CN105861753A - Nested RT-PCR method, primers and reagent kit for detecting Zika virus - Google Patents
Nested RT-PCR method, primers and reagent kit for detecting Zika virus Download PDFInfo
- Publication number
- CN105861753A CN105861753A CN201610353475.8A CN201610353475A CN105861753A CN 105861753 A CN105861753 A CN 105861753A CN 201610353475 A CN201610353475 A CN 201610353475A CN 105861753 A CN105861753 A CN 105861753A
- Authority
- CN
- China
- Prior art keywords
- pcr
- rna
- reaction
- cdna
- reagent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides two primer pairs. One primer pair includes nucleotide sequences shown as SEQ ID NO:1 and SEQ ID NO:2, and the other primer pair includes nucleotide sequences shown as SEQ ID NO:3 and SEQ ID NO:4. The invention further provides application of the two primer pairs in preparing products for detecting the Zika virus. The invention further provides a reagent kit comprising the two primer pairs and application. As proved by experiments, the two primer pairs are good in specificity and repeatability and high in sensitivity, and a Zika virus detecting method established based on the two primer pairs can be used for sensitively, accurately, stably and rapidly detecting whether the Zika virus exists or not and has great significance on clinical rapid diagnosis and public prevention and control over the Zika virus in China.
Description
Technical field
The present invention relates to field of biological detection, particularly to RT-Nested PCR method, primer and the examination of detection zika virus
Agent box.
Background technology
Zika virus (Zika virus, ZIKV) is found in rhesus monkeys in Uganda first in nineteen forty-seven, 1952
Year is separated to virus in the human body of Uganda and Tanzania.ZIKV is traveled to by the Aedes mosquito bite being infected
People, this relates generally to the Aedes aegypti of torrid areas.It is identical with the mosquito propagating dengue fever, Chikungunya fever and yellow fever.
But, existing two example zika viruses, by the case spread through sex intercourse, find to there is zika virus in seminal fluid in another example case.
ZIKV cases of infection and the country of epidemic outbreaks and area increase substantially in recent years, and 2007 first on island, the Pacific Ocean
There is zika virus epidemic outbreaks in the YAP island of state Micronesia, and 2013 and 2015 the most respectively in west, French Polynesia
There is large-scale epidemic situation in sub-and Brazil.Existing research shows that zika virus disease is likely to result in neural and self immune system is concurrent
Disease, in the epidemic situation that Brazil occurs, local health authority finds that zika virus infects and Ji Lanbalei is comprehensive in general public
Levying and risen simultaneously, lucky blue barre syndrome case is being increased sharply and latent between zika virus infection by current research worker
But the most unconfirmed contact study.Additionally increasing evidence shows to have between zika virus and microcephaly pass
Connection.In May, 2015, the first zika virus disease case of Brazil's report, October in the same year, Brazil's report neonate microcephalus substantially on
Rising, spatial and temporal distributions matches with zika virus Endemic Area.But, can preferably explain baby's microcephaly and zika virus it
Between relation before remain a need for making more investigation, at present other cause of disease also may carried out investigation further.
Zika virus belongs to flaviviridae (Flaviviridae) Flavivirus (Flavivirus), for single stranded positive-sense RNA
Virus, full-length genome about 10.8kb.Zika virus particle is spherical in shape, diameter about 40-70nm.Molecular biology and bio information
Credit analysis shows, zika virus is primarily present Africa type and two hypotypes of Asian type, on phylogenetic tree be all banzi virus
The dengue virus, Japanese encephalitis virus and the west nile virus that belong to are close.Zika virus genome only one of which opening code-reading frame
(open reading frame, ORF), coded amyloid protein precursor cuts into different through host protein enzyme and virus protease
Functional protein, including 3 structural protein (C, prM/M, E) and 7 non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A,
NS4B、NS5)。
First case Introduced cases zika virus is made a definite diagnosis by February 9th, 2016, national health and circular China of Family Planning Committee
Cases of infection, hereafter have report to occur during Introduced cases cases of infection, China is described, and for the prevention and control of zika virus, the situation is tense.Mesh
Before also not for the RT-Nested PCR detection method of zika virus.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of high specificity, highly sensitive and reproducible nido RT-
The method of PCR detection zika virus, present invention also offers the specificity for the method good, highly sensitive and reproducible
Two groups of primers to the test kit containing these two groups of primers pair and application.
First aspect present invention provides two groups of primers pair, and one of which primer is to comprising SEQ ID NO:1 and SEQ ID
Nucleotide sequence shown in NO:2, another group primer is to comprising the nucleotides sequence shown in SEQ ID NO:3 and SEQ ID NO:4
Row.
Second aspect present invention provides described two group primer to the application in the product of preparation detection zika virus.
In a preference, the product of described detection zika virus also includes PCR amplifing reagent.
Third aspect present invention provides a kind of test kit, including two groups of described primers pair.
In a preference, also include PCR amplifing reagent.
In a preference, described PCR amplifing reagent includes the TaKaRa that article No. is RR019A from TaKaRa company
5 × PCR Buffer that RNA PCR Kit Ver.3.0 test kit is comprised and Ex Taq HS archaeal dna polymerase.
