CN105886662B - Method for rapidly breeding ST sensitive cell line of hog cholera lapinized virus strain (C strain) and special primer - Google Patents
Method for rapidly breeding ST sensitive cell line of hog cholera lapinized virus strain (C strain) and special primer Download PDFInfo
- Publication number
- CN105886662B CN105886662B CN201610053986.8A CN201610053986A CN105886662B CN 105886662 B CN105886662 B CN 105886662B CN 201610053986 A CN201610053986 A CN 201610053986A CN 105886662 B CN105886662 B CN 105886662B
- Authority
- CN
- China
- Prior art keywords
- strain
- virus
- pcr
- hog cholera
- lapinized
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for rapidly breeding a sensitive cell line of swine fever lapinized low virulent strain (C strain) ST (pig testis) by using a reverse transcription PCR (RT-PCR) technology and a real-time fluorescent quantitative RT-PCR technology. Comprising 1) obtaining ST monoclonal cells; 2) inoculating a hog cholera lapinized virus strain (strain C); 3) extracting RNA of each batch of continuously-harvested hog cholera lapinized virus liquid (virus liquid), and determining that the ST monoclonal cell line can continuously infect the hog cholera lapinized virus (C strain) by using an RT-PCR (reverse transcription-polymerase chain reaction) technology; 4) the copy number is determined to be 10 by using a real-time fluorescent quantitative RT-PCR technology6More than copy (copies)/mL is ST sensitive cell line of hog cholera lapinized virus strain (C strain). The invention can rapidly provide a sensitive cell line for the production of the swine fever attenuated vaccine, shorten the production period of the vaccine and reduce the cost of the vaccine.
Description
Technical Field
The invention belongs to the technical field of biological engineering, and particularly relates to a method for rapidly breeding a swine fever lapinized low virulent strain (C strain) ST sensitive cell line by using an RT-PCR (reverse transcription-polymerase chain reaction) technology and a real-time fluorescent quantitative RT-PCR technology.
Background
Hog cholera is an acute, febrile, highly infectious and lethal virulent infectious disease caused by Classical Swine Fever Virus (CSFV), commonly called as hog cholera, and also called as hog cholera in the early years. The disease is the infectious disease of pigs with the most occurrence, the greatest harm and the most popular. In recent years, the number of pigs died due to diseases accounts for 8% -10% of the total number of pigs fed, and one third of the pigs are caused by swine fever. The world animal health Organization (OIE) classifies the swine fever as one of 16 legal infectious diseases in A class, and China also determines the swine fever as a class of virulent infectious diseases, belonging to one of animal epidemic diseases which are seriously harmful and need to be urgently and strictly enforced to prevent, control and extinguish.
Hog cholera is widespread throughout the world and highly contagious. At present, vaccination is an important means for preventing and controlling swine fever, and many countries and regions have successively announced that swine fever is eliminated. The Chinese hog cholera lapinized attenuated vaccine is internationally recognized as the safest and most effective attenuated vaccine due to the characteristics of quick induction immune response, no residual toxicity to boars and porkets, capability of resisting the attack of hog cholera virulent strains and the like.
The swine fever vaccines currently used for immunization are mainly four: spleen stranguria seedling, milk rabbit seedling, cell seedling and combined seedling. The swine fever strains of the four vaccines are all Chinese swine fever lapinized attenuated strains (C strains for short). The hog cholera spleen stranguria vaccine and the milk rabbit vaccine are rabbit-derived tissue vaccines and are prepared by utilizing living tissues of adult rabbits and milk rabbits. Because the hog cholera spleen stranguria vaccine and the milk rabbit vaccine are prepared by using immune organs of animals, although the immune effect is better, the cost is high, the pollution is easy, the yield is low, the difference between batches is large, and the stress reaction after immune injection is large. The swine fever cell vaccine has the characteristics of low production cost, suitability for batch production, small batch-to-batch difference, low side reaction and the like, and is increasingly emphasized. However, in the production process of the swine fever cell vaccine, the cell virus production effect is poor, and the virus titer is low, so that the immune effect of the vaccine finished product is inferior to that of the swine fever spleen and lymph node vaccine. Therefore, the screening of the cell line sensitive to the lapinized hog cholera virus strains to improve the virus titer has practical significance on the production of hog cholera cell seedlings and can bring economic benefits.
Disclosure of Invention
The invention aims to provide a method for rapidly breeding a sensitive cell line of a hog cholera lapinized low virulent strain (C strain) ST (pig testicular cells) by using an RT-PCR (reverse transcription-polymerase chain reaction) technology and a real-time fluorescent quantitative RT-PCR technology, so as to overcome the defect of non-ideal immune effect in the production of the conventional hog cholera cell vaccine.
The method for rapidly breeding the ST sensitive cell line of the hog cholera lapinized low virulent strain (C strain) mainly comprises the following steps:
1) obtaining ST monoclonal cells;
2) inoculating a hog cholera lapinized virus strain (strain C);
3) extracting RNA of each batch of continuously-harvested hog cholera lapinized virus liquid (virus liquid), performing primary identification by using an RT-PCR (reverse transcription-polymerase chain reaction) technology, and determining that an ST monoclonal cell line can continuously infect the hog cholera lapinized virus (C strain);
4) quantitatively detecting the hog cholera lapinized virus solution by using a real-time fluorescent quantitative RT-PCR technology to determine the copy number of the hog cholera lapinized virus strain (C strain), wherein the hog cholera lapinized virus strain (C strain) can continuously infect cells, and the copy number of the virus solution harvested in a third batch and a later batch can be maintained at 106Copy (copies)/mL is ST sensitive cell line of hog cholera lapinized virus (strain C).
