CN105886481B - A kind of chitin synthase and its gene and application - Google Patents
A kind of chitin synthase and its gene and application Download PDFInfo
- Publication number
- CN105886481B CN105886481B CN201610321982.3A CN201610321982A CN105886481B CN 105886481 B CN105886481 B CN 105886481B CN 201610321982 A CN201610321982 A CN 201610321982A CN 105886481 B CN105886481 B CN 105886481B
- Authority
- CN
- China
- Prior art keywords
- phytophthora
- oomycetes
- dna
- gene
- transformant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01016—Chitin synthase (2.4.1.16)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The present invention relates to chitin synthases, in particular to the chitin synthase in oomycota, its amino acid sequence is in similitude with the amino acid sequence as shown in SEQ ID No.4 75% or more, it is preferred that 80% or more, more preferably 90% or more, most preferably 95% or more and there is amino acid sequence with the amino acid sequence identical function as shown in SEQ ID No.4.The activity level of the chitin synthase can adjust the viable spore capsule of oomycetes and the yield of active zoospore to influence the pathogenicity of oomycetes or the occurring degree of host.
Description
Technical field
The present invention relates to chitin synthases, the in particular to chitin synthase in oomycota.
Background technique
There are many important pathogenic oomycetes in oomycota (Oomycota), a variety of host plants can be infected, such as
Phytophthora capsici (Phytophthora capsici) can infect solanaceae plant pepper and tomato, leguminous plant green soya bean and Kidney bean with
And the most plants in Curcurbitaceae, cause serious economic loss.Wherein capsicum epidemic disease is one in pepper planting and production
The crushing oomycetes disease of kind, in China, most area has generation, and capsicum epidemic disease has infection way more, and the course of disease is short, sprawling
The features such as speed is fast when onset condition is suitable for, can cause capsicum largely to wilt death in a short time, or even total crop failure.And soybean phytophthora
Root rot caused by germ (Phytophthora sojae) is infected is to seriously endanger one of the important disease of Soybean production,
Economic loss caused by annual is more than 1,000,000,000 dollars.1989, Northeast Area of China found soybean phytophthora root rot for the first time,
It is sent out in the main producing region Heilongjiang Province of Chinese soybean and the ground such as Anhui Province, Inner Mongolia Autonomous Region, Fujian Province and Beijing, Shandong Province
It is existing.
The asexual reproduction of oomycota can produce sporangium and zoospore.Sporangium resembles a pear in shape or lemon shape.It is sending out
When plant disease, Spores capsule is usually formed on plant site of pathological change surface.Sporangium can with the wind, rainwater and irrigation
It is propagated at a distance with water.Sporangium can be infected after contacting with host plant with direct germination.And in low temperature and moisture
Under conditions of, sporangium can also release monokaryon, cell-free wall, amphitrichous zoospore.Each sporangium can discharge 20-
40 zoospores, several hours that can generally continue to move about by several days, move in water in a spiral manner, and travelling distance is
6cm or longer.The travelling of zoospore has independence and has taxis, it can be made to infect the successful probability of host and improved.
Zoospore vulnerable to external environment stimulation and stop and be changed into the spore that stops, and quickly form to sprout after cell wall and form bud
Pipe secretes ectoenzyme after encountering host for destroying the epidermis of host plant and quickly forming and infects nail, can also pass through
Natural aperture is invaded.Zoospore is played as source of infection again main in Disease Cycle in disease in the groove on a large scale
Important role.
In conclusion the formation of Spores capsule and the generation of zoospore are that oomycetes infects process necessary to host.
And the severity of host's disease and the yield of sporangium and zoospore are positively correlated.If can block sporangium formation and
The generation of zoospore, so that it may control the generation of disease such as capsicum epidemic disease and soybean phytophthora etc. caused by oomycetes is infected.
Summary of the invention
By inventor's the study found that in oomycetes (Oomycota) specific chitin synthase and oomycetes generate it is active
The yield of sporangium and active zoospore is closely related, and the severity of host's disease and sporangium and zoospore
Yield is positively correlated.Therefore the formation of sporangium and the generation of zoospore can be blocked by regulation chitin synthase, it can
To reach the generation of disease such as capsicum epidemic disease and phytophthora root rot of soybean caused by control oomycetes is infected etc..
Therefore, one of present invention provides a kind of chitin synthase, amino acid sequence be with as shown in SEQ ID No.4
Amino acid sequence similitude 75% or more, preferably 80% or more, more preferably 90% or more, most preferably 95% with
Above and with the amino acid sequence with the amino acid sequence identical function as shown in SEQ ID No.4.In general, have higher
Similitude, while again amino acid sequence with the same function on evolutionary relationship have homology.Regardless of amino acid sequence
The similitude of column is high or low, as long as they are with conservative amino acid sites or amino acid block, and passes through evolutionary relationship
Analysis software further confirms that, then it is assumed that they have homology.Usually with the amino acid sequence or protein one of homology
As named using identical title.Here so-called homology or homologous sequence briefly refer to and pass through from a certain common ancestor
Divergent evolution and the relationship in the different sequences formed, that is, evolutionary process between the germanus branch.It necessarily refers to
Out, similitude (similarity) and homology (homology) are two entirely different concepts.Similitude refers to sequence ratio
To in the process be used to identical DNA base or the height of amino acid residue sequence proportion between detection sequence and target sequence are described
It is low, that is, the correlation between two sequences (nucleic acid, protein).When similarity degree is higher than 50%, it is easier to speculate inspection
Sequencing column and target sequence may be homologous sequence；And when degree of similarity is lower than 20%, just it is difficult to determining or basic nothing
Method is determined if with homology.Sequence alignment, PSCHS1 of the invention (SEQ ID No.4) are carried out using DNAMAN software
There is 92.34% similitude, PSCHS1 of the invention (SEQ ID No.3) and PCCHS with PCCHS (SEQ ID No.22)
(SEQ ID No.21) has 81.02% similitude.
Wherein, amino acid sequence of the invention can be the amino acid sequence as shown in SEQ ID No.4 by one
Or several amino acid residues substitution and/or deletion and/or addition and with the amino acid sequence function as shown in SEQ ID No.4
Identical amino acid sequence.Chitin synthase of the invention is typically derived from oomycetes in nature (Oomycota), i.e., generally
For, it is natural products.But it can also be by constructing the recombinant expression carrier containing chitin synthase gene, specific
In host, such as in common bacillus (Bacillus), pseudomonad (Pseudomonas), enterobacteria
(Escherichia) and in the biology such as at least one of yeast (Saccharomyces) it is recombinantly expressed.
In the present invention, the chitin synthase includes being present in Saprolegniales (Saprolegniales) and Peronosporales
(Peronosporales), especially Bai Xiuke (Albuginacece), Peronosporaceae (Peronosporaceae) and pythiaceae
At least one of (Pythiaceae) chitin synthase in；It is preferred that the chitin synthase includes being present in Plasmopara
(Plasmopara), the chitin synthase at least one of pythium (Pythium) and Phytophthora (Phytophthora)；
The more preferable chitin synthase includes phytophthora sojae kaufmann&gerdemann (Phytophthora sojae), phytophthora infestans
(Phytophthora infestans), phytophthora parasitica (Phytophthora parasitica) and Plasmopara viticola
Chitin synthase at least one of (Plasmopara viticola)
In the present invention, the amino acid sequence of the chitin synthase can be specifically as shown in SEQ ID No.4.
The two of the present invention provide a kind of DNA sequence dna that can encode any one chitin synthase as above.It is preferred that DNA sequence
It is classified as with the similitude of the DNA sequence dna as shown in SEQ ID No.3 65% or more, it is more excellent further preferably 75% or more
Be selected in 85% or more, particularly preferably 95% or more and have with the DNA sequence dna identical function as shown in SEQ ID No.3
DNA sequence dna.Such as cDNA or recombinant DNA.Such as in the present invention, the DNA sequence dna of the chitin synthase includes being present in water mold
Mesh (Saprolegniales) and Peronosporales (Peronosporales), especially Bai Xiuke (Albuginacece), Peronosporaceae
(Peronosporaceae) and the chitin synthase at least one of pythiaceae (Pythiaceae)；It is preferred that the chitin
Matter synthase includes being present in Plasmopara (Plasmopara), pythium (Pythium) and Phytophthora (Phytophthora)
It is at least one in chitin synthase；The more preferable chitin synthase includes phytophthora sojae kaufmann&gerdemann (Phytophthora
Sojae), phytophthora infestans (Phytophthora infestans), phytophthora parasitica (Phytophthora
) and the chitin synthase DNA sequence at least one of Plasmopara viticola (Plasmopara viticola) parasitica
Column.For another example DNA sequence dna of the invention is able to carry out molecule with the DNA sequence dna as shown in SEQ ID No.3 under strict conditions and hybridizes
And encode the DNA sequence dna of as above any one chitin synthase.Above-mentioned stringent condition can be for 6 × SSC, 0.5%SDS's be molten
Liquid hybridizes at 65 DEG C, and then with 2 × SSC, 0.1%SDS and 1 × SSC, it is primary that 0.1%SDS respectively washes film.