In a preference, also include positive control and negative control.
In a preference, also include that RNA extracts reagent.
In a preference, described RNA extracts reagent and includes the QIAamp that article No. is 52904 from QIAGEN company
Viral RNA Mini Kit RNA extracts the reagent that test kit is comprised.
In a preference, also include reverse transcription reagents.
In a preference, described reverse transcription reagents includes the TaKaRa that article No. is RR019A from TaKaRa company
The reagent that RNA PCR Kit (AMV) Ver.3.0 test kit is comprised.
In a preference, the described article No. from TaKaRa company is the TaKaRa RNA PCR Kit of RR019A
(AMV) reagent that Ver.3.0 test kit is comprised is MgCl2、dNTP Mixture、RNase Inhibitor、AMV
Reverse Transcriptase XL, Random 9mers and RNase Free dH2At least one in O.
Fourth aspect present invention provides the application in the product of preparation detection zika virus of the described test kit.
Fifth aspect present invention provides a kind of screening and is susceptible to suffer from the system of the sick biological sample of zika virus, including:
Nucleic acid-extracting apparatus, described nucleic acid-extracting apparatus is for extracting the sample of nucleic acid in described biological sample；
RT-Nested PCR device, described RT-Nested PCR is connected with described nucleic acid-extracting apparatus, it is adaptable to use right to want
Ask two groups of primers described in 1 that described sample of nucleic acid is carried out RT-Nested PCR reaction；And
Judgment means, described judgment means is connected with described RT-Nested PCR device, in order to react based on RT-Nested PCR
Result, it is judged that it is sick whether described biological sample is susceptible to suffer from zika virus.
In a preference, described nucleic acid-extracting apparatus farther includes:
RNA extraction unit, described RNA extraction unit is for extracting RNA sample from biological sample；And
Reverse transcription unit, described reverse transcription unit is connected with described RNA extraction unit, for carrying out described RNA sample
Reverse transcription reaction, in order to obtain cDNA sample, described cDNA sample constitutes described sample of nucleic acid.
In a preference, described biological sample is to include the blood of DNA and/or RNA, cell or tissue, or is matter
Grain, or be DNA, cDNA, mRNA or cDNA fragment, or be the reagent containing DNA, cDNA, mRNA or cDNA fragment.
In a preference, when biological sample is DNA, cDNA or cDNA fragment, or it is containing DNA, cDNA or cDNA sheet
The reagent of section, or when be plasmid, by its directly as sample of nucleic acid and described two groups of primers to carrying out RT-Nested PCR reaction.
In a preference, when biological sample is the blood containing DNA and/or RNA, urine, cell or tissue, or it is
MRNA, or when being the reagent containing mRNA, be translated into the sample of nucleic acid of DNA, cDNA or cDNA fragment again with described two groups
Primer is to carrying out RT-Nested PCR reaction.
In a preference, the reaction system of described RT-Nested PCR reaction is as follows:
First round reaction system:
5×PCR Buffer 10μL
Ex Taq HS archaeal dna polymerase 0.25 μ L
Primer is 10 μMs to SEQ ID NO:1 and SEQ ID NO:2 concentration, each 0.5 μ L
DNA or cDNA or cDNA fragment 1 × 103-1×109Copy/μ L, 2 μ L
Adding nuclease free water to total reaction volume is 50 μ L；Obtain the PCR primer of RT-Nested PCR first round reaction；
Second takes turns reaction system:
5×PCR Buffer 10μL
Ex Taq HS archaeal dna polymerase 0.25 μ L,
Primer is 10 μMs to SEQ ID NO:3 and SEQ ID NO:4 concentration, each 0.5 μ L
The PCR primer 1 μ L of RT-Nested PCR first round reaction
Adding nuclease free water to total reaction volume is 50 μ L；
It is RR019A that described 5 × PCR Buffer and Ex Taq HS archaeal dna polymerase derive from the article No. of TaKaRa company
TaKaRa RNA PCR Kit (AMV) Ver.3.0 test kit.
In a preference, the program of reaction of the described first round is as follows: 94 DEG C of 45s, 50 DEG C of 45s, 72 DEG C of 1min, 35 are followed
Ring；Described second to take turns the program of reaction as follows: 94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 1min, 35 circulations.
The method have the advantages that:
(1) primer specificity that the present invention is directed to zika virus design is good, highly sensitive and reproducible.
(2) the RT-Nested PCR method of the zika virus that the present invention sets up, can carry out qualitative detection to zika virus.
(3) the RT-Nested PCR method of the zika virus that the present invention sets up is particularly well-suited to the detection of clinical sample, its inspection
The sensitivity surveyed can reach 1 × 103The viruses molecule of copy/μ L, operation is simple, and result is stable, faces the zika virus of China
Bed quick diagnosis and public prevention and control all have great importance.