In the above method, the step 1) ST monoclonal cells are obtained by: ST cells without exogenous viral contamination were incubated at 37 ℃ with 5% CO2Culturing for 48h in an incubator, digesting into single scattered cells by 0.2% (mass/volume, W/V, unit g/100mL) of trypsin, counting the cells, diluting to a cell concentration of 10-100cells/mL by using DMEM medium containing 15% (volume/volume, V/V, unit mL/100mL) of serum, adding the cells to a 96-well plate by using a pipette, carrying out observation on the cells by 100 mu L per well, recording and marking the wells containing only one cell, observing every day, and carrying out gradual expansion culture after the number of the cells is increased to obtain ST monoclonal cells.
The method for inoculating the hog cholera lapinized virus strain (C strain) in the step 2) comprises the following steps: inoculating the hog cholera lapinized virus strain (C strain) to ST monoclonal cells, and culturing at 37 deg.C and 5% CO2Culturing in an incubator, harvesting virus liquid every 48h, continuously harvesting 8 batches of virus liquid, and placing each batch of virus liquid at-80 ℃ for short-term storage to be detected.
The RT-PCR identification method in the step 3) can comprise the following steps:
3.1) extracting the total RNA of the hog cholera lapinized virus liquid (virus liquid);
3.2) reverse transcription is carried out by taking the total RNA of the virus liquid as a template to synthesize cDNA of the virus liquid;
3.3) RT-PCR detection: and (3) carrying out PCR amplification under the guidance of an RT-PCR specific primer by taking the cDNA as a template, carrying out 1% agarose gel electrophoresis on a PCR amplification product after the reaction is finished, and if a target fragment with the length of 383bp can be amplified, determining that the detection result is positive, otherwise, determining that the detection result is negative.
In the step 3.2), the extracted RNA is subjected to two-step reverse transcription by using a reverse transcription kit, wherein the first-step reaction system is as follows: oligo dT Primer (50uM) 1. mu.L, dNTP mix (10mM each) 1. mu.L, Template RNA 2. mu.L, RNase free ddH2O6. mu.L, and the reaction conditions are as follows: cooling rapidly at 65 deg.C for 5 min; the second step reaction system is: 10 μ L of template RNA and Primer mix (product of first step), 4 μ L of 5. mu.l of PrimeScript II Buffer, 0.5 μ L of Rnaseinhibitor (40U/. mu.L), 1 μ L of PrimeScript II RTase (200U/. mu.L), RNase free H204.5. mu.L, reaction conditions are as follows: mixing, cooling at 42 deg.C for 30-60min and 95 deg.C for 5min on ice.
The specific primer for RT-PCR identification in the step 3.3) is a primer which is formed by carrying out reverse transcription on a sequence of 54-436bp (SEQ ID NO: 1) the target fragment is 383bp long and is designed for the target to detect whether the ST monoclonal cell can be continuously infected with the hog cholera lapinized virus strain (C strain).
The upstream primer for RT-PCR identification in the step 3.3) has the sequence shown in SEQ ID NO: 2, and the downstream primer has a nucleotide sequence shown in SEQ ID NO: 3.
The RT-PCR reaction system in the step 3.3) is as follows: mu.L of template cDNA, 2 XTaq PCR MasterMIX12.5. mu.L, 1. mu.L of upstream primer (10. mu.M/. mu.L), 1. mu.L of downstream primer (10. mu.M/. mu.L), and RNase free H2O to 25 μ L; the reaction conditions of the RT-PCR are as follows: pre-denaturation at 94 ℃ for 5 min; then denaturation at 94 ℃ for 30s, annealing at 56-64 ℃ for 20s, and extension at 72 ℃ for 30s for 35 cycles; most preferablyAnd then extended for 10min at 72 ℃.
The real-time fluorescent quantitative RT-PCR detection method in the step 4) can comprise the following steps:
4.1) establishing a standard curve: hog cholera virus (strain C) was used as a standard and diluted to 1X 108、1×107、1×106、1×105、1×104、1×103、1×102、1×101Taking standard substances with different concentrations as templates, carrying out real-time fluorescence quantitative PCR detection under the guide of primers and TaqMan probes, and after the detection is finished, drawing a corresponding Ct value (Y axis) by using a concentration Log value (X axis) of each standard substance to draw a standard curve;
4.2) extracting the genome RNA of the classical swine fever lapinized virus liquid (virus liquid), and carrying out real-time fluorescent quantitative RT-PCR detection on the classical swine fever virus (C strain) under the guide of a primer and a TaqMan probe by taking the extracted genome RNA as a template;
4.3) qualitatively and quantitatively detecting the classical swine fever virus (C strain) in the sample to be detected according to the change and the intensity of the fluorescence signal, wherein the existence of the fluorescence amplification curve indicates that the sample contains the classical swine fever virus, the non-existence of the fluorescence amplification curve indicates that the sample does not contain the classical swine fever virus, and then the copy number of the classical swine fever virus contained in the sample to be detected is obtained according to the intensity of the fluorescence signal of the sample and the standard curve in the step 1).