In the present invention, the DNA sequence dna of chitin synthase can be specifically as shown in SEQ ID No.3.
The three of the present invention provide the mRNA sequence that any one DNA sequence dna as above is transcribed.The four of the present invention provide
The method that one kind being able to suppress and/or killed oomycetes (Oomycota) growth, the method includes by inhibiting as above any
A kind of transcription of DNA sequence dna, or inhibit as above any one RNA sequence translation, or inhibit and/or inactivation as above any one
The activity of chitin synthase grows to inhibit and/or kill the oomycetes.
In the present invention, the oomycetes includes Saprolegniales (Saprolegniales) and Peronosporales
(Peronosporales), especially Bai Xiuke (Albuginacece), Peronosporaceae (Peronosporaceae) and pythiaceae
At least one of (Pythiaceae) chitin synthase in；It is preferred that the chitin synthase includes being present in Plasmopara
(Plasmopara), the chitin synthase at least one of pythium (Pythium) and Phytophthora (Phytophthora)；
The more preferable chitin synthase includes phytophthora sojae kaufmann&gerdemann (Phytophthora sojae), phytophthora infestans
(Phytophthora infestans), phytophthora parasitica (Phytophthora parasitica) and Plasmopara viticola
At least one of (Plasmopara viticola)
In the present invention, the method can be used for inhibiting and/or killing soybean, potato, tomato, tobacco, eggplant, thorn
The oomycetes disease that at least one of Chinese scholartree, wintersweet and grape generate.
The five of the present invention provide a kind of screening, and oomycetes is antibacterial and/or the method for fungicide, and the method includes will be to be checked
It surveys object and is applied to the oomycetes, transcribed when the object to be detected is able to suppress any one DNA sequence dna as above, or inhibit such as to take up an official post
It anticipates a kind of translation of RNA sequence, or inhibits and/or inactivate the activity of as above any one chitin synthase, then the object to be detected
For the antibacterial and/or fungicide of the oomycetes.The oomycetes includes Saprolegniales (Saprolegniales) and Peronosporales
(Peronosporales), especially Bai Xiuke (Albuginacece), Peronosporaceae (Peronosporaceae) and pythiaceae
At least one of (Pythiaceae) chitin synthase in；It is preferred that the chitin synthase includes being present in Plasmopara
(Plasmopara), the chitin synthase at least one of pythium (Pythium) and Phytophthora (Phytophthora)；
The more preferable chitin synthase includes phytophthora sojae kaufmann&gerdemann (Phytophthora sojae), phytophthora infestans
(Phytophthora infestans), phytophthora parasitica (Phytophthora parasitica) and Plasmopara viticola
At least one of (Plasmopara viticola).
The six of the present invention provide a kind of method for reducing oomycetes and infecting host's ability comprising by inhibiting as above any
A kind of transcription of DNA sequence dna, or inhibit as above any one RNA sequence translation, or inhibit and/or inactivation as above any one
The activity of chitin synthase reduces the ability that the oomycetes infects the host.The oomycetes includes Saprolegniales
(Saprolegniales) and Peronosporales (Peronosporales), especially Bai Xiuke (Albuginacece), Peronosporaceae
(Peronosporaceae) and the chitin synthase at least one of pythiaceae (Pythiaceae)；It is preferred that the chitin
Matter synthase includes being present in Plasmopara (Plasmopara), pythium (Pythium) and Phytophthora (Phytophthora)
It is at least one in chitin synthase；The more preferable chitin synthase includes phytophthora sojae kaufmann&gerdemann (Phytophthora
Sojae), phytophthora infestans (Phytophthora infestans), phytophthora parasitica (Phytophthora
) and at least one of Plasmopara viticola (Plasmopara viticola) parasitica.
The seven of the present invention provide a kind of method for detecting chitin synthase transcriptional level in oomycetes comprising choose as above
Any one section of 80-300bp in any one DNA sequence dna, the especially target sequence of 150-200bp long are glimmering to carry out reverse transcription
Fluorescent Quantitative PCR detection；It is also preferable to include internalcontrol sequences.The oomycetes includes Saprolegniales (Saprolegniales) and Peronosporales
(Peronosporales), especially Bai Xiuke (Albuginacece), Peronosporaceae (Peronosporaceae) and pythiaceae
At least one of (Pythiaceae) chitin synthase in；It is preferred that the chitin synthase includes being present in Plasmopara
(Plasmopara), the chitin synthase at least one of pythium (Pythium) and Phytophthora (Phytophthora)；
The more preferable chitin synthase includes phytophthora sojae kaufmann&gerdemann (Phytophthora sojae), phytophthora infestans
(Phytophthora infestans), phytophthora parasitica (Phytophthora parasitica) and Plasmopara viticola
At least one of (Plasmopara viticola)
The eight of the present invention provide a kind of for expanding the primer sequence of chitin synthase expression in oomycetes, that is, are used for
The primer sequence of target sequence is expanded, the preferably described primer sequence is as shown in SEQ ID No.5 and SEQ ID No.6；More preferably
The primer sequence of the internalcontrol sequence is as shown in SEQ ID No.7-12.The oomycetes includes Saprolegniales (Saprolegniales)
With Peronosporales (Peronosporales), especially Bai Xiuke (Albuginacece), Peronosporaceae (Peronosporaceae) and
Chitin synthase at least one of pythiaceae (Pythiaceae)；It is preferred that the chitin synthase includes being present in single shaft
Chitin at least one of mould category (Plasmopara), pythium (Pythium) and Phytophthora (Phytophthora)
Synthase；The more preferable chitin synthase includes phytophthora sojae kaufmann&gerdemann (Phytophthora sojae), phytophthora infestans
(Phytophthora infestans), phytophthora parasitica (Phytophthora parasitica) and Plasmopara viticola
At least one of (Plasmopara viticola).
In addition, recombinant vector, expression cassette or recombinant bacterium containing any one of the above DNA sequence dna also belong to guarantor of the invention
Protect range.The recombinant vector can be recombinant expression carrier, can also be recombinant cloning vector.In the present invention, the recombination table
Up to carrier be specially among the restriction enzyme site XbaI and EcoRI of pTOR carrier in positive insetion sequence table such as SEQ ID No.3
Shown in the recombinant plasmid that obtains after DNA fragmentation.
In the present invention, the recombinant bacterium is specially and has been imported as shown in SEQ ID No.3 into purpose soybean phytophthora
The recombination soybean phytophthora obtained after DNA fragmentation.Wherein, the DNA fragmentation as shown in SEQ ID No.3 is in the form of recombinant vector
It imports；The recombinant vector is specially positive insertion such as SEQ ID among pTOR carrier restriction enzyme site XbaI and EcoRI
The recombinant plasmid obtained after DNA fragmentation shown in No.3.The purpose soybean phytophthora is specially soybean phytophthora bacterial strain PS6.
Amplification coding as above the DNA sequence dna overall length or any section of DNA sequence thereon of any one chitin synthase
One primer and/or primer pair also belong to protection scope of the present invention.
It is demonstrated experimentally that chitin synthase provided by the present invention works during oomycetes own growth and development, utilize
PEG-CaCl2The growth and development for the silencing transformant that the protoplast transformation technology of mediation obtains has significant change compared with wild type,
It mainly include that sporangium forming quantity is reduced, zoospore yield decline etc.；The leaf of in vitro host is inoculated with by zoospore
Find that the lesion area of silencing transformant inoculation significantly less than wild type, is further inoculated with posting for living body by zoospore after piece
The plant lesion diameter of main etiolated seedling discovery silencing transformant inoculation is also significantly lower than wild type.Therefore, chitin in oomycetes
The yield of the adjustable viable spore capsule of the activity level of synthase and active zoospore, to influence the pathogenicity of oomycetes or post
Main occurring degree.The present invention is further to develop oomycetes germ growth course and molecular detection technology (such as the present invention is
The fluorescence quantitative PCR detection technique of exploitation) and oomycetes caused by plurality of plant diseases prevention and treatment and research provide technology
Basis.