Accompanying drawing explanation
Fig. 1 is two groups of primers of the present invention to, test kit and the detection method RT-Nested PCR specificity to zika virus
The agarose gel electrophoresis figure of checking, has eight swimming lanes: wherein M is marker DL2000, and 1 for inserting ZIKV E protein base
The RT-Nested PCR amplified production compareed because of the positive plasmid of cDNA, 2 is the RT-Nested PCR amplified production of ZIKV1, and 3 are
The RT-Nested PCR amplified production of ZIKV2,4 is the RT-Nested PCR amplified production of dengue virus, and 5 is Chikungunya virus
RT-Nested PCR amplified production；6 is the RT-Nested PCR amplified production of banzi virus；7 for using nuclease free water as negative control
RT-Nested PCR amplified production.
Fig. 2 is two groups of primers of the present invention to, test kit and the detection method RT-Nested PCR susceptiveness to zika virus
The agarose gel electrophoresis figure of checking, has 11 swimming lanes: wherein M is marker DL2000, and 1-9 is respectively concentration successively
It is 1 × 109Copy/μ L, 1 × 108Copy/μ L, 1 × 107Copy/μ L, 1 × 106Copy/μ L, 1 × 105Copy/μ L, 1 × 104
Copy/μ L, 1 × 103Copy/μ L, 1 × 102Copy/μ L and 1 × 101The plasmid of copy/μ L, 10 is nuclease free water negative control.
Fig. 3 is that the agarose of the susceptiveness checking that the RT-PCR for zika virus is reacted by first group of primer of the present invention coagulates
Gel electrophoresis figure, has 11 swimming lanes: wherein M is marker DL2000, and 1-9 respectively concentration is followed successively by 1 × 109Copy/μ
L、1×108Copy/μ L, 1 × 107Copy/μ L, 1 × 106Copy/μ L, 1 × 105Copy/μ L, 1 × 104Copy/μ L, 1 × 103
Copy/μ L, 1 × 102Copy/μ L and 1 × 101The plasmid of copy/μ L, 10 is nuclease free water negative control.
Detailed description of the invention
Unless specifically indicated, the general sense during term used herein has art of the present invention.
Below with reference to specific embodiments and the drawings, the present invention will be described, it should be noted that these embodiments are only
It is illustrative, and is not considered as limiting the invention.Unreceipted concrete technology or condition in embodiment, according to ability
The technology described by document or condition in territory or carry out according to product description.Agents useful for same or the unreceipted factory of instrument
Shang Zhe, be can by city available from conventional products.
Embodiment 1
Present embodiments provide a kind of two groups of primers detecting zika virus to and application.
The design of two groups of primers pair: utilize existing 71 ZIKV whole genome sequences in GenBank to carry out multisequencing ratio
Right, select the conservative region (536bp, SEQ.ID.No.5) of ZIKV envelope protein (envelope protein) as target sequence
Design two groups of primers pair.
The particular sequence of two groups of primers pair is as shown in table 1:
Table 1
In table 1, ZIKV/1st/F represents the forward primer of RT-Nested PCR first round reaction, and ZIKV/1st/R represents nido
The downstream primer that the RT-PCR first round reacts, ZIKV/2nd/F represents RT-Nested PCR second and takes turns the forward primer of reaction, ZIKV/
2nd/R represents RT-Nested PCR second and takes turns the downstream primer of reaction.M in primer sequence represents A or C, R and represents A or G, Y representative
C or T, S represent C or G.
The particular sequence of described SEQ.ID.No.5 is:
acaggccttgacttttcagatttgtattacttgactatgaataacaagcactggttggttcacaaggagtggttcca
cgacattccattaccttggcacgctggggcagacaccggaactccacactggaacaacaaagaagcactggtagagt
tcaaggacgcacatgccaaaaggcaaactgtcgtggttctagggagtcaagaaggagcagttcacacggcccttgct
ggagctctggaggctgagatggatggtgcaaagggaaggctgtcctctggccacttgaaatgtcgcctgaaaatgga
taaacttagattgaagggcgtgtcatactccttgtgtaccgcagcgttcacattcaccaagatcccggctgaaacac
tgcacgggacagtcacagtggaggtacagtacgcagggacagatggaccttgcaaggttccagctcagatggcggtg
gacatgcaaactctgaccccagttgggaggttgataaccgctaaccccgtaatcactgaaagcactgagaactc
Above-mentioned two groups of primers synthesize by Shanghai Sheng Gong biological engineering company limited.
The above-mentioned two groups of primers product to can be applicable at preparation detection zika virus, the product of described detection zika virus
Also include PCR amplifing reagent.
Embodiment 2
Present embodiments providing a kind of test kit and application thereof, described test kit includes:
(1) two groups of primers pair of embodiment 1；
(2) PCR amplifing reagent.
Described PCR amplifing reagent includes the TaKaRa RNA PCR that article No. is RR019A from TaKaRa company
5 × PCR Buffer that KitVer.3.0 test kit is comprised and Ex Taq HS archaeal dna polymerase.
It is demonstrated experimentally that above-mentioned PCR amplifing reagent and two groups of primers are to being used in combination, effect is more superior, concrete manifestation
In favorable repeatability, high specificity, highly sensitive feature.
Described test kit can further include:
(3) positive control and negative control；
(4) RNA extracts reagent；
(5) reverse transcription reagents.