The primers and TaqMan probes for real-time fluorescent quantitative PCR detection in the steps 4.1) and 4.2) are designed by taking the 151 th and 243bp from the 5' end in a specific conserved region of the whole genome of the hog cholera lapinized virus strain (C strain) as an object, and the target fragment is 93bp (SEQ ID NO: 4) to determine the copy number of the virus (93bp of the target fragment amplified by real-time fluorescent quantitative PCR is part of the amplified product of RT-PCR in step 3.3).
The nucleotide sequence of the upstream primer for real-time fluorescent quantitative RT-PCR detection in the steps 4.1) and 4.2) is shown as SED ID NO: 4, the nucleotide sequence of the downstream primer is shown as SEQ ID NO: 5, respectively.
The TaqMan probe used for real-time fluorescent quantitative RT-PCR detection in the steps 4.1) and 4.2) has a nucleotide sequence shown as SEQ ID NO: 6 is shown in the specification; the probe is subjected to fluorescence labeling, a report fluorescent group is labeled at the 5 'end of the probe, and a quenching fluorescent group is labeled at the 3' end of the probe; the reporter fluorophore is FAM, and the fluorescence quenching group is TAMRA; to prevent extension during PCR amplification, the 3' end of the probe has been phosphorylated.
The reaction system of the real-time fluorescent quantitative RT-PCR in the steps 4.1) and 4.2) is as follows: template RNA 2. mu.L, 2 XTT-PCR buffer 12.5. mu.L, upstream primer (20. mu.M/. mu.L) 0.5. mu.L (10ng), downstream primer (20. mu.M/. mu.L) 0.5. mu.L (10ng), Mix enzyme 0.5. mu.L, HS enzyme 0.5. mu.L, TaqMan probe (20. mu.M/. mu.L) 0.5. mu.L (10ng), RNase free H2O to 25 μ L; the reaction conditions of the real-time fluorescent quantitative PCR are as follows: firstly, the temperature is 52 ℃ for 15min, and the temperature is 95 ℃ for 5 s; then, 45 cycles of 94 ℃ for 5s and 58 ℃ for 40s were carried out.
The invention also aims to provide a special primer in the method for rapidly breeding the ST sensitive cell line of the hog cholera lapinized virus strain (C strain), which comprises the following steps:
the upstream primer preliminarily identified by the T-PCR technology in the step 3) has the sequence shown in SEQ ID NO: 2; a downstream primer having the sequence shown in SEQ ID NO: 3; or
The nucleotide sequence of the upstream primer quantitatively detected by the real-time fluorescent quantitative RT-PCR technology in the step 4) is shown as SED ID NO: 5 is shown in the specification; the nucleotide sequence of the downstream primer is shown as SEQ ID NO: 6 is shown in the specification; the nucleotide sequence of the TaqMan probe is shown as SEQ ID NO: shown at 7.
The invention provides a method for rapidly breeding a sensitive cell line of hog cholera lapinized low virulent strain (C strain) ST (pig testicular cells) by using an RT-PCR technology and a real-time fluorescent quantitative RT-PCR technology. The invention can rapidly provide a sensitive cell line for the production of the hog cholera attenuated vaccine, shortens the production period of the vaccine, reduces the cost of the vaccine, and solves the problem that the conventional hog cholera cell vaccine has an unsatisfactory vaccine immune effect due to low titer of the hog cholera virus.
Compared with the prior art, the invention has the following beneficial effects:
1. the ST sensitive cell line screened by the invention can continuously infect the hog cholera lapinized low virulent strain (C strain), can continuously and repeatedly harvest the hog cholera lapinized low virulent solution, and can be directly used in the production process;
2. the method for screening the ST sensitive cell line established by the invention is characterized in that after the cell is subjected to monoclonal, the cell is preliminarily identified by using an RT-PCR technology to determine that the ST monoclonal cell line can continuously infect the hog cholera lapinized virus (C strain), and then the hog cholera lapinized virus solution is quantitatively detected by using a real-time fluorescent quantitative PCR technology, so that the hog cholera ST sensitive cell line can be bred more quickly than a conventional immunofluorescence method;
3. the ST sensitive cell line screened by the invention is a strain (hog cholera lapinized low virulent strain (C strain)) used for the hog cholera vaccine, and can be directly applied to the production of the hog cholera vaccine;
4. the ST cell line screened by the invention is sensitive to the classical swine fever virus, can continuously infect the classical swine fever virus with high titer, is beneficial to overcoming the problem of low titer of the conventional classical swine fever virus cell culture, can shorten the production period of the vaccine and reduce the cost of the vaccine, and has practical significance for the production of the classical swine fever vaccine.
The present invention will be described in further detail with reference to specific examples.
Drawings
FIG. 1 shows the growth state of single ST cells of strain C4 in a 96-well plate
FIG. 2 shows the growth state of E11 single ST cells in a 96-well plate
FIG. 3 is a real-time fluorescent quantitative RT-PCR amplification curve of the standard
FIG. 4 is a standard curve of real-time fluorescent quantitative RT-PCR
FIG. 5 shows the results of real-time quantitative fluorescence detection of the copy numbers of D3, C4, C8, D5, E10, E11, F9 and H9 hog cholera lapinized virus (C)
Detailed Description
The methods used in the following examples are conventional unless otherwise specified, and specific procedures can be found in: molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold spring harbor).