Detailed description of the invention
Fig. 1 be PSCHS1 gene soybean phytophthora different developmental phases (abscissa from left to right successively are as follows: mycelia (MY),
Sporangium (SP), zoospore (ZO), the spore that stops (CY), infect soybean leaves 1.5h, 3h, 6h, 12h, for 24 hours, 48h) it is opposite
Expression quantity.
Fig. 2 is Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT), empty vector control transformant
The relative expression quantity of PSCHS1 in silencing transformant ST1-1, ST1-2 and ST1-3 of CK, PSCHS1 gene.
Fig. 3 is Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT), empty vector control transformant
The relative expression quantity for being overexpressed PSCHS1 in transformant OT1-1, OT1-2 and OT1-3 of CK, PSCHS1 gene.
Fig. 4 is Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT), empty vector control transformant
The bacterium colony photo of the overexpression transformant OT1-1 of silencing transformant ST1-1 and the PSCHS1 gene of CK, PSCHS1 gene.
Fig. 5 is Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT), empty vector control transformant
The overexpression transformant OT1-1 of silencing transformant ST1-1, ST1-2 and ST1-3 of CK, PSCHS1 gene and PSCHS1 gene,
The sporangium quantity figure of OT1-2 and OT1-3.
Fig. 6 is Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT), empty vector control transformant
The sporangial morphology of the overexpression transformant OT1-1 of silencing transformant ST1-1 and the PSCHS1 gene of CK, PSCHS1 gene shines
Piece.
Fig. 7 is Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT), empty vector control transformant
The overexpression transformant OT1-1 of silencing transformant ST1-1, ST1-2 and ST1-3 of CK, PSCHS1 gene and PSCHS1 gene,
The zoospore quantity of OT1-2 and OT1-3.
Fig. 8 is Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT), empty vector control transformant
The overexpression transformant OT1-1 of silencing transformant ST1-1, ST1-2 and ST1-3 of CK, PSCHS1 gene and PSCHS1 gene,
Causative effect of the OT1-2 and OT1-3 to soybean leaves.
Fig. 9 is Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT), empty vector control transformant
The overexpression transformant OT1-1 of silencing transformant ST1-1, ST1-2 and ST1-3 of CK, PSCHS1 gene and PSCHS1 gene,
Causative effect of the ST1-2 and ST1-3 to soybean etiolated seedling.
Figure 10 is PCCHS gene in Phytophthora capsici different developmental phases (mycelia (MY), sporangium (SP), zoospore
(ZO), stop spore (CY), infect Pepper Leaves 1.5h, 3h, 6h, 12h, for 24 hours, 48h) relative expression quantity.
Figure 11 is wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT), empty vector control turns
The relative expression quantity of PCCHS in silencing transformant T22, T33, T62 of beggar's CK and PCCHS gene.
Figure 12 is wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT), empty vector control turns
The sporangial morphology photo of silencing the transformant T33 and T62 of beggar's CK and PCCHS gene.
Figure 13 is wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT), empty vector control turns
The sporangium quantity of silencing transformant T22, T33, T62 of beggar's CK and PCCHS gene.
Figure 14 is wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT), empty vector control turns
The sporangial morphology scanning electron microscope result of silencing the transformant T33 and T62 of beggar's CK and PCCHS gene.
Figure 15 is wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT), empty vector control turns
The quantity of the zoospore of silencing transformant T22, T33 and T62 of beggar's CK and PCCHS gene.
Figure 16 is wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT), empty vector control turns
Causative effect of the silencing transformant T33 and T62 of beggar's CK and PCCHS gene to Pepper Leaves.
Figure 17 is wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT), empty vector control turns
Causative effect of silencing transformant T33, the T62 of beggar's CK and PCCHS gene to pepper plant.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment side in following embodiments
Method is unless otherwise specified conventional method.The materials, reagents and the like used in the following examples, unless otherwise specified,
It obtains from commercial channels.
Soybean phytophthora bacterial strain PS6: it is real with fungicide pharmacology to deposit in China Agricultural University's plant protection institute seed disease reason
Room is tested, the public can obtain from China Agricultural University.
Phytophthora capsici bacterial strain LT1534: it is presented by University of Tennessee, U.S. Kurt professor Lamour, is recorded in " Genome
Sequencing and Mapping Reveal Loss of Heterozygosity as a Mechanism for Rapid
Adaptation in the Vegetable Pathogen Phytophthora capsici”,Mol Plant Microbe
Interact, 2012, the public can obtain from China Agricultural University.
Lyases, cellulase, mannitol are purchased from Sigma-Aldrich company, article No. be respectively as follows: L1412,
C8546、M1902。
Culture medium prescription:
PDA solid medium: PDA solid medium: weighing potato 200g, and stripping and slicing of peeling, which is placed in 1L distilled water, to be added
Heat 30 minutes is settled to 1L again after collecting filtrate with four layers of filtered through gauze, 14g agar powder is added and 18g glucose boils,
121 DEG C of moist heat sterilizations 20 minutes to get.
V8 solid medium: 100ml V8 vegetable juice is centrifuged 10min under 1500 revs/min (5000g), takes supernatant and go
Ionized water 1:9 dilution proportion (900ml deionized water is added in the supernatant of 100ml), is added 1g calcium carbonate, 15g agar, and high pressure is steamed
Vapour sterilizing (121 DEG C) 20min.
NPB liquid and NPBA solid medium: 125g green pea, 1L deionized water, high pressure steam sterilization (121 DEG C)
After 20min, 4 layers of filtered through gauze take filtrate, and add following each substance: K2HPO41.0g, KNO33.0g, MgSO40.5g,
CaCl20.1g, CaCO32.0g, D-glucitol 5.0g, PEARLITOL 25C 5.0g, glucose 5.0g, yeast powder 2.0g, vitamin
2.0ml, microelement 2.0ml, agar powder (when preparing solid medium) 15g, and 1L is settled to deionized water.High steam
Sterilize (121 DEG C) 20min.
PM fluid nutrient medium: 125g green pea, 1L deionized water, after high pressure steam sterilization (121 DEG C) 20min, 4 layers of gauze
Filtering takes filtrate, and 91.1g mannitol, 1g CaCl is added2, 2g calcium carbonate, and 1L is settled to deionized water.High steam goes out
Bacterium (121 DEG C) 20min.If preparing PM solid medium, 10.5g Agar high pressure steam sterilization is added in 1L PM fluid nutrient medium
?.MMg culture solution: 0.4M PEARLITOL 25C, 15mM MgCl2, 4mM 2- (N- morpholine) ethanesulfonic acid (MES), pH 5.7；It is high
Press steam sterilizing (121 DEG C) 20min.
PTOR carrier: the laboratory Agricultural University Of Nanjing Wang Yuanchao give, and is recorded in " Shao Jing Peng, Phytophthora Capsici Zoospores
The research of population effect., China Agricultural University, master thesis in a 2014 " text, the public can obtain from China Agricultural University
?.
Embodiment 1
1. the clone of chitin synthase PSCHS1 gene
The extraction of 1.1 soybean phytophthora total serum IgEs
Soybean phytophthora bacterial strain PS6 after dark culturing 6 days, beats cut-off from colony edge at 25 DEG C on solid medium V8
Diameter is the pure culture biscuits involvng inoculation of 5mm on the PDA plate for being covered with glassine paper, and 25 DEG C scrape mycelia after dark culturing 6 days, takes 30mg or so
Mycelia, as in the 2ml centrifuge tube of no RNase, and the steel ball of two diameter 5mm is added, ball milling instrument is used after liquid nitrogen frozen
It is ground to powdered.Soybean phytophthora RNA, specific method are extracted using the SV Total RNA extracts kit of Promega company
The explanation that step is extracted with reference to plant tissue RNA in kit.