Described positive control is to insert the ZIKV E protein gene cDNA of synthetic (the raw work biological engineering share in Shanghai has
Limit company synthesize) plasmid.
Described RNA extracts reagent and includes the QIAamp Viral RNA Mini that article No. is 52904 from QIAGEN company
Kit RNA extracts the reagent that test kit is comprised；Described reverse transcription reagents include from the article No. of TaKaRa company be RR019A
The reagent that comprised of TaKaRa RNA PCR Kit (AMV) Ver.3.0 test kit, such as MgCl2、dNTP Mixture、
RNase Inhibitor、AMV Reverse Transcriptase XL、Random 9mers、RNase Free dH2O。
Mentioned reagent box can be applicable to detect zika virus.
Embodiment 3
Present embodiments provide a kind of method detecting zika virus, such as in detection biological sample, zika virus deposits
, the method use two groups of primers of embodiment 1 to and the test kit of embodiment 2.
Above-mentioned biological sample is to include the blood of DNA and/or RNA, urine, cell or tissue, or is plasmid, or is
DNA, cDNA, mRNA or cDNA fragment, or be the reagent containing DNA, cDNA, mRNA or cDNA fragment.
When biological sample is DNA, cDNA or cDNA fragment, or it is the reagent containing DNA, cDNA or cDNA fragment, or is
During plasmid, by its directly as template and described two groups of primers to carrying out RT-Nested PCR reaction.
When biological sample is the blood containing DNA and/or RNA, cell or tissue, or it is mRNA, or is containing mRNA's
During reagent, be translated into DNA, cDNA or cDNA fragment again with described two groups of primers to carrying out RT-Nested PCR reaction.
The method of detection zika virus comprises the steps:
1. RT-Nested PCR amplified reaction
The RT-Nested PCR first round reacts: take the TaKaRa RNA PCR Kit that article No. is RR019A of TaKaRa company
5 × PCR Buffer 10 μ L, the Ex Taq HS archaeal dna polymerase 0.25 μ L that Ver.3.0 test kit is comprised, in embodiment 1
The each 0.5 μ L of ZIKV/1st/F and ZIKV/1st/R of 10 μMs, 2 μ L DNA or cDNA fragments (1 × 103-1×109Copy/μ L), add
Entering nuclease free water to total reaction volume is 50 μ L, sets negative control and positive control simultaneously, and negative control is deionized water, positive
Comparison, for inserting the plasmid of the ZIKV E protein gene cDNA of synthetic, carries out PCR amplification, and the program of described PCR amplification is such as
Under: 94 DEG C of 45s, 50 DEG C of 45s, 72 DEG C of 1min, 35 circulations, obtain RT-Nested PCR first round reaction PCR primer.
RT-Nested PCR second takes turns reaction: take the TaKaRa RNA PCR Kit that article No. is RR019A of TaKaRa company
(AMV) 5 × PCR Buffer 10 μ L, the Ex Taq HS archaeal dna polymerase 0.25 μ L that Ver.3.0 test kit is comprised, embodiment
The each 0.5 μ L of ZIKV/2nd/F and ZIKV/2nd/R of 10 μMs in 1, the 1 μ L RT-Nested PCR first round reacted PCR primer, added
Nuclease free water to total reaction volume is 50 μ L, sets negative control and positive control simultaneously, and negative control is deionized water, positive right
According to the plasmid of the ZIKV E protein gene cDNA for inserting synthetic, carrying out PCR amplification, the program of described PCR amplification is as follows:
94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 1min, 35 circulations, obtain RT-Nested PCR second and take turns reaction PCR primer.
2. judge the existence of zika virus in biological sample
Take 3 μ L RT-Nested PCR second to take turns the PCR primer of reaction and carry out agarose electrophoretic analysis, on gel imaging system
Observed result.
The standard that the result of described RT-Nested PCR amplification judges is:
If the RT-Nested PCR amplified production that the amplification of described RT-Nested PCR obtains contains the fragment that size is about 355bp,
Represent containing zika virus in biological sample, for the positive；If the RT-Nested PCR amplification that the amplification of described RT-Nested PCR obtains is produced
Thing does not contains the fragment that size is about 355bp, represents and does not contains zika virus in biological sample, for feminine gender.
If above-mentioned biological sample is also not converted into DNA, cDNA or cDNA fragment, said method step 1 RT-Nested PCR
The QIAamp Viral RNA Mini Kit that article No. is 52904 using QIAGEN company can also be included before amplified reaction
RNA in biological sample is extracted by the reagent that RNA extracts in test kit according to test kit description, and with from
The reagent pair that TaKaRa RNA PCR Kit (AMV) the Ver.3.0 test kit that the article No. of TaKaRa company is RR019A is comprised
The RNA extracted carries out the step of reverse transcription.