The percentage concentration is a mass/mass (W/W, unit g/100g) percentage concentration, a mass/volume (W/V, unit g/100mL) percentage concentration, or a volume/volume (V/V, unit mL/100mL) percentage concentration, unless otherwise specified.
The various biological materials described in the examples are obtained by way of experimental acquisition for the purposes of this disclosure and should not be construed as limiting the source of the biological material of the invention. In fact, the sources of the biological materials used are wide and any biological material that can be obtained without violating the law and ethics can be used instead as suggested in the examples.
The primers and TaqMan probes used were synthesized by Takara Bio Inc. (Dalian Co., Ltd.).
The embodiments are provided in order to provide detailed embodiments and specific procedures, which will help understanding of the present invention, but the scope of the present invention is not limited to the following embodiments.
Example, Rapid selection of ST sensitive cell line of hog cholera lapinized virus strain (C strain)
The invention relates to a method for rapidly breeding a sensitive cell line of swine fever lapinized low virulent strain (C strain) ST (pig testicular cells) by using an RT-PCR technology and a real-time fluorescent quantitative RT-PCR technology, which comprises the following steps:
1) obtaining ST monoclonal cells
ST cells (purchased from American Type Culture Collection (ATCC)) free of exogenous viral contamination were cultured at 37 ℃ with 5% CO2Culturing for 48H in an incubator, digesting into single scattered cells by 0.2% (mass/volume, W/V, unit g/100mL) of trypsin, counting the cells, diluting with DMEM medium containing 15% (volume/volume, V/V, unit mL/100mL) of serum to a cell concentration of 10-100cells (cells)/mL (generally, the pancreatin digestive juice and serum are added in the ratio only need to be marked), adding the diluted cells to a 96-well plate by a pipette, each well is 100 uL, observing under a microscope, recording and marking wells containing only one cell, respectively marked as D3 strain, C4 strain, C8 strain, D5 strain, E10 strain, E11 strain, F9 strain and H9 strain, observing every day,the growth states of individual ST cells of the C4 strain and E11 strain are shown in FIGS. 1 and 2. Gradually expanding and culturing after the number of the cells is increased, firstly expanding and culturing to a 24-pore plate, then expanding and culturing to a 6-pore plate, and finally inoculating the cloned ST cells to 25cm2In the cell culture flask, the serum addition amount in the DMEM medium was changed to 10% (volume/volume, V/V, unit mL/100mL), and the cells were cultured conventionally to obtain ST monoclonal cells.
2) Inoculation of hog cholera lapinized virus strain (C strain)
The single clone cells of ST strains D3, C4, C8, D5, E10, E11, F9 and H9 were expanded and cultured to 75cm2In each cell culture flask, hog cholera lapinized virus strain (C strain, purchased from Chinese veterinary medicine inspection institute) was inoculated at 1% (V/V, unit mL/100mL) virus content, and the virus concentration was controlled at 37 deg.C and 5% CO2Culturing in incubator, harvesting virus solution every 48h, and continuously harvesting 8 batches (CSFV does not cause cytopathic effect, and continuous harvesting of virus solution can be realized, one batch for each harvest).
3) Extracting RNA of continuously harvested 8 batches of virus liquid, carrying out primary identification by using an RT-PCR technology, and determining that an ST monoclonal cell line can continuously infect hog cholera lapinized virus (C strain), wherein the specific method comprises the following steps:
3.1) extraction of Total RNA from the Virus solution
The virus liquid harvested from each batch is sampled, and total RNA is extracted by using a TaKaRaRNAioso Reagent kit of TAKARA company, and the specific steps are as follows:
3.1.1 pipette up 200. mu.L of virus solution, add 1mL of RNAioso Reagent, and mix well.
3.1.2 to the homogenate lysate of step 3.1.1 above, chloroform (1/5 volumes from RNAlso Reagent) was added, the centrifuge tube cap was closed and shaken vigorously (chloroform is low boiling and volatile, and the centrifuge tube cap should be flicked carefully during shaking). After the emulsion solution is milky (no phase separation), the mixture is allowed to stand at room temperature for 5 minutes.
3.1.312,000g, centrifuge at 4 ℃ for 15 minutes.
3.1.4 carefully remove the tube from the centrifuge and aspirate the supernatant into another new tube.
3.1.5 adding isopropanol into the supernatant, turning the centrifuge tube upside down, mixing, and standing at 15-30 deg.C for 10 min.
3.1.612,000g, centrifuge at 4 ℃ for 10 minutes. Typically, after centrifugation, a pellet appears at the bottom of the tube.
3.1.7 washing of RNA pellet supernatant was carefully discarded, 75% ethanol lmL was slowly added along the walls of the centrifuge tube (without touching the pellet), the walls of the centrifuge tube were washed gently upside down, centrifuged at 12,000g at 4 ℃ for 5 minutes and ethanol was carefully discarded.
3.1.8 dissolving RNA, drying the precipitate at room temperature for 2-5 min, adding a proper amount of RNasefree to dissolve the precipitate, gently blowing and beating the precipitate by using a pipette if necessary, and storing for later use after the RNA precipitate is completely dissolved.
