CN105861699A - Multiple relative real-time fluorescent quantitative PCR detection kit for rapidly detecting number of human chromosomes - Google Patents
Multiple relative real-time fluorescent quantitative PCR detection kit for rapidly detecting number of human chromosomes Download PDFInfo
- Publication number
- CN105861699A CN105861699A CN201610320505.5A CN201610320505A CN105861699A CN 105861699 A CN105861699 A CN 105861699A CN 201610320505 A CN201610320505 A CN 201610320505A CN 105861699 A CN105861699 A CN 105861699A
- Authority
- CN
- China
- Prior art keywords
- chromosome
- sequence
- seq
- probe
- special
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a multiple relative real-time fluorescent quantitative PCR detection kit for rapidly detecting the number of human chromosomes. The kit comprises two reaction tubes of a group A reaction system and a group B reaction system, wherein the group A reaction system comprises two pairs of primers and four Taqman probes which are used for detecting repetitive sequences between chromosomes 21 and 18 and repetitive sequences between chromosomes 13 and 1, and are mainly used for detecting the number of chromosomes 13, 18 and 21; the group B reaction system comprises two pairs of primers and four Taqman probes which are used for detecting repetitive sequences between chromosomes 16 and X and repetitive sequences between chromosomes 1 and Y, and are mainly used for detecting the number of chromosomes X and Y. The kit disclosed by the invention is capable of respectively detecting the number of the chromosomes 13, 18, 21, X and Y simultaneously and independently; the results are accurate and reliable; the kit has high sensitivity and specificity.
Description
Technical field
The present invention relates to technical field of medical detection, be specifically related to the multiplephase pair of a kind of quick detection human chromosome number
Real-time fluorescence quantitative PCR detection kit.
Background technology
The disease that chromosome disease mainly causes because of number or the textural anomaly of chromosome, the most often can cause miscarriage,
Stillborn fetus, early die young, the generation of the disease such as congenital mental retardation, growth are delayed, Poly-monstrosity and sexual infantilism.Clinically 21
Number, No. 18 and No. 13 trisomic syndromes most commonly seen, its sickness rate is respectively 1/700～1/800,1/3500～1/
8000 and 1/4000～1/10000.At present, such chromosomal disorders there is no effective Therapeutic Method, therefore, carries out antenatal in time
Diagnosis prevents the birth of infant from being the main method that prevention chromosomal disorders occur.
Amniotic fluid cell culture, chromosome karyotype analysis be prenatal diagnosis classical way (Caspersson T, Zech L,
Johansson C,et al.Identification of human chromosomes by DNA-binding
Fluorescent agents [J] .Chromosoma, 1970,30 (2): 215-227.), but, the method is it is generally required to two weeks
Above just can obtain testing result, be easily caused anemia of pregnant woman and great mental pressure bears in family.Fluorescence in situ hybridization
(FISH) technology is applied to antenatal quick diagnosis, it is not necessary to carry out cell cultivation, it is achieved that the quick diagnosis (Ho of chromosomal disorders
SSY,Chua C,Gole L,et al.Same-day prenatal diagnosis of common chromosomal
aneuploidies using microfluidics-fluorescence in situ hybridization[J]
.Prenatal Diagnosis, 2012,32 (4): 321-328.), but owing to this technical operation is loaded down with trivial details and requirement has good
Good technology specialty so that this technology can not the substantial amounts of application carrying out clinical samples.QF-PCR method based on STR
(Atef SH,Hafez S,Helmy S,et al.QF-PCR as a Rapid Technique for Routine
Prenatal Diagnosis of Fetal Aneuploidies[J].Pediatric Research,2011,70:412-
412.) and Multiplex ligation dependent probe amplification (MLPA) method achieve No. 21 with
And quick diagnosis (Slater HR, Bruno DL, Ren H, et al.Rapid, the high throughput of other chromosome
prenatal detection of aneuploidy using a novel quantitative method(MLPA)[J]
.Journal of medical genetics, 2003,40 (12): 907-912.), but such method needs the follow-up of product
The steps such as capillary electrophoresis analysis, complex operation and genetic analyzer that need to be expensive, be unfavorable for the wide popularization and application of method.
Real time fluorescence quantifying PCR method diagnosis aneuploid need not PCR post processing, has simplicity, quickly and at batch
The ability of reason.Research before mainly uses the specific gene between coloured differently body to diagnose, such as No. 21 chromosomes
Diagnosis (Zimmermann B, Holzgreve W, Wenzel F, et al.Novel real-time quantitative PCR
Test for trisomy 21 [J] .Clinical chemistry, 2002,48 (2): 362-363.), and No. 21 and No. 18
Diagnosis (Zimmermann B G, the Dudarewicz L.Real-time quantitative PCR for the of chromosome
detection of fetal aneuploidies[M].Prenatal Diagnosis.Humana Press,2008:95-
109).But, owing to using two primer expands different fragments, the change of the most small annealing temperature or DNA mass respectively
Difference all can cause false negative or false-positive result, thus cause result inaccuracy (Helmy SM, Ismail S,
Bassiouni R,et al.Sensitivity of DCSR3/GAPDH ratio using quantitative real-
time PCR in the rapid prenatal diagnosis for down syndrome[J].Fetal Diagn
Ther,2009,25(2):220-223.).To this end, the present inventor have developed the real-time fluorescence relative quantification PCR of repeated fragment
No. 21 chromosomes of method quick diagnosis (Rapid detection of Down's syndrome using quantitative
Real-time PCR (qPCR) targeting segmental duplications on chromosomes 21and 11),
Thus it is greatly improved stability and the reliability of qPCR detection.