The synthesis of 1.2 the first chain of soybean phytophthora reverse transcription cDNA
First chain cDNA synthesis is using Takara company RT reagent Kit with
GDNAEraser (Perfect Real Time) kit carries out.Specific step is as follows:
(1) genomic DNA (10 μ l reaction system) is removed: 5 × gDNA Eraser Buffer, 2 μ l；gDNA Eraser
1μl；2 μ l of total serum IgE；5 μ l of ultrapure water without RNase.
(2) reverse transcription reaction (20 μ l reaction system): the 10 μ l of reaction solution of step (1)； Buffer
2 4μl；RT Enzyme Mix I 1μl；RT Primer Mix 1μl；4 μ l of ultrapure water without RNase.
Reaction condition: 37 DEG C of 15min；85℃5s；4 DEG C of preservations.The cDNA of acquisition is diluted 4 times and is used for Real time
PCR reaction.
1.3PSCHS1 gene cloning
The primer of design clone's soybean phytophthora chitin synthase PSCHS1 gene, PSCHS1-F (SEQ ID No.1):
ATGAGCGGCGCCCCGCCCCCGT；PSCHS1-R:(SEQ ID No.2): TTAGGCCGCCGAG GAGACGTCGTT.With step
The rapid 2 phytophthora sojae gene group cDNA obtained are template, carry out PCR amplification with above-mentioned primer, after amplified production is recycled respectively
It is connected with T1-simple Vector (Quan Shijin, Beijing), and converts Escherichia coli T1, pass through blue hickie screening, Plasmid DNA
Digestion evaluation and screening goes out positive colony, and the plasmid for extracting positive colony is sequenced, sequencing result show PSCHS1 gene by
2742 deoxynucleotides form (see SEQ ID No.3), encode 913 amino acid (sequence is shown in SEQ ID No.4).
Expression pattern analysis of the 2PSCHS1 gene in soybean phytophthora different developmental phases
By different developmental phases (i.e. mycelia (MY)；Sporangium (SP)；Zoospore (ZO)；Stop spore (CY)；Mycelia is infected
1.5h, 3h after soybean leaves, 6h, 12h, for 24 hours and 48h) the total serum IgE of soybean phytophthora bacterial strain PS6 (extracting method is big referring to 1.1
The extraction of beans phytophthora total serum IgE) cDNA of reverse transcription synthesis (closes referring to the synthesis of 1.2 the first chain of soybean phytophthora reverse transcription cDNA
At cDNA) it is template, fluorescence quantitative PCR detection is carried out to PSCHS1 gene.With soybean phytophthora RPS gene, RPL13a gene and
Deoxyribonucleoside acid fragment in β-tublin gene is internal reference.The wherein deoxyribonucleoside acid fragment primer in PSCHS1 gene
PSCHS1-RT-F and PSCHS1-RT-R amplification；Deoxyribonucleoside acid fragment in soybean phytophthora RPS gene with primer RPS-F and
RPS-R amplification；Deoxyribonucleoside acid fragment in RPL13a gene is expanded with primer RPL13a-F and RPL13a-R；β-tublin base
Deoxyribonucleoside acid fragment because in is expanded with primer β-tublin-F and β-tublin-R.
Fluorescence quantification PCR primer is as shown in the table:
By Realtime PCR reaction using Takara company Premix Ex TaqTM(Perfect
Real Time) kit, reaction system is as follows:
Reaction condition is as follows: initial denaturation: 95 DEG C of 30s；95 DEG C of 5s, 62 DEG C of 30s, 72 DEG C of 34s, 40 circulations.
Use ABI7500 carry out Realtime PCR reaction, and each sample is done to be repeated three times, using 2-ΔΔCt
Method calculate PSCHS1 gene relative expression quantity.
As a result as shown in Figure 1, the expression quantity of target gene PSCHS1 occurs since soybean phytophthora sporangium formation stages
Up-regulation, and PSCHS1 infects soybean leaves stage expression quantity in soybean phytophthora and also significantly raises, therefore by the two growth and development
Stage is as research emphasis.
3. the silencing transformant of soybean phytophthora PSCHS1 gene and the acquisition for being overexpressed transformant
The acquisition of the silencing expression vector and over-express vector of 3.1 soybean phytophthora PSCHS1 genes
Using the cDNA of soybean phytophthora bacterial strain PS6 as template, using primer PSCHS1-XbaI-F (SEQ ID No.13):TCTAGACTGCCCATTCATACGGTGTT (underscore part be XbaI identification restriction enzyme site, for silent carrier construct) and
PSCHS1-EcoRI-R (SEQ ID No.14):GAATTC(underscore part is the knowledge of EcoRI to CTGCTGGAAGCCTTGGAACA
Other restriction enzyme site is constructed for silent carrier) and primer PSCHS1-EcoRI-F (SEQ ID No.15):GAATTC(underscore part is the identification restriction enzyme site of EcoRI to CTGCCCATTCATACGGTGTT, is used for Overexpression vector structure
Build) and PSCHS1-XbaI-R (SEQ ID No.16):TCTAGA(underscore part is XbaI to CTGCTGGAAGCCTTGGAACA
Identification restriction enzyme site, for Overexpression vector construct) carry out PCR amplification.After amplified production is recycled respectively with T1-
Simple Vector (Quan Shijin, Beijing) connection, and Escherichia coli T1 is converted, pass through the screening of blue hickie, the digestion of Plasmid DNA
Evaluation and screening goes out positive colony, and the plasmid for extracting positive colony is sequenced, and expands numerous pTOR plasmid for digestion.Digestion system
As follows (enzyme is bought from NEB):
The digestion 5-15min in 37 DEG C of water-baths.
PSCHS1 gene after digestion is connected in the pTOR plasmid after digestion, following (the T4ligase purchase of linked system
It buys from NEB): pTOR 1 μ l；PSCHS1 5μl；5×ligation buffer 2μl；T4ligase 0.5μl；1.5 μ of ultrapure water
l；10 μ l of total volume.30min is connected under the conditions of being placed in 25 DEG C, converts Escherichia coli T1, passes through resistance marker screening, Plasmid DNA
Digestion evaluation and screening go out positive colony, the plasmid for extracting positive colony is sequenced.
PTOR-F (SEQ ID No.17) TCACTCTCACGTGCCCAAGTCC and pTOR-R is carried out using vector primer
(SEQ ID No.18) TTGTATTAAATGCATAGACACA is sequenced, in the restriction enzyme site EcoRI and XbaI of pTOR carrier
The recombinant plasmid of the positive insertion PSCHS1 gene as shown in SEQ ID No.3 in place is the table excessively of soybean phytophthora PSCHS1 gene
Up to carrier.
PTOR-F (SEQ ID No.17) TCACTCTCACGTGCCCAAGTCC and pTOR-R is carried out using vector primer
(SEQ ID No.18) TTGTATTAAATGCATAGACACA is sequenced, in the restriction enzyme site EcoRI and XbaI of pTOR carrier
The recombinant plasmid of the reversed insertion sequence as shown in SEQ ID No.3 in place is that the silencing expression of soybean phytophthora PSCHS1 gene carries
Body.
The silencing transformant of 3.2 soybean phytophthora PSCHS1 genes and the acquisition for being overexpressed transformant
Using CaCl2The protoplast transformation method that-PEG is mediated prepares the silencing transformant of soybean phytophthora PSCHS1 gene
With overexpression transformant.Specific step is as follows:
The first step, the culture of soybean phytophthora bacterial strain PS6 are as follows:
(1) by soybean phytophthora bacterial strain PS6 in V8 solid medium tablets at 25 DEG C dark culturing 6 days, from bacterium colony side
The mycelia block that edge cuts diameter 5mm is transferred back on NPBA plate, dark culturing 7-10 days at 25 DEG C of NPBA plate.
(2) 10 pieces of mycelia block or so of 2 × 2mm are cut from colony edge, are put into the triangular flask equipped with 60ml NPB, altogether
Dark static gas wave refrigerator 3 days under the conditions of 3 bottles, 25 DEG C of culture.
Second step, the protoplast transformation of soybean phytophthora
(1) after static gas wave refrigerator 3 days, 1 layer of filtered through gauze collects mycelia into the centrifuge tube of 50ml, with the 0.8M of about 40ml
PEARLITOL 25C rinses mycelia, rinses mycelia with the 0.8M PEARLITOL 25C of about 40ml again.At room temperature on the horizontal shaker of 75rpm
Rinse 10min.