3.2 reverse transcription of viral RNA as template to synthesize cDNA
Carrying out two-step reverse transcription on the extracted RNA by using a reverse transcription kit, wherein the first-step reaction system is as follows: oligo dTprimer (50uM) 1. mu.L, dNTP mix (10mM each) 1. mu.L, Template RNA 2. mu.L, RNase free ddH2O6. mu.L, reaction conditions were: cooling rapidly at 65 deg.C for 5 min; the second step reaction system is: template RNA and PrimeMixture (product of first step) 10. mu.L, 5. mu.l PrimeScript II Buffer 4. mu.L, RNase inhibitor (40U/. mu.L) 0.5. mu.L, PrimeScript II RTase (200U/. mu.L) 1. mu.L, RNase free H204.5. mu.L, reaction conditions are as follows: mixing, cooling at 42 deg.C for 30-60min and 95 deg.C for 5min on ice.
3.3RT-PCR detection
Searching gene sequence of hog cholera lapinized virus (C strain) on Genbank, finding out specific conserved region of the whole genome of the hog cholera lapinized virus (C strain) by a bioinformatics method through comparison and analysis, designing a special Primer for RT-PCR identification by taking a region (383bp, SEQ ID NO: 1 in a sequence table) from 54-436bp at the 5' end as an object and using software Primer Express2.0 to detect whether ST monoclonal cells can continuously infect the hog cholera lapinized virus (C strain) or not, wherein the Primer sequence is as follows:
the RT-PCR identifies the specific primers of the hog cholera lapinized virus (C strain):
forward primer (Forward primer): 5'-ATTTGGTTCAGGGCCTCC-3' (SEQ ID NO: 2 in the sequence Listing)
Downstream primer (Reverse primer): 5'-TCCACTCCCATTGGTTTT-3' (SEQ ID NO: 3 of the sequence Listing).
Taking cDNA as a template, and carrying out RT-PCR amplification under the guidance of a primer special for RT-PCR, wherein the RT-PCR reaction system is as follows: mu.L of template cDNA, 12.5. mu.L of 2 XTaq PCR Master MIX, 1. mu.L of upstream primer (10. mu.M/. mu.L), 1. mu.L of downstream primer (10. mu.M/. mu.L), and RNase free H2O to 25 μ L; the reaction conditions of the RT-PCR are as follows: pre-denaturation at 94 ℃ for 5 min; then denaturation at 94 ℃ for 30s, annealing at 56-64 ℃ for 20s, and extension at 72 ℃ for 30s for 35 cycles; finally, extension is carried out for 10min at 72 ℃.
And after the reaction is finished, carrying out 1% agarose gel electrophoresis on the RT-PCR amplification product, and if the target fragment with the length of 383bp can be amplified, determining that the detection result is positive, and otherwise, determining that the detection result is negative.
Through the preliminary identification of RT-PCR, the obtained ST monoclonal cell lines of the D3 strain, the C4 strain, the C8 strain, the D5 strain, the E10 strain, the E11 strain, the F9 strain and the H9 strain can be continuously infected with hog cholera lapinized virus (C strain).
4) And (3) quantitatively detecting virus liquid by using a real-time fluorescent quantitative RT-PCR technology to determine the copy number of the virus. The virus can continuously infect cells, and the copy number of the virus liquid obtained in the third batch and the later batches can be maintained at 106The copies/mL is a swine fever lapinized low virulent strain (C strain) ST sensitive cell line (the swine fever virus infected cells have an adaptive stage, and the virus price of the virus liquid of the first two batches is lower), and the specific method comprises the following steps:
the primer and TaqMan probe for real-time fluorescent quantitative RT-PCR detection are designed by taking 151-th and 243bp (length 93bp, SEQ ID NO: 4 in a sequence table) from the 5' end in a specific conserved region of a whole genome of a hog cholera lapinized virus (C strain) as an object (a 93bp target fragment is a part of 383bp of an RT-PCR amplification product in the step 3.3) to determine the copy number of the virus, and the sequences of the primer and the TaqMan probe are as follows:
forward primer (Forward primer): 5'-CCCTGGGTGGTCTAAG-3' (SEQ ID NO: 5 in the sequence Listing) downstream primer (Reverse primer): 5'-CATGCCCTCGTCCAC-3' (SEQ ID NO: 6 in the sequence Listing) TaqMan probe: 5'- (FAM) CCTGAGTACAGGACAGTCGTCAGTAGTT(TAMRA) -3' (SEQ ID NO: 7 in the sequence Listing).
The TaqMan probe is subjected to fluorescent labeling, a report fluorescent group is labeled at the 5 'end of the TaqMan probe, and a quenching fluorescent group is labeled at the 3' end of the TaqMan probe; the reporter fluorophore is FAM, and the fluorescence quenching group is TAMRA; to prevent extension during PCR amplification, the 3' end of the probe has been phosphorylated.
4.1 establish a standard curve: hog cholera virus (strain C) was used as a standard and diluted to 1X 108、1×107、1×106、1×105、1×104、1×103、1×102、1×101Copies (copies)/μ L, 2 replicates per sample, and different concentrations of standards as templates, under the guide of primers and TaqMan probes, for real-time fluorescent quantitative PCR detection.