Embodiment 4
The detection method of, the test kit of embodiment 2 and embodiment 3 is entered by the present embodiment by two groups of primers of embodiment 1
Go effectiveness or reliability demonstration, specifically include following steps:
1. prepared by sample
Material to be tested used is as follows: the serum of two example Introduced cases ZIKV the infecteds (is all from Chinese Academy of Sciences's microorganism
Institute) and the serum of 20 parts of clinic doubtful low grade fever patients (from the blood routine examination of clinical laboratory of The Third People's Hospital of Shenzhen
Rear remaining blood sample, " doubtful " represent suspect for ZIKV the infected but after testing after be ZIKV the infected), use
The article No. of QIAGEN company be 52904 the QIAamp Viral RNA Mini Kit RNA reagent that extracts in test kit according to
Test kit description carries out RNA extraction, then the RNA extracted is carried out reverse transcription, and reverse transcription uses the article No. of TaKaRa company
Carry out to specifications for the reagent in TaKaRa RNA PCR Kit (AMV) the Ver.3.0 test kit of RR019A, reverse transcription body
It is as follows:
Wherein MgCl2、dNTP Mixture、RNase Inhibitor、AMV Reverse Transcriptase XL、
Random 9mers、RNase Free dH2O is all from the TaKaRa RNA PCR that article No. is RR019A of TaKaRa company
Kit (AMV) Ver.3.0 test kit.Described reverse transcription reaction condition is as follows: 42 DEG C of reaction 30min, 95 DEG C of 5min terminate reaction；
CDNA is obtained after reverse transcription.
2. RT-Nested PCR amplified reaction
The RT-Nested PCR first round reacts: take the TaKaRa RNA PCR Kit that article No. is RR019A of TaKaRa company
(AMV) 5 × PCR Buffer 10 μ L, the Ex Taq HS archaeal dna polymerase 0.25 μ L that Ver.3.0 test kit is comprised, embodiment
The each 0.5 μ L of ZIKV/1st/F and ZIKV/1st/R, the cDNA that 2 μ L steps 1 obtain of 10 μMs in 1, adds nuclease free water to always
Reaction volume is 50 μ L, sets negative control and positive control simultaneously, and negative control is deionized water, and positive control is artificial for inserting
The plasmid of the ZIKV E protein gene cDNA of synthesis, carries out PCR amplification, obtains the PCR primer of RT-Nested PCR first round reaction,
The program of described PCR amplification is as follows: 94 DEG C of 45s, 50 DEG C of 45s, 72 DEG C of 1min, 35 circulations.
RT-Nested PCR second takes turns reaction: take the TaKaRa RNA PCR Kit that article No. is RR019A of TaKaRa company
(AMV) 5 × PCR Buffer 10 μ L, the Ex Taq HS archaeal dna polymerase 0.25 μ L that Ver.3.0 test kit is comprised, embodiment
(PCR of RT-Nested PCR first round reaction produces each 0.5 μ L of ZIKV/2nd/F and ZIKV/2nd/R, 1 μ L DNA of 10 μMs in 1
Thing, i.e. target sequence), adding nuclease free water to total reaction volume is 50 μ L.Set negative control and positive control, negative control simultaneously
For deionized water, positive control is the plasmid of the ZIKV E protein gene cDNA inserting synthetic, carries out PCR amplification, described
The program of PCR amplification is as follows: 94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 1min, 35 circulations.
3. judge the existence of zika virus in biological sample
Take 3 μ L RT-Nested PCR second to take turns the PCR primer of reaction and carry out agarose electrophoretic analysis, on gel imaging system
Observed result.
Result shows plasmid positive control and two examples ZIKV of the ZIKV E protein gene cDNA only inserting synthetic
The serum of the infected may detect that ZIKV, and remaining 20 parts of doubtful sample of clinic and negative control are all not detected by
ZIKV, illustrates that involved in the present invention two group primer is reliable to the detection method of, the test kit of embodiment 2 and embodiment 3
And it is effective.
Embodiment 5
The detection method of, the test kit of embodiment 2 and embodiment 3 is entered by the present embodiment by two groups of primers of embodiment 1
Go specificity verification, specifically include following steps:
1. prepared by sample
Material to be tested used is as follows: two strain ZIKV and a strain dengue virus live virus (derive from the Chinese Academy of Sciences
Institute of microbiology), ZIKV positive control is cDNA (the raw work biological engineering share in Shanghai of synthetic ZIKV E protein gene
Company limited), the Genomic full_length cDNA of synthetic Chikungunya virus or banzi virus detects for primer specificity, synthesis
CDNA through clone be saved in respectively carrier T (Promega company article No. A3610's-T Vector System II)
In.
Extract in test kit with the QIAamp Viral RNA Mini Kit RNA that article No. is 52904 of QIAGEN company
Reagent according to test kit description extract RNA, then to extract RNA carry out reverse transcription, reverse transcription is according to TaKaRa company
TaKaRa RNA PCR Kit (AMV) the Ver.3.0 test kit description that article No. is RR019A carry out, reverse transcription system is such as
Under:
Wherein MgCl2、dNTP Mixture、RNase Inhibitor、AMV Reverse Transcriptase XL、
Random 9mers、RNase Free dH2O is all from the TaKaRa RNA PCR that article No. is RR019A of TaKaRa company
Kit (AMV) Ver.3.0 test kit.