In the research of early stage, the present inventor establishes grinding of qPCR rapid diagnosis of down syndrome based on repeated fragment
Study carefully, be also in the research of early stage, it has been found that relative quantification based on repeated fragment is highly stable, thus research establishes
A kind of single tube detects the single tube four color dual relative quantification PCR of the number of 4 chromosomes simultaneously.Research in theory and combining practice
During, we pass through human chromosomal gene database, develop a series of new repetitive sequence molecular marker, develop reality
The test kit that existing people No. 21, No. 18, No. 13, X and Y chromosome number quickly detect.
Summary of the invention
The technical problem to be solved in the present invention is to have filtered out a series of new repetitive sequence molecular marker, and therefore provides
The multiplephase of a kind of quick detection people No. 21, No. 18, No. 13, X and Y chromosome number is to real-time fluorescence quantitative PCR detection examination
Agent box.This test kit uses the detection system that two sets are independent, is used for detecting people No. 21, No. 18, No. 13, X and Y chromosome number knot
Fruit is accurate, reliable, and highly sensitive, high specificity.
The multiplephase of quick detection human chromosome number of the present invention to real-time fluorescence quantitative PCR detection kit,
Including A group reaction system and/or B group reaction system, wherein:
Augmentation detection reagent in described A group reaction system includes:
(1) expand No. 21 chromosome special repetitive sequence chr21's and No. 18 chromosome special repetitive sequence chr18 simultaneously
Primer pair, their base sequence is respectively as shown in SEQ ID NO:1 and SEQ ID NO:2；
(2) the Taqman probe chr21-Probe of No. 21 chromosome special repetitive sequence chr21 of specific detection, its alkali
Basic sequence is as shown in SEQ ID NO:3；
(3) the Taqman probe chr18-Probe of No. 18 chromosome special repetitive sequence chr18 of specific detection, its alkali
Basic sequence is as shown in SEQ ID NO:4；
(4) expand No. 13 chromosome special repetitive sequence chr13's and No. 1 chromosome special repetitive sequence chr1-1 simultaneously
Primer pair, their base sequence is respectively as shown in SEQ ID NO:5 and SEQ ID NO:6；
(5) the Taqman probe chr13-Probe of No. 13 chromosome special repetitive sequence chr13 of specific detection, its alkali
Basic sequence is as shown in SEQ ID NO:7；
(6) the Taqman probe chr1-1-Probe of No. 1 chromosome special repetitive sequence chr1-1 of specific detection, its alkali
Basic sequence is as shown in SEQ ID NO:8.
Augmentation detection reagent in described B group reaction system includes:
(1) expand the primer of No. 16 chromosome special repetitive sequence chr16 and X chromosome special repetitive sequence chrX simultaneously
Right, their base sequence is respectively as shown in SEQ ID NO:13 and SEQ ID NO:14；
(2) the Taqman probe chr16-Probe of No. 16 chromosome special repetitive sequence chr16 of specific detection, its alkali
Basic sequence is as shown in SEQ ID NO:15；
(3) the Taqman probe chrX-Probe of specific detection X chromosome special repetitive sequence chrX, its base sequence
As shown in SEQ ID NO:16；
(4) expand the primer of No. 1 chromosome special repetitive sequence chr1-2 and Y chromosome special repetitive sequence chrY simultaneously
Right, their base sequence is respectively as shown in SEQ ID NO:17 and SEQ ID NO:18；
(5) the Taqman probe chr1-2-Probe of No. 1 chromosome special repetitive sequence chr1-2 of specific detection, its alkali
Basic sequence is as shown in SEQ ID NO:19；
(6) the Taqman probe chrY-Probe of specific detection Y chromosome special repetitive sequence chrY, its base sequence
As shown in SEQ ID NO:20.
In technical solutions according to the invention, A group reaction system includes: repeat for No. 21 and No. 18 interchromosomals of detection
2 pairs of primers of chromosome repetitive sequence and 4 Taqman probes between sequence, No. 13 and No. 1, mainly for detection of No. 13,18
Number and the number of No. 21 chromosomes；B group reaction system includes: for repetitive sequence, No. 1 and Y dye between detection 16 and X chromosome
2 pairs of primers of repetitive sequence and 4 Taqman probes between colour solid, mainly for detection of X and the number of Y chromosome.The present invention
Described test kit is possible not only to realize No. 13, No. 18, No. 21, X and the detection of Y chromosome, meanwhile, also can realize No. 1 and
The aneuploid of No. 16 chromosomes carries out examination.
Owing to the number of chromosome is consistent with the distinguished sequence copy number on chromosome, and the copy number of chromosome sequence leads to
Cross the 2 of real-time fluorescence-△△CTConversion, therefore, by 2-△△CTIt is worth us and just can infer the copy number of detected sequence, and
Obtain the number of detected chromosome.
Although detection system be divide into A group reaction system and B group reaction system by technical scheme of the present invention, but
In actual application, the primer of every pair of repetitive sequence