The reaction system of the real-time fluorescent quantitative RT-PCR in the step 4.1) is as follows: template RNA 2. mu.L, 2 XTT-PCRbuffer 12.5. mu.L, upstream primer (20. mu.M/. mu.L) 0.5. mu.L (10ng), downstream primer (20. mu.M/. mu.L) 0.5. mu.L (10ng), Mix enzyme 0.5. mu.L, HS enzyme 0.5. mu.L, TaqMan probe (20. mu.M/. mu.L) 0.5. mu.L (10ng), RNase free H2O to 25 μ L; the reaction conditions of the real-time fluorescent quantitative RT-PCR are as follows: firstly, the temperature is 52 ℃ for 15min, and the temperature is 95 ℃ for 5 s; then, 45 cycles of 94 ℃ for 5s and 58 ℃ for 40s were carried out.
The amplification curves of the standards are shown in FIG. 3 (curves from left to right correspond to 1X 108、1×107、1×106、1×105、1×104、1×103、1×102、1×101Copies (copies)/μ L concentration of standard), the standard amplification curve is a smooth "S" shaped curve. After the detection is finished, the concentration Log value (X axis) of each standard substance is plotted against the corresponding Ct value (Y axis), a standard curve is drawn, the standard curve is shown in figure 4 (the abscissa is the Ct value, and the ordinate is the copy number), and R is2The error is small, and the linear equation obtained from the standard curve is 0.999:
y＝-3.394x+40.812。
4.2 extracting the genome RNA of each harvested virus liquid of 8 batches, and carrying out real-time fluorescent quantitative RT-PCR detection under the guide of a primer and a TaqMan probe by taking the extracted genome RNA as a template.
The reaction system of the real-time fluorescent quantitative RT-PCR in the step 4.2) is as follows: template RNA 2. mu.L, 2 XTT-PCRbuffer 12.5. mu.L, upstream primer (20. mu.M/. mu.L) 0.5. mu.L (10ng), downstream primer (20. mu.M/. mu.L) 0.5. mu.L (10ng), Mix enzyme 0.5. mu.L, HS enzyme 0.5. mu.L, TaqMan probe (20. mu.M/. mu.L) 0.5. mu.L (10ng), RNase free H2O to 25 μ L; the reaction conditions of the real-time fluorescent quantitative PCR are as follows: firstly, the temperature is 52 ℃ for 15min, and the temperature is 95 ℃ for 5 s; then, 45 cycles of 94 ℃ for 5s and 58 ℃ for 40s were carried out.
And 4.3, qualitatively and quantitatively detecting the sample to be detected according to the change and the intensity of the fluorescence signal, wherein the existence of a fluorescence amplification curve indicates that the sample contains the classical swine fever virus (C strain), the non-existence of the fluorescence amplification curve indicates that the sample does not contain the classical swine fever virus (C strain), the copy number of the classical swine fever virus (C strain) contained in the sample to be detected is obtained according to the intensity of the fluorescence signal of the sample and the standard curve in the step 4.1), and the real-time fluorescence quantitative RT-PCR detection result is shown in the table 1.
As shown in Table 1 and FIG. 5, the number of venom copies from batch 3 to batch 8 obtained from the harvest of two strains C4 and E11 in the obtained 8-strain ST monoclonal cell line was maintained at 106copies/mL of copies and a venom copy number of 10 at peak time7The copies/mL, the virus yield is obviously higher than other cell strains, belongs to the ST sensitive cell line of hog cholera lapinized virus strain (C strain), and can be applied to the production of hog cholera vaccines.
TABLE 1 hog cholera virus (C strain) real-time fluorescent quantitative RT-PCR detection results
Claims (6)
1. The method for rapidly breeding the ST sensitive cell line of the hog cholera lapinized virus strain (C strain) mainly comprises the following steps:
1) obtaining ST monoclonal cells;
2) inoculating a hog cholera lapinized low virulent strain, namely a C strain, culturing, harvesting virus liquid every 48h, and continuously harvesting 8 batches of virus liquid;
3) extracting RNA of each batch of continuously-harvested hog cholera lapinized virus liquid, performing primary identification by using an RT-PCR (reverse transcription-polymerase chain reaction) technology, and determining that the ST monoclonal cell line can continuously infect hog cholera lapinized virus (C strain);
4) quantitatively detecting the hog cholera lapinized virus solution by using a real-time fluorescent quantitative RT-PCR technology to determine the copy number of the hog cholera lapinized virus strain (C strain) and determine that the hog cholera lapinized virus strain (C strain) can continuously infect cells; and
5) the copy number of virus solution harvested in the third and later batches can be maintained at 106copy/mL is determined as ST sensitive cell line of hog cholera lapinized virus strain (C strain);
wherein, the method for obtaining the ST monoclonal cells in the step 1) comprises the following steps: ST cells without exogenous viral contamination were incubated at 37 ℃ with 5% CO2Culturing for 48h in an incubator, digesting the cells into single scattered cells by using trypsin with the mass concentration of 0.2g/100mL, counting the cells, then diluting the cells to the cell concentration of 10-100cells/mL by using a DMEM medium with the volume concentration of 15% serum, adding the cells to a 96-well plate by using a pipette, wherein each well is 100 mu L, observing under a microscope, recording and marking the wells containing only one cell, observing every day, and gradually expanding and culturing after the number of the cells is increased to obtain ST monoclonal cells;
the RT-PCR identification method in the step 3) comprises the following steps:
3.1) extracting the total RNA of the hog cholera lapinized venom;
3.2) reverse transcription is carried out by taking the total RNA of the virus liquid as a template to synthesize cDNA of the virus liquid;
3.3) RT-PCR detection: taking cDNA as a template, carrying out PCR amplification under the guidance of an RT-PCR specific primer, carrying out 1% agarose gel electrophoresis on a PCR amplification product after the reaction is finished, and if a target fragment with the length of 383bp can be amplified, determining that the detection result is positive, otherwise, determining that the detection result is negative;
the nucleotide sequence of the upstream primer for RT-PCR identification in the step 3.3) is shown as SEQ ID NO: 2, the nucleotide sequence of the downstream primer is shown as SEQ ID NO: 3, respectively.