The reaction condition of described reverse transcription is as follows: 42 DEG C of reaction 30min, 95 DEG C of 5min terminate reaction；Obtain after reverse transcription
cDNA。
2. RT-Nested PCR amplified reaction
The RT-Nested PCR first round reacts: take the TaKaRa RNA PCR Kit that article No. is RR019A of TaKaRa company
(AMV) 5 × PCR Buffer 10 μ L, the Ex Taq HS archaeal dna polymerase 0.25 μ L that Ver.3.0 test kit is comprised, embodiment
The each 0.5 μ L of ZIKV/1st/F and ZIKV/1st/R, the cDNA that 2 μ L steps 1 obtain of 10 μMs in 1, adds nuclease free water to always
Reaction volume is 50 μ L, sets negative control and positive control simultaneously, and negative control is deionized water, and positive control is artificial for inserting
The plasmid of the ZIKV E protein gene cDNA of synthesis, carries out PCR amplification, obtains PCR primer, and the program of described PCR amplification is as follows:
94 DEG C of 45s, 50 DEG C of 45s, 72 DEG C of 1min, 35 circulations.
RT-Nested PCR second takes turns reaction: take the TaKaRa RNA PCR Kit that article No. is RR019A of TaKaRa company
(AMV) 5 × PCR Buffer 10 μ L, the Ex Taq HS archaeal dna polymerase 0.25 μ L that Ver.3.0 test kit is comprised, embodiment
(reaction of the RT-Nested PCR first round obtains each 0.5 μ L of ZIKV/2nd/F and ZIKV/2nd/R, 1 μ L DNA of 10 μMs in 1
PCR primer, i.e. target sequence), adding nuclease free water to total reaction volume is 50 μ L.Set negative control and positive control simultaneously, cloudy
Property comparison for deionized water, positive control is the plasmid of the ZIKV E protein gene cDNA inserting synthetic, carries out PCR expansion
Increasing, the program of described PCR amplification is as follows: 94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 1min, 35 circulations.
3. judge the existence of zika virus in biological sample
Take 3 μ L RT-Nested PCR second to take turns the PCR primer of reaction and carry out agarose electrophoretic analysis.On gel imaging system
Observed result.
Result is as it is shown in figure 1, it can be seen that only ZIKV positive control and the nido of two strain ZIKV serum samples
RT-PCR or RT-Nested PCR amplified production have band at about 355bp, can specifically be expanded, are all positive；And step on
Leather fever virus, Chikungunya virus, banzi virus and the RT-Nested PCR of negative control or RT-Nested PCR amplified production are about
All without band at 355bp, it is impossible to specifically expanded, be all negative.Thus prove two groups of primers of the embodiment of the present invention 1
, the test kit of embodiment 2 is respectively provided with high specific；Further, present invention primer based on embodiment 1 and embodiment 2
Zika virus can be detected by detection method that test kit is set up accurately.
Embodiment 6
The detection method of, the test kit of embodiment 2 and embodiment 3 is entered by the present embodiment by two groups of primers of embodiment 1
Go susceptiveness checking, specifically include following steps:
1. preparation of samples
By SEQ.ID.No.5 (nido first round PCR primer) insert carrier T (Promega company article No. A3610's-T Vector System II) build plasmid, constructed plasmid is carried out 10 times of dilutions, altogether 8 gradients,
Making its concentration is 1 × 109-1×101Copy/μ L.
2. RT-Nested PCR amplified reaction
With above-mentioned sample as template, carry out RT-Nested PCR amplified reaction, the method for RT-Nested PCR amplified reaction and bar
Part is with embodiment 5.
Result is as in figure 2 it is shown, the least concentration that RT-Nested PCR detection method designed by the present invention can detect is 1
×103Copy every microlitre.And only directly carry out conventional RT-PCR amplification with ZIKV/1st/F and ZIKV/1st/R and (the most only carry out nest
The formula RT-PCR first round reacts), the least concentration that can detect is 1 × 105Copy/μ L, result is as shown in Figure 3.More than tie
Fruit explanation RT-Nested PCR detection method designed by the present invention highly sensitive 100 times than conventional RT-PCR.
Claims (10)
1. liang group primer pair, it is characterised in that one of which primer is to comprising shown in SEQ ID NO:1 and SEQ ID NO:2
Nucleotide sequence, another group primer is to comprising the nucleotide sequence shown in SEQ ID NO:3 and SEQ ID NO:4.
Two groups of primers the most according to claim 1 are to the application in the product of preparation detection zika virus；
Optional, the product of described detection zika virus also includes PCR amplifing reagent.
3. a test kit, it is characterised in that include two groups of primers pair described in claim 1.