(2) enzyme solution: 0.15g lyases, 0.06g cellulose, 10ml 0.8M PEARLITOL 25C, 8ml ddH is prepared2O, 800 μ
L 0.5M KCl, 800 μ l 0.5M 2- (N- morpholine)-ethanesulfonic acids (MES), 400 μ l 0.5M CaCl2.And filtration sterilization.
(3) add the mycelia rinsed in the centrifuge tube for the enzyme solution that Xiang Shengyou step (2) is prepared, 75rpm is cracked at room temperature
Mycelia 35-50min.
(4) PEG4000 (6g PEG4000,3.75ml 0.8M PEARLITOL 25C, the 3ml 0.5M CaCl of configuration 40%2,
3ml H2O), magnetic agitation after filtration sterilization, is contained in the sterilizing small beaker of 50ml, is placed on ice to being completely dissolved at room temperature
It is spare.
(5) digest it is abundant when, in advance bandage the 50ml beaker of 2 layers of polyester staple fiber's filter cloth (mira-cloth) come
Mycelia is filtered to collect protoplast.Then the protoplast gathered is poured into 50ml Falcon centrifuge tube, 4 DEG C,
524g is centrifuged 3min.
(6) after protoplast is collected by centrifugation, supernatant is abandoned, washs precipitating with the W5 that 30ml or so is pre-chilled.4 DEG C, 524g, centrifugation
4min。
(7) supernatant is abandoned, with 10ml or so W5 solution suspension protoplast, and shelves 30min on ice.
(7) 4 DEG C, 524g, it is centrifuged 4min.Supernatant is abandoned, MMg culture solution is added with the protoplast that suspends, and make protoplast
Final concentration reach 2 × 106/ ml or so.
(8) it is placed at room temperature for 10min, (silencing for the soybean phytophthora PSCHS1 gene that step 1 obtains is expressed to be carried packing plasmid
Body or over-express vector) into the Falcon centrifuge tube of 50ml, the Plasmid DNA of every 40 μ g of pipe.
(9) it draws 1ml protoplast with the pipette tips cut to be added in above-mentioned Falcon centrifuge tube, and by plasmid and plasm
Body mixes gently, and is subsequently placed in 10min on ice.
(10) 40%PEG4000 solution is added, 1740 μ l are added in every pipe, soft to mix.PEG divides 3 times and adds, and is added every time
580μl。
(11) after mixing is added in PEG, it is placed on static 20min on ice.
(12) after 20min, 2ml PM culture medium is added in every pipe, stands 2min after mixing on ice.
(13) 8ml PM culture medium is added after standing 2min, then stands 2min.
(14) the PM culture medium that 10ml or so is added after 2min is set, after mixing, stationary culture 14h, makes primary at room temperature
Plastid regeneration.
(15) it is centrifuged 5min at 699g, discards supernatant liquid.
(16) when PM solid medium is cooled to certain temperature, the G418 of final concentration of 30 μ g/ml is added, it, will after mixing
Culture medium pours into the centrifuge tube of above-mentioned 50ml, mixes with regeneration mycelia.
(17) by after mixing PM culture medium and mycelia mixture pour into 9cm culture dish, dry.Dark culturing at 25 DEG C
3-4 days, whether there is or not bacterium colonies to grow for observation.Then it is doubtful transformant if there is bacterium colony to grow, extracts the identification for being used for downstream after saving
It is tested with analysis.
It tests while the control for being only transferred to pTOR marker plasmid into soybean phytophthora bacterial strain PS6 is set.
The silencing transformant of 3.3 soybean phytophthora PSCHS1 genes and the identification for being overexpressed transformant
By the transformant operated by above-mentioned 3.2 trifle through Geneticin (G418) resistance V8 solid medium tablets
25 DEG C of cultures are screened again, are beaten from colony edge and are taken inoculated by hypha block on the V8 plate for being covered with glassine paper, 25 DEG C of dark culturings 6
Mycelia is scraped after it, and the RNA of conversion subsample is extracted referring to method above.After synthesizing the first chain cDNA through reverse transcription, carry out
Quantitative fluorescent PCR verifying.Using soybean phytophthora using soybean phytophthora RPS gene, RPL13a gene and β-tublin gene as internal reference, with
The Wild-type soy Mtr mutant PS6 and soybean phytophthora bacterial strain PS6 for converting pTOR marker plasmid is control.Specific primer sequence and
Operate the 2nd trifle referring to the present embodiment: expression pattern analysis of the PSCHS1 gene in soybean phytophthora different developmental phases.
Use ABI7500 carry out Realtime PCR reaction, and each sample is done to be repeated three times, using 2-ΔΔCt
Method calculate PSCHS1 gene relative expression quantity.
The qualification result of the silencing transformant of soybean phytophthora PSCHS1 gene shows, the Wild-type soy phytophthora as control
Bacterial strain PS6 and the soybean phytophthora bacterial strain for converting pTOR marker plasmid amplify purpose band, and soybean phytophthora PSCHS1 gene
Silencing transformant almost expand less than purpose band.Three are selected at random from the silencing transformant of soybean phytophthora PSCHS1 gene
It is respectively labeled as ST1-1, ST1-2 and ST1-3.The specific qualification result of the silencing transformant of soybean phytophthora PSCHS1 gene is as schemed
Shown in 2, the silence efficiency of PSCHS1 is between 80%-90%.
The qualification result of the overexpression transformant of soybean phytophthora PSCHS1 gene shows, the Wild-type soy epidemic disease as control
Trichoderma strain PS6 and the soybean phytophthora bacterial strain for converting pTOR marker plasmid amplify purpose band, and soybean phytophthora PSCHS1 base
The overexpression transformant of cause expands resulting purpose band and is more clear, and signal is stronger.From the mistake of soybean phytophthora PSCHS1 gene
Expression transformant selects three at random and is respectively labeled as OT1-1, OT1-2 and OT1-3.The overexpression of soybean phytophthora PSCHS1 gene
The specific qualification result of transformant is as shown in figure 3, the overexpression efficiency of PSCHS1 is about 12-53 times of wild type.
4. the silencing transformant of soybean phytophthora PSCHS1 gene and the biology shape analysis for being overexpressed transformant
The detection of 4.1 mycelial growth rates
By Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT), empty vector control transformant CK and
Overexpression transformant OT1-1, OT1-2 and OT1-3 of silencing transformant ST1-1, ST1-2 and ST1-3 and PSCHS1 gene connect
Kind cultivates 6 days under 25 DEG C of dark conditions on the 9cm culture dish center added with 15ml V8 solid medium, uses crossing method
Measure the colony diameter of each bacterial strain, 3 repetitions of each bacterial strain.Thus mycelial growth rate is obtained.
The results show that turning with Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT), empty vector control
Beggar CK is compared, overexpression transformant OT1-1, OT1- of silencing transformant ST1-1, ST1-2, ST1-3 and PSCHS1 gene
2, the colony diameter of OT1-3 has no significant change (Fig. 4).
4.2 sporangium quantity and Morphology observation
Referring to the 3rd trifle (the silencing transformant of soybean phytophthora PSCHS1 gene and overexpression transformant of the present embodiment
Obtain) in method, 10%V8 solid and fluid nutrient medium are prepared, by Wild-type soy phytophthora (Phytophthora sojae)
The mistake of bacterial strain PS6 (WT), empty vector control transformant CK and silencing transformant ST1-1, ST1-2, ST1-3 and PSCHS1 gene
Expression transformant OT1-1, OT1-2, OT1-3 are inoculated on V8 culture medium, dark culturing 6 days under the conditions of 25 DEG C, and every plant of bacterial strain is used
5mm punch is beatened to take bacteria cake 10, moves into sterile petri dish, and 20ml V8 juice fluid nutrient medium, 25 DEG C of dark culturings 3 are added
It after it, is rinsed with 20ml deionized water, is rinsed 1 time every 30min, rinsed 5 times, later plus 10ml deionized water constant volume, set altogether
Under 25 DEG C of dark conditions after 6-8h, the quantity generated by sporangium in micro- sem observation bacteria cake, 3 repetitions.