2. The method for rapidly breeding the ST sensitive cell line of the lapinized hog cholera strain (strain C) according to claim 1, wherein: the method for inoculating the hog cholera lapinized virus strain (C strain) in the step 2) comprises the following steps: inoculating the hog cholera lapinized virus strain (C strain) to ST monoclonal cells, and culturing at 37 deg.C and 5% CO2Culturing in an incubator, and storing each harvested batch of virus liquid at-80 ℃ for short term for detection.
3. The method for rapidly breeding the ST sensitive cell line of the lapinized hog cholera strain (strain C) according to claim 1, wherein: in the step 3.2), the extracted RNA is subjected to two-step reverse transcription by using a reverse transcription kit, wherein the first-step reaction system is as follows: mu.L of 50. mu.M Oligo dT Primer 1. mu.L, 10mM each of dNTP mix 1. mu.L, Template RNA 2. mu.L, RNase free ddH2O6. mu.L, and the reaction conditions are as follows: cooling rapidly at 65 deg.C for 5 min; the second step reaction system is: the first step reaction system was 10. mu.L, 5 XPrimeScript II Buffer 4. mu.L, 40U/. mu.L of Rnaseinhibitor 0.5. mu.L, 200U/. mu.L of PrineScriptIIRTase 1. mu.L, and RNase free H204.5. mu.L, reaction conditions are as follows: mixing, cooling at 42 deg.C for 30-60min and 95 deg.C for 5min on ice.
4. The method for rapidly breeding the ST sensitive cell line of the lapinized hog cholera strain (strain C) according to claim 1, wherein: the RT-PCR reaction system in the step 3.3) is as follows: mu.L of template cDNA, 12.5. mu.L of 2 XTaq PCR Master MIX, 1. mu.L of 10. mu.M/. mu.L upstream primer, 1. mu.L of 10. mu.M/. mu.L downstream primer, and RNase free H2O to 25 μ L; the reaction conditions of the RT-PCR are as follows: pre-denaturation at 94 ℃ for 5 min; then denaturation at 94 ℃ for 30s, annealing at 56-64 ℃ for 20s, and extension at 72 ℃ for 30s for 35 cycles; finally, extension is carried out for 10min at 72 ℃.
5. The method for rapidly breeding the ST sensitive cell line of the hog cholera lapinized virus strain (strain C) according to any one of claims 1 to 4, wherein: the real-time fluorescent quantitative RT-PCR detection method in the step 4) comprises the following steps:
4.1) establishing a standard curve: hog cholera virus (strain C) was used as a standard and diluted to 1X 108、1×107、1×106、1×105、1×104、1×103、1×102、1×101Taking standard substances with different concentrations as templates, carrying out real-time fluorescence quantitative PCR detection under the guide of primers and TaqMan probes, after the detection is finished, drawing a graph by taking the concentration Log value of each standard substance as an X axis and taking the corresponding Ct value as a Y axis, and drawing a standard curve;
4.2) extracting genome RNA of the hog cholera lapinized virus liquid, and carrying out real-time fluorescent quantitative RT-PCR detection on the hog cholera virus (C strain) under the guide of a primer and a TaqMan probe by taking the extracted genome RNA as a template;
4.3) qualitatively and quantitatively detecting the classical swine fever virus (C strain) in the sample to be detected according to the change and the intensity of the fluorescence signal, wherein the existence of the fluorescence amplification curve indicates that the sample contains the classical swine fever virus, the non-existence of the fluorescence amplification curve indicates that the sample does not contain the classical swine fever virus, and then the copy number of the classical swine fever virus contained in the sample to be detected is obtained according to the intensity of the fluorescence signal of the sample and the standard curve in the step 1).