Test kit the most according to claim 3, it is characterised in that: also include PCR amplifing reagent；
Described PCR amplifing reagent includes the TaKaRa RNA PCR Kit that article No. is RR019A from TaKaRa company
5 × PCR Buffer that Ver.3.0 test kit is comprised and Ex Taq HS archaeal dna polymerase；
Optional, also include positive control and negative control；
Optional, also include that RNA extracts reagent；
Optional, described RNA extracts reagent and includes and from the article No. of QIAGEN company is
The QIAamp Viral RNA Mini Kit RNA of 52904 extracts the reagent that test kit is comprised；
Optional, also include reverse transcription reagents；
Optional, described reverse transcription reagents includes the TaKaRa RNA PCR Kit that article No. is RR019A from TaKaRa company
(AMV) reagent that Ver.3.0 test kit is comprised；
Optional, the described article No. from TaKaRa company is TaKaRa RNA PCR Kit (AMV) the Ver.3.0 examination of RR019A
The reagent that agent box is comprised is MgCl2、dNTP Mixture、RNase Inhibitor、AMV Reverse
Transcriptase XL, Random 9mers and RNaseFree dH2At least one in O.
5. the application in the product of preparation detection zika virus of the test kit described in claim 4.
6. a screening is susceptible to suffer from the system of the sick biological sample of zika virus, it is characterised in that including:
Nucleic acid-extracting apparatus, described nucleic acid-extracting apparatus is for extracting the sample of nucleic acid in described biological sample；
RT-Nested PCR device, described RT-Nested PCR is connected with described nucleic acid-extracting apparatus, it is adaptable to use claim 1 institute
The two groups of primers stated carry out RT-Nested PCR reaction to described sample of nucleic acid；And
Judgment means, described judgment means is connected with described RT-Nested PCR device, in order to knot based on RT-Nested PCR reaction
Really, it is judged that it is sick whether described biological sample is susceptible to suffer from zika virus.
System the most according to claim 6, it is characterised in that described nucleic acid-extracting apparatus farther includes:
RNA extraction unit, described RNA extraction unit is for extracting RNA sample from biological sample；And reverse transcription unit, institute
State reverse transcription unit to be connected with described RNA extraction unit, for described RNA sample is carried out reverse transcription reaction, in order to obtain
CDNA sample, described cDNA sample constitutes described sample of nucleic acid.
System the most according to claim 7, it is characterised in that described biological sample is the blood including DNA and/or RNA
Liquid, cell or tissue, or be plasmid, or be DNA, cDNA, mRNA or cDNA fragment, or be containing DNA, cDNA, mRNA or
The reagent of cDNA fragment；
Optional, when biological sample is DNA, cDNA or cDNA fragment, or it is the reagent containing DNA, cDNA or cDNA fragment, or
During for plasmid, by its directly as sample of nucleic acid and described two groups of primers to carrying out RT-Nested PCR reaction；
Optional, when biological sample is the blood containing DNA and/or RNA, urine, cell or tissue, or it is mRNA, or for containing
When having the reagent of mRNA, be translated into the sample of nucleic acid of DNA, cDNA or cDNA fragment again with described two groups of primers to carrying out nest
Formula RT-PCR is reacted.
System the most according to claim 8, it is characterised in that:
The reaction system of described RT-Nested PCR reaction is as follows:
First round reaction system:
5×PCR Buffer 10μL
Ex Taq HS archaeal dna polymerase 0.25 μ L
Primer is 10 μMs to SEQ ID NO:1 and SEQ ID NO:2 concentration, each 0.5 μ L
DNA or cDNA or cDNA fragment 1 × 103-1×109Copy/μ L, 2 μ L
Adding nuclease free water to total reaction volume is 50 μ L；Obtain the PCR primer of RT-Nested PCR first round reaction；
Second takes turns reaction system:
5×PCR Buffer 10μL
Ex Taq HS archaeal dna polymerase 0.25 μ L,
Primer is 10 μMs to SEQ ID NO:3 and SEQ ID NO:4 concentration, each 0.5 μ L
The PCR primer 1 μ L of RT-Nested PCR first round reaction
Adding nuclease free water to total reaction volume is 50 μ L；
It is RR019A's that described 5 × PCR Buffer and Ex Taq HS archaeal dna polymerase derive from the article No. of TaKaRa company
TaKaRa RNA PCR Kit (AMV) Ver.3.0 test kit.