The results show that overexpression transformant OT1-1, OT1-2, OT1-3 and Wild-type soy phytophthora of PSCHS1 gene
(Phytophthora sojae) bacterial strain PS6 (WT) is compared with empty vector control transformant CK, and sporangium quantity is suitable (Fig. 5),
And there are a certain number of sporangiums to release zoospore (Fig. 6)；But silencing transformant ST1-1, ST1-2 and ST1-
It is seldom that 3 sporangiums generate quantity, mostly spherical in shape and without Zoospore liberation (Fig. 6).This illustrates the expression quantity of PSCHS1 gene
The normal development and quantity that will affect soybean phytophthora sporangium are reduced, so that its growth phase develops backward delay.Based on this
Point can also illustrate that silencing transformant infects the reduced capability of host.
The detection of 4.3 zoospore quantity
Referring to the 3rd trifle (the silencing transformant of soybean phytophthora PSCHS1 gene and overexpression transformant of the present embodiment
Obtain) in method, 10%V8 solid and fluid nutrient medium are prepared, by Wild-type soy phytophthora (Phytophthora sojae)
Bacterial strain PS6 (WT), empty vector control transformant CK and silencing transformant ST1-1, ST1-2 and ST1-3 and PSCHS1 gene
It is overexpressed transformant OT1-1, OT1-2, OT1-3 to be inoculated on V8 culture medium, dark culturing 6 days under the conditions of 25 DEG C, every plant of bacterial strain
10 are beatened to take bacteria cake with 5mm punch, is moved into sterile petri dish, 20ml V8 juice fluid nutrient medium, 25 DEG C of dark culturings are added
It after 3 days, is rinsed with 20ml deionized water, is rinsed 1 time every 30min, rinsed 5 times, later plus 10ml deionized water constant volume, set altogether
Under 25 DEG C of dark conditions after 12h, the spore concentration of each suspension is measured with blood counting chamber, is respectively supplied with extrapolating unit area
Try the sporulation quantity of bacterial strain.
The results show that overexpression transformant OT1-1, OT1-2, OT1-3 and Wild-type soy phytophthora of PSCHS1 gene
(Phytophthora sojae) bacterial strain PS6 (WT) is compared with empty vector control transformant CK, zoospore quantity quite (figure
7)；But silencing transformant ST1-1, ST1-2, ST1-3 zoospore quantity is seldom (Fig. 7).This illustrates the table of PSCHS1 gene
Reducing up to amount will affect the generation of soybean phytophthora zoospore, and the expression quantity of this and PSCHS1 gene, which reduces, is influencing sporangium just
Often development is closely related with quantity.
The excised leaf pathogenicity of 4.4 transformants
Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT), empty carrier are prepared using the above method
It compares transformant CK, silencing transformant ST1-1, ST1-2, ST1-3 and is overexpressed the spore of transformant OT1-1, OT1-2, OT1-3
Sub- suspension.It prepares spore suspension and counts under the microscope, calculate the zoospore quantity in every ml spore suspension.It will
The concentration dilution of spore suspension is to 1 × 104ml-1.After collecting spore suspension, layers of absorbent paper is taken to be layered on the culture of Φ 15cm
In ware, it is put into glass supporter after pouring into appropriate amount of deionized water, stalwartness, equipotential, soybean leaves of the same age is adopted and is placed on glass supporter
Face.Spore suspension after dilution is inoculated in soybean leaves, every blade inoculation 2 drips, 10 μ l of every drop, 5 leaves of every group of inoculation
Piece.It is 25 DEG C that culture dish sealing, which is placed on temperature, under the conditions of humidity is 70%, 12h alternation of light and darkness culture 5d.Observation disease daily
Shape photographs to record.
The results show that inoculation Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT) spore suspension
Blade morbidity it is very fast, when being inoculated with the 3rd day, inoculation site occurs as soon as the rotten spot of necrosis, and scab has expansion trend, is connecing
Lesion area can reach 3.1cm at kind the 5th day2.There is phase in the blade of inoculation empty vector control transformant CK spore suspension
There is not scab (Fig. 8) in the soybean leaves of same symptom, sterile water inoculation；And with silencing transformant ST1-1, ST1-2, ST1-3
And the soybean leaves of the spore suspension inoculation of overexpression transformant OT1-1, OT1-2, OT1-3 had been inoculated with position at inoculation the 4th day
There is the rotten spot of gangrenosum acne in point, and intensity is obviously reduced (scab color is more shallow than compareing, and area ratio control is small), and onset area is significantly small
In the blade of inoculation soybean phytophthora wild-type strain PS6 (WT), when being inoculated with third day, lesion area is only between 0.4cm2-
1.2cm2(Fig. 8).
The plants pathogenicity of 4.5 transformants
Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT), empty carrier are prepared using the above method
Compare the 3rd trifle (the silencing transformant of soybean phytophthora PSCHS1 gene and overexpression transformant of transformant CK, the present embodiment
Obtain) obtained silencing transformant ST1-1, ST1-2, ST1-3 and the spore for being overexpressed transformant OT1-1, OT1-2 and OT1-3
Suspension.It prepares spore suspension and counts under the microscope, calculate the zoospore quantity in every ml spore suspension.By spore
The concentration dilution of sub- suspension is to 1 × 104ml-1.Group's inoculation of suspension liquid of moving about is cultivated to 4 days " Japan under dark condition
At blueness " seedling hypocotyl, apart from cotyledon about 1.5cm.Then 25 DEG C of dark moisturizing culture 48h measure lesion diameter and take pictures.Often
10 seedling hypocotyls of a strain inoculated, experiment repeat at least 3 times.
The results show that inoculation Wild-type soy phytophthora (Phytophthora sojae) bacterial strain PS6 (WT) spore suspension
Seedling inoculation 48h when morbidity diameter be 4.9cm.There is phase in the seedling of inoculation empty vector control transformant CK spore suspension
There is not scab (Fig. 9) in the soybean seedling of same symptom, sterile water inoculation；And with the 3rd trifle (soybean phytophthora of the present embodiment
The silencing transformant of PSCHS1 gene and the acquisition for being overexpressed transformant) obtained silencing transformant ST1-1, ST1-2, ST1-3
And the soybean seedling occurring degree of the spore suspension inoculation of overexpression transformant OT1-1, OT1-2 and OT1-3 writes lower than inoculation
The blade of soybean phytophthora wild-type strain PS6 (WT) falls ill diameter when being inoculated with 48h between 0.5-2.4cm.
Above-mentioned experiment illustratively PSCHS1 gene take part in soybean phytophthora infect host and cause the soybean phytophthora course of disease occur
Process, be important virulence factor.
Embodiment 2
The clone of Phytophthora capsici 1. (Phytophthoracapsici) chitin synthase PCCHS gene
Operation is the same as embodiment 1.
The difference is that:
1) the present embodiment selects Phytophthora capsici bacterial strain LT1534, and incubation time is 4 days.
2) primer of design clone Phytophthora capsici chitin synthase PCCHS gene is PCCHS-F (SEQ ID No.19):
ATGAGCGACCTTCCACCT；PCCHS-R (SEQ ID No.20): TTACGCGACCGAGGAGAT.Sequencing result shows PCCHS
Gene is made of 2745 deoxynucleotides (see SEQ ID No.21), and (sequence is shown in SEQ ID to 914 amino acid of coding
No.22)。
Expression pattern analysis of the 2.PCCHS gene in Phytophthora capsici different developmental phases
Operation is the same as embodiment 1.
The difference is that:
Phytophthora capsici 40S ribosomal protein S3A gene is selected when carrying out target PCCHS gene by fluorescence quantitative PCR detection
(WS21), the part deoxyribonucleoside acid fragment in Ubc gene and β-tublin gene is as internal reference.Wherein target PCCHS gene
In deoxyribonucleoside acid fragment with primer PCCHS-RT-F and PCCHS-RT-R expand；Deoxyribonucleoside acid fragment in WS21 is with drawing
Object WS21-F and WS21-R amplification；Deoxyribonucleoside acid fragment in Ubc gene is expanded with primer UBC-F and UBC-R；β-tublin
Deoxyribonucleoside acid fragment in gene is expanded with primer β-tublin-F and β-tublin-R.
The results are shown in Figure 10, and the expression quantity of target gene PCCHS is significant since Phytophthora capsici sporangium formation stages
Up-regulation, and PCCHS infects Pepper Leaves stage expression quantity in Phytophthora capsici and also significantly raises, therefore by the two growth and development ranks
Duan Zuowei research emphasis.
3. the acquisition of the silencing transformant of Phytophthora capsici PCCHS gene
Operation is the same as embodiment 1.