6. The method for rapidly breeding the ST sensitive cell line of the lapinized hog cholera strain (strain C) according to claim 5, wherein: the nucleotide sequence of the upstream primer for real-time fluorescent quantitative RT-PCR detection in the steps 4.1) and 4.2) is shown as SED ID NO: 5, the nucleotide sequence of the downstream primer is shown as SEQ ID NO: 6 is shown in the specification; the nucleotide sequence of the TaqMan probe is shown as SEQ ID NO: 7, wherein the probe is subjected to fluorescent labeling, a report fluorescent group is labeled at the 5' end of the probe, a quenching fluorescent group is labeled at the 3' end of the probe, and the 3' end of the probe is subjected to phosphorylation treatment;
the reaction body of the real-time fluorescent quantitative RT-PCR in the steps 4.1) and 4.2)The method comprises the following steps: 2 muL of template RNA, 12.5 muL of 2 XRT-PCR buffer, 0.5 muL of upstream primer of 20 muM/muL, 0.5 muL of downstream primer of 20 muM/muL, 0.5 muL of Mix enzyme, 0.5 muL of HS enzyme, 0.5 muL of TaqMan probe of 20 muM/muL, and RNase free H2O to 25 μ L; the reaction conditions of the real-time fluorescent quantitative RT-PCR are as follows: firstly, the temperature is 52 ℃ for 15min, and the temperature is 95 ℃ for 5 s; then, 45 cycles of 94 ℃ for 5s and 58 ℃ for 40s were carried out.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610053986.8A CN105886662B (en) | 2016-01-26 | 2016-01-26 | Method for rapidly breeding ST sensitive cell line of hog cholera lapinized virus strain (C strain) and special primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610053986.8A CN105886662B (en) | 2016-01-26 | 2016-01-26 | Method for rapidly breeding ST sensitive cell line of hog cholera lapinized virus strain (C strain) and special primer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105886662A CN105886662A (en) | 2016-08-24 |
| CN105886662B true CN105886662B (en) | 2020-03-24 |
Family
ID=57013684
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610053986.8A Active CN105886662B (en) | 2016-01-26 | 2016-01-26 | Method for rapidly breeding ST sensitive cell line of hog cholera lapinized virus strain (C strain) and special primer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105886662B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112779352B (en) * | 2019-11-11 | 2023-07-21 | 中国动物疫病预防控制中心(农业农村部屠宰技术中心) | Dual digital PCR detection technology for swine fever and African swine fever and special kit thereof |
| CN114058736A (en) * | 2020-08-05 | 2022-02-18 | 先进应用技术有限公司 | Pig pathogenic bacteria detection method |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0914826D0 (en) * | 2009-08-25 | 2009-09-30 | Wyeth Corp | Assay methods |
| CN102221618B (en) * | 2011-06-23 | 2013-07-31 | 中国兽医药品监察所 | Method for establishing hog cholera lapinized virus labeled vaccine strain and preparing vaccine |
| CN102994445B (en) * | 2012-12-14 | 2015-10-07 | 山东滨州沃华生物工程有限公司 | A kind of indirect immunofluorescene assay technology of using carries out the method for screening in viral sensitive cells clone |
| CN103088158A (en) * | 2013-01-11 | 2013-05-08 | 金宇保灵生物药品有限公司 | Method for quantitative determination of hog cholera lapinized virus by real-time fluorescence quantification PCR (polymer chain reaction) technology |
-
2016
- 2016-01-26 CN CN201610053986.8A patent/CN105886662B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105886662A (en) | 2016-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106811550B (en) | Grass carp reovirus type II vaccine strain and wild strain identification primer, kit containing grass carp reovirus type II vaccine strain and wild strain identification primer and diagnostic detection method | |
| CN111733283B (en) | Triple fluorescence PCR detection kit for infectious spleen and kidney necrosis virus, largemouth black bass virus and mandarin fish rhabdovirus | |
| Nicholson et al. | Detection of Tilapia lake virus using conventional RT-PCR and SYBR green RT-qPCR | |
| Xu et al. | Isolation and characterization of vaccine-derived polioviruses, relevance for the global polio eradication initiative | |
| CN101812539B (en) | Hog cholera virus TaqMan-MGB fluorescence quantitative RT-PCR differential detection kit and production method thereof | |
| Liu et al. | Reverse transcription loop-mediated isothermal amplification for rapid detection of Japanese encephalitis virus in swine and mosquitoes | |
| CN105886662B (en) | Method for rapidly breeding ST sensitive cell line of hog cholera lapinized virus strain (C strain) and special primer | |
| CN110699485B (en) | RPA primer pair, probe, kit and detection method for rapidly detecting Marek's disease virus | |
| CN110885900B (en) | Freeze-dried microchip, kit and method for identifying classical strain of porcine reproductive and respiratory syndrome virus and NADC30-Like strain | |
| CN109439801B (en) | Real-time fluorescence RT-PCR detection kit and detection method for israel acute paralysis virus of bees | |
| CN109207644A (en) | For identifying the primer pair and RT-PCR detection method of hog cholera field virus and vaccine virus | |
| CN101285103A (en) | Synchronization detection process for multi-viruses of prawn | |
| Huang et al. | A new method to detect red spotted grouper neuro necrosis virus (RGNNV) based on CRISPR/Cas13a | |
| CN110885902B (en) | Freeze-drying microchip, kit and method for detecting porcine reproductive and respiratory syndrome virus and identifying highly pathogenic classical variant strain of porcine reproductive and respiratory syndrome virus | |
| Dogadov et al. | Molecular genetic identification of isolates of the hepatitis A virus (HAV) from monkeys at Adler Primate Center | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN112941240B (en) | Primer pair, kit and method for detecting goose astrovirus and goose goblet virus | |
| CN106868222B (en) | LAMP primer for detecting silkworm binary densovirus and kit thereof | |
| CN107574263A (en) | A kind of kit and method for the type of PCR quick detections pig circular ring virus 3 | |
| CN110144413B (en) | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification | |
| CN112877479A (en) | Primer for rapidly detecting exogenous viruses in porcine pseudorabies live vaccine and application of primer in kit | |
| Meng et al. | A genetically novel avian Hepatitis E virus in China | |
| CN113430274A (en) | RPA primer, probe, kit and method for detecting liver enterocytozoon | |
| CN109504664B (en) | III type duck hepatitis A virus chicken embryonated attenuated strain and application thereof | |
| CN110157836B (en) | Primer, probe and method for detecting IBRV and BVDV |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |