant height production Valine and application
US10221407B2 (en) Stabilized recombinant expression plasmid vector in hafnia alvei and applications thereof
CN101663389A (en) An amidase gene knock-out engineered strain for nitrile hydratase production, its construction and application
CN105925520B (en) One plant of Efficient Conversion fumaric acid is the recombination bacillus coli and its construction method of altheine and application
CN105316273B (en) One plant without the L-Aspartic acid enzyme recombination bacillus coli and its construction method of malic acid by-product and application
CN110982772A (en) Corynebacterium with high yield of valine as well as construction method and application thereof
CN110184230A (en) The genetic engineering bacterium and its construction method of one plant height production L-Histidine and application
CN107119002A (en) A kind of recombinant bacterium for synthesizing 3 hydracrylic acids and its construction method and application
CN107641622A (en) Hydrolyzable para-Phthalonitrile prepares the nitrilase of paracyanobenzoic acid
CN107916283B (en) A kind of production technology of niacinamide
CN107287144B (en) Metabolically-modified bacillus subtilis biotransformation cell and preparation method and application thereof
CN105907692A (en) High-yield recombinant corynebacterium glutamicum for L-lysine and method for constructing high-yield recombinant corynebacterium glutamicum
CN112391329B (en) Escherichia coli engineering bacteria with improved acid stress resistance and application thereof
RU2546239C1 (en) RECOMBINANT STRAIN Escherichia coli, HAVING CONSTITUTIVE ASPARTASE ACTIVITY AND METHOD OF SYNTHESIS OF L-ASPARTIC ACID USING THIS STRAIN AS BIOCATALYST
CN109053867A (en) A kind of cultural method of high density fermentation expression recombinant rotavirus Δ VP8* antigen
CN110218691A (en) One plant of genetic engineering bacterium for synthesizing altheine and its construction method and application
CN106834128A (en) One plant of genetic engineering bacterium and its construction method and application that beta Alanine is produced using glucose fermentation
CN114854659A (en) Ergothioneine production process and application thereof
CN114606172B (en) Bacillus amyloliquefaciens engineering bacteria for improving heme yield and construction method thereof
CN108359629A (en) Hydrogenlike silicon ion recombinant bacterium and its construction method and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information

Inventor after: Ma Jiangfeng

Inventor after: Zhou Huiyuan

Inventor after: Jiang Min

Inventor after: Dong Weiliang

Inventor after: Zhang Wenming

Inventor after: Chen Kequan

Inventor after: Wu Hao

Inventor before: Ma Jiangfeng

Inventor before: Jiang Min

Inventor before: Dong Weiliang

Inventor before: Zhang Wenming

Inventor before: Chen Kequan

Inventor before: Wu Hao

COR Change of bibliographic data
GR01 Patent grant
GR01 Patent grant