3.1 construct Phytophthora capsici PCCHS gene silencing expression vector when the difference is that:
Using the cDNA of Phytophthora capsici bacterial strain LT1534 as template, using primer PCCHS-XbaI-F (SEQ ID No.29):TCTAGAATGAGCGACCTTCCACCT (the identification restriction enzyme site that underscore part is XbaI) and PCCHS-ClaI-R (SEQ ID
No.30):ATCGATTTACGCGACCGAGGAGAT (the identification restriction enzyme site that underscore part is ClaI) carries out PCR amplification.
PTOR-F (SEQ ID No.17) TCACTCTCACGTGCCCAAGTCC and pTOR-R is carried out using vector primer
(SEQ ID No.18) TTGTATTAAATGCATAGACACA is sequenced, in the restriction enzyme site XbaI and EcoRI of pTOR carrier
The recombinant plasmid of the reversed insertion sequence PCCHS as shown in SEQ ID No21 in place is the silencing table of Phytophthora capsici PCCHS gene
Up to carrier.
3.2 in CaCl2- PEG mediate protoplast transformation process when the difference is that: the first step, Phytophthora capsici
The culture of bacterial strain LT1534, as follows:
(1) by Phytophthora capsici bacterial strain LT1534 in V8 solid medium tablets at 25 DEG C dark culturing 4 days, from bacterium colony
The mycelia block that edge cuts diameter 5mm is transferred back on NPBA plate, dark culturing 3-4 days at 25 DEG C of NPBA plate.
(2) after strain culturing 3-4 days, 10 pieces of mycelia block or so of 2 × 2mm is cut from colony edge, is put into equipped with 60ml
In the triangular flask of NPB, 3 bottles are co-cultured.Dark static gas wave refrigerator 2 days under the conditions of 25 DEG C.
Second step, the protoplast transformation of Phytophthora capsici
(1) after static gas wave refrigerator 2 days, 1 layer of filtered through gauze collects mycelia into the centrifuge tube of 50ml, with the 0.8M of about 40ml
Mannitol rinses mycelia, rinses mycelia with the 0.8M Mannitol of about 40ml again.At room temperature on the horizontal shaker of 75rpm
Rinse 10min.
3.3 test while the control for being only transferred to pTOR marker plasmid into Phytophthora capsici bacterial strain LT1534 are arranged.
3.4 carry out Phytophthora capsici PCCHS gene silencing transformant identification when the difference is that: by Phytophthora capsici
Silencing transformant screens again through 25 DEG C of solid medium tablets cultures of G418 resistance V8, beats from colony edge and takes inoculated by hypha block
On the PDA plate for being covered with glassine paper, 25 DEG C scrape mycelia after dark culturing 4 days.With capsicum when progress quantitative fluorescent PCR verifying
Phytophthora 40S ribosomal protein S3A gene (WS21), Ubc gene and β-tublin gene are internal reference, with wild type phytophthora blight of pepper
The strain LT1534 and Phytophthora capsici bacterial strain LT1534 for converting pTOR marker plasmid is control.Specific primer and operation are referring to this implementation
2nd trifle of example.
The qualification result of the silencing transformant of Phytophthora capsici PCCHS gene shows, the wild type Phytophthora capsici as control
Bacterial strain LT1534 and the Phytophthora capsici bacterial strain for converting pTOR marker plasmid amplify purpose band, and Phytophthora capsici PCCHS base
The silencing transformant of cause is almost expanded less than purpose band.Three are selected at random from the silencing transformant of Phytophthora capsici PCCHS gene
It is a to be respectively labeled as T22, T33 and T62.Specific qualification result such as Figure 11 institute of the silencing transformant of Phytophthora capsici PCCHS gene
Show, the silence efficiency of PCCHS is between 60%-80%.
4. the biology shape analysis of the silencing transformant of Phytophthora capsici PCCHS gene
The detection of 4.1 mycelial growth rates
Operation is the same as embodiment 1.The difference is that the material used are as follows: wild type Phytophthora capsici (Phytophthora
Capsici) bacterial strain LT1534 (WT), empty vector control transformant CK and silencing transformant T22, T33 and T62.
The results show that with wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT), empty carrier
Control transformant CK is compared, and the colony diameter of silencing transformant T22, T33 and T62 of PCCHS gene have no significant change.
4.2 sporangium quantity and Morphology observation
By wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT), empty vector control transformant
CK and silencing transformant T22, T33 and T6 are inoculated on V8 culture medium, and illumination cultivation 5 days.A large amount of spores are formed to Phytophthora capsici
After capsule, micro- sem observation is carried out.Meanwhile sample in V8 solid medium different location is cut, with 2.5% (volume fraction) penta
Sample presentation is scanned Electronic Speculum observation to Electron Microscopy Room after 4 DEG C of fixations of dialdehyde overnight.
The results show that silencing transformant T22, T33, T62 and wild type Phytophthora capsici (Phytophthora capsici)
Bacterial strain LT1534 (WT) is compared with empty vector control transformant CK, and sporangium deformity, sporangium quantity is remarkably decreased (Figure 12 and figure
13).Further by scanning electron microscopic observation, a small amount of spore that as a result silencing transformant T22, T33 and T62 as shown in figure 14 are formed
Deformity has occurred in scrotiform state, and mastoid process is more obvious, and the content formed in sporangium substantially reduces.
The detection of 4.3 zoospore quantity
By wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT), empty vector control transformant
CK and silencing transformant T22, T33, T62 are inoculated on V8 culture medium, dark culturing 3 days under the conditions of 25 DEG C, and illumination cultivation 5 days.
A large amount of sporangiums are formed to Phytophthora capsici, 30min under the conditions of appropriate sterile distilled water is placed in 4 DEG C, 30min under the conditions of 25 DEG C is added
Afterwards, spore suspension, microscopy concentration are collected.
The results show that silencing transformant T22, T33, T62 and wild type Phytophthora capsici (Phytophthora capsici)
Bacterial strain LT1534 (WT) is compared with empty vector control transformant CK, and as shown in figure 15, zoospore quantity is remarkably decreased, this with it is upper
The silencing conversion microscope quantity that text is mentioned is remarkably decreased, and it is closely related that deformity occurs for sporangial morphology.
The excised leaf pathogenicity of 4.4 transformants
Wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT) is prepared using the above method, it is empty
Vehicle Control transformant CK, the spore suspension of silencing transformant T22, T33 and T62.Prepare spore suspension and in microscope
Lower counting calculates the zoospore quantity in every ml spore suspension.By the concentration dilution of spore suspension to 1 × 105ml-1。
After collecting spore suspension, takes layers of absorbent paper to be layered in the culture dish of Φ 15cm, be put into glass after pouring into appropriate amount of deionized water
Bracket is adopted stalwartness, equipotential, Pepper Leaves of the same age and is placed in above glass supporter.Spore suspension after dilution is inoculated in peppery
Green pepper blade, every blade inoculation 10 drip, 10 μ L of every drop, 5 blades of every group of inoculation.It is 25 that culture dish sealing, which is placed on temperature,
DEG C, under the conditions of humidity is 70%, 12h alternation of light and darkness culture 3d.It observes the symptoms, photographs to record daily.
The results show that inoculation wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT) spore is outstanding
The blade morbidity of supernatant liquid is very fast, and when being inoculated with the 2nd day, inoculation site occurs as soon as the rotten spot of necrosis, and scab has expansion trend,
When being inoculated with third day, lesion area can reach 3.8cm2.The blade for being inoculated with empty vector control transformant CK spore suspension occurs
There is not scab (Figure 16) in the Pepper Leaves of same symptoms, sterile water inoculation；And with silencing transformant T22, T33 and T62
The Pepper Leaves of spore suspension inoculation there is gangrenosum acne in inoculation site in inoculation the 3rd day and rot spot, intensity is obviously reduced
(scab color is more shallow than compareing, and area ratio control is small), onset area is significantly less than inoculation Phytophthora capsici wild-type strain LT1534
(WT) blade, when being inoculated with third day, lesion area is only between 0.2cm2-1.4cm2(Figure 16).