System the most according to claim 9, it is characterised in that: the program of reaction of the described first round is as follows: 94 DEG C of 45s, and 50
DEG C 45s, 72 DEG C of 1min, 35 circulations；
Described second to take turns the program of reaction as follows: 94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 1min, 35 circulations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610353475.8A CN105861753A (en) | 2016-05-25 | 2016-05-25 | Nested RT-PCR method, primers and reagent kit for detecting Zika virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610353475.8A CN105861753A (en) | 2016-05-25 | 2016-05-25 | Nested RT-PCR method, primers and reagent kit for detecting Zika virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105861753A true CN105861753A (en) | 2016-08-17 |
Family
ID=56635836
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610353475.8A Pending CN105861753A (en) | 2016-05-25 | 2016-05-25 | Nested RT-PCR method, primers and reagent kit for detecting Zika virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105861753A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106282410A (en) * | 2016-08-31 | 2017-01-04 | 南方医科大学 | A kind of zika virus specific detection target sequence, plasmid control molecule and detection kit thereof |
| CN108611437A (en) * | 2017-12-25 | 2018-10-02 | 深圳市第三人民医院 | A kind of primer sets and kit detecting zika virus based on one-step method fluorescent quantitation RT-Nested PCR |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103476928A (en) * | 2010-12-09 | 2013-12-25 | 巴斯德研究所 | MGMT-based method for obtaining high yield of recombinant protein expression |
| CN105506188A (en) * | 2016-02-23 | 2016-04-20 | 深圳市易瑞生物技术有限公司 | Fluorescent RT-PCR (reverse transcription-polymerase chain reaction) primer, fluorescent probe, kit and method for detecting Asia-type Zika viruses |
-
2016
- 2016-05-25 CN CN201610353475.8A patent/CN105861753A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103476928A (en) * | 2010-12-09 | 2013-12-25 | 巴斯德研究所 | MGMT-based method for obtaining high yield of recombinant protein expression |
| CN105506188A (en) * | 2016-02-23 | 2016-04-20 | 深圳市易瑞生物技术有限公司 | Fluorescent RT-PCR (reverse transcription-polymerase chain reaction) primer, fluorescent probe, kit and method for detecting Asia-type Zika viruses |
Non-Patent Citations (2)
| Title |
|---|
| KUNO,G.ET AL: "ZIKA virus strain MR766,complete genome", 《GENBANK:AY632535.2》 * |
| OUMAR FAYE,ET AL: "One-step RT-PCR for detection of Zika virus", 《JOURNAL OF CLINICAL VIROLOGY》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106282410A (en) * | 2016-08-31 | 2017-01-04 | 南方医科大学 | A kind of zika virus specific detection target sequence, plasmid control molecule and detection kit thereof |
| CN106282410B (en) * | 2016-08-31 | 2020-05-05 | 南方医科大学 | Zika virus specificity detection target sequence, plasmid standard molecule and detection kit thereof |
| CN108611437A (en) * | 2017-12-25 | 2018-10-02 | 深圳市第三人民医院 | A kind of primer sets and kit detecting zika virus based on one-step method fluorescent quantitation RT-Nested PCR |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Duong et al. | Zika virus in Asia | |
| Pessôa et al. | Investigation into an outbreak of dengue-like illness in Pernambuco, Brazil, revealed a cocirculation of Zika, Chikungunya, and dengue virus type 1 | |
| Postel et al. | High abundance and genetic variability of atypical porcine pestivirus in pigs from Europe and Asia | |
| Bakonyi et al. | Novel flavivirus or new lineage of West Nile virus, central Europe | |
| CN105838713A (en) | Method for detecting fluorogenic quantitative PCR of Zika virus, primers and kit | |
| CN106367533B (en) | For detecting the nucleic acid, real-time fluorescence RPA kit and method of zika virus | |
| Sudiro et al. | Rapid diagnosis of dengue viremia by reverse transcriptase-polymerase chain reaction using 3'-noncoding region universal primers | |
| CN108330210B (en) | Zika virus, dengue virus and chikungunya virus nucleic acid detection kit and application thereof | |
| Chow et al. | Use of NS 3 consensus primers for the polymerase chain reaction amplification and sequencing of dengue viruses and other Flaviviruses | |
| Mishra et al. | Utility of multiplex reverse transcriptase-polymerase chain reaction for diagnosis and serotypic characterization of dengue and chikungunya viruses in clinical samples | |
| Cao et al. | Visual detection of West Nile virus using reverse transcription loop-mediated isothermal amplification combined with a vertical flow visualization strip | |
| CN105734171A (en) | Zika virus fluorescent PCR detecting kit | |
| CN107557493B (en) | A kind of enterovirus parting detecting reagent | |
| CN110305985B (en) | Method for detecting Zika virus, chikungunya virus and Mayaro virus by utilizing triple real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) | |
| Fischer et al. | Lineage-specific real-time RT-PCR for yellow fever virus outbreak surveillance, Brazil | |
| CN105936946A (en) | One step method inverse transcription PCR kit for detecting and differentiating Zika viruses and detection method thereof | |
| CN104513865A (en) | Kit and detection method for inverse transcription PCR detection of chikungunya virus | |
| CN107151711A (en) | A kind of double fluorescent quantitative RT PCR kits for detecting dengue virus and zika virus | |
| CN107619885A (en) | A kind of fluorescence RT RAA primers, probe and detection method for being used to detect dengue virus | |
| CN103305633B (en) | Multiplex-fluorescence PCR (Polymerase Chain Reaction) detection kit and application thereof | |
| CN105886663A (en) | Locked nucleic acid sensitivity-enhanced fluorescent quantitative PCR (polymerase chain reaction) detection reagent kit for wild strains of porcine pseudorabies viruses | |
| CN105861753A (en) | Nested RT-PCR method, primers and reagent kit for detecting Zika virus | |
| CN104212914B (en) | The heavy quick super quick detection kit of fluorescent PCR of Ebola five and application thereof | |
| CN107400735A (en) | Detect the real-time fluorescent quantitative RT-PCR method of zika virus | |
| CN106868217A (en) | A kind of detection primer of zika virus and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160817 |
|
| RJ01 | Rejection of invention patent application after publication |