4.5 the plants pathogenicity of transformant
Wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT) is prepared using the above method, it is empty
Vehicle Control transformant CK, the spore suspension of silencing transformant T22, T33 and T62.Prepare spore suspension and in microscope
Lower counting calculates the zoospore quantity in every ml spore suspension.By the concentration dilution of spore suspension to 1 × 105ml-1。
After collecting spore suspension, chooses the hole tray containing 50 caves and plant capsicum, 2 pepper seeds are sowed in each cave, by capsicum
It is placed in a greenhouse culture, when capsicum grew to for six leaf phases, carries out living body inoculation test.It is suspended using the method inoculating spores of pouring root
Liquid, each cave are inoculated with 3ml spore suspension, and 30 plants of pepper seedlings of every group of inoculation observe the symptoms daily, photograph to record, see after 7 days
Examine statistical result.
The state of an illness is divided into 0-5 grades: 0 referring to following standard: plant is healthy；1: leaf portion turns yellow and stem is not downright bad；2: stem
Small area necrosis；3: stem's moderate area necrosis, plant are wilted；4: stem's large area necrosis, plant seriously wither；5: plant is dead
It dies.
The results show that inoculation wild type Phytophthora capsici (Phytophthora capsici) bacterial strain LT1534 (WT) spore is outstanding
The plant morbidity of supernatant liquid is very fast, and when being inoculated with the 3-4 days, inoculation site occurs as soon as stem's necrosis, and necrosis has expansion trend,
When being inoculated with the 7th day, disease index is up to 2-3 grades.The plant of inoculation empty vector control transformant CK spore suspension occurs
There is not scab (Figure 17) in the pepper plant of same symptoms, sterile water inoculation；And the silencing transformant obtained with embodiment 3
There is necrosis in inoculation site at inoculation the 5-6 days in the pepper plant of the spore suspension inoculation of T22, T33 and T62, and the state of an illness refers to
Number is substantially less than the blade for being inoculated with Phytophthora capsici wild-type strain LT1534 (WT), and when being inoculated with the 7th day, disease index is between 0-
1 grade.
Above-mentioned experiment illustratively PCCHS gene take part in Phytophthora capsici infect host and cause the Phytophthora capsici course of disease occur
Process is important virulence factor.
Claims (5)
1. the method that one kind was able to suppress and/or killed oomycetes (Oomycota) growth, the method includes by inhibiting DNA sequence
The transcription of column, or inhibit the translation of RNA sequence, or inhibit and/or inactivate the activity of chitin synthase to inhibit and/or kill institute
State oomycetes growth；The amino acid sequence of the chitin synthase is amino acid sequence shown in SEQ ID No.4；The DNA sequence
It is classified as the DNA sequence dna that can encode the chitin synthase；The RNA is the RNA sequence that the DNA sequence dna is transcribed；
Wherein, inhibit and/or kill oomycetes (Oomycota) by making the reduction of sporangium forming quantity or the decline of zoospore yield
Growth；The oomycetes is phytophthora sojae kaufmann&gerdemann (Phytophthora sojae).
2. the method according to claim 1, wherein the DNA sequence dna of the chitin synthase is such as SEQ ID
DNA sequence dna shown in No.3.
3. the method according to claim 1, wherein the method is used to inhibit and/or kill soybean generation
Oomycetes disease.
4.DNA sequence, RNA sequence or chitin synthase make the reduction of oomycetes sporangium forming quantity or the decline of zoospore yield
In application；The amino acid sequence of the chitin synthase be and the amino acid sequence as shown in SEQ ID No.4；The DNA
Sequence is the DNA sequence dna that can encode the chitin synthase；The RNA is the RNA sequence that the DNA sequence dna is transcribed
Column；The oomycetes is phytophthora sojae kaufmann&gerdemann (Phytophthora sojae).
Reduce oomycetes 5. a kind of and infect the method for host's ability comprising by inhibit claim 1 to or method as described in 2
In the DNA sequence dna transcription, or inhibit turning over for the RNA sequence in method as stated in claim 1 or 2
It translates, or inhibits and/or inactivate the activity of the chitin synthase in method according to claim 1 or 2 to reduce
State the ability that oomycetes infects the host, wherein drop by reducing sporangium forming quantity or zoospore yield declining
Low oomycetes infects host's ability；The oomycetes is phytophthora sojae kaufmann&gerdemann (Phytophthora sojae).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610321982.3A CN105886481B (en) | 2016-05-16 | 2016-05-16 | A kind of chitin synthase and its gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610321982.3A CN105886481B (en) | 2016-05-16 | 2016-05-16 | A kind of chitin synthase and its gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105886481A CN105886481A (en) | 2016-08-24 |
| CN105886481B true CN105886481B (en) | 2019-10-01 |
Family
ID=56716237
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610321982.3A Active CN105886481B (en) | 2016-05-16 | 2016-05-16 | A kind of chitin synthase and its gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105886481B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109977728A (en) * | 2017-12-27 | 2019-07-05 | 云南农业大学 | A kind of method of counting of pathogenic oomycetes zoospore |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102634496B (en) * | 2012-05-04 | 2013-04-10 | 山东农业大学 | Carnitine acyltransferase PCCAT1 from Phytophthora capsici, and coding gene and application thereof |
-
2016
- 2016-05-16 CN CN201610321982.3A patent/CN105886481B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| Investigating the function of a putative chitin synthase from Phytophthora infestans;Stefan Klinter et al;《Oomycete Molecular Genetics Network Meeting》;20130312;第39页 * |
| XM_009525864.1;Tyler,B.M et al;《Genebank》;20141009;第1-5页 * |
| XP_002908631.1;Nusbaum,C et al;《Genebank》;20100722;第1-3页 * |
| XP_009524159.1;Tyler,B.M et al;《Genebank》;20141009;第1-4页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105886481A (en) | 2016-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhou et al. | Endophytism or saprophytism: Decoding the lifestyle transition of the generalist fungus Phomopsis liquidambari | |
| CN103756975B (en) | A kind of preparation method and application thereof infecting the soybean mosaic virus of tobacco | |
| CN110157719A (en) | Sclerotinite SsMAS3 gene and its application in plant resistance to sclerotinia sclerotiorum breeding | |
| CN102965382B (en) | New botrytis cinerea gene related to pathogenicity and application of new botrytis cinerea gene | |
| CN113025501A (en) | Multifunctional trichoderma asperellum and application thereof | |
| CN109077067A (en) | A kind of biocontrol microorganisms and its application in terms of crops gray mold prevention and treatment | |
| Zhang et al. | Isolation, identification and artificial inoculation of Ustilago esculenta on Zizania latifolia | |
| CN115044505A (en) | Antibacterial lipopeptide produced by bacillus belgii and application of antibacterial lipopeptide in cosmetics and foods | |
| CN102634496B (en) | Carnitine acyltransferase PCCAT1 from Phytophthora capsici, and coding gene and application thereof | |
| CN110484478A (en) | A kind of bacillus subtilis JZ2-1-12 and its application | |
| CN103255150A (en) | Magnaporthe grisea MoLON1 gene function and application thereof | |
| CN105886481B (en) | A kind of chitin synthase and its gene and application | |
| CN104388448B (en) | A kind of corn phospholipase A_2 gene ZmsPLA2-1 and its application | |
| Michalec-Warzecha et al. | Establishment of highly efficient agrobacterium rhizogenes-mediated transformation for Stevia rebaudiana Bertoni explants | |
| CN107488610A (en) | A kind of isolation and identification method of paddy bacterial fringe rot pathogen | |
| CN111996130A (en) | Biocontrol bacterium for plant root rot and application thereof | |
| CN112029665A (en) | Rubber tree colletotrichum resistant strain HcgHNQZ1736 and application thereof in drug resistance research | |
| Meliah et al. | Preliminary study of myxobacteria as biocontrol agents for panama disease pathogen, tropical race 4 Fusarium odoratissimum | |
| CN106167767B (en) | Endogenetic fungus L-14 and its application for preventing and treating banana blight | |
| CN103789325B (en) | Cotton cells wall extensin gene GbEXPATR and application | |
| CN105886482B (en) | Phytophthora capsici chitin synthase and gene and application thereof | |
| CN112195135A (en) | Bacillus belgii and application thereof in preventing and treating plant downy mildew disease | |
| CN111979210A (en) | Phytophthora capsici cellulose synthase protein and coding gene and application thereof | |
| CN110564813A (en) | miRNAs related to highland barley stripe disease and mining method thereof | |
| CN114989273B (en) | Gene PlMYB1R and application thereof in preventing and treating downy mildew of litchi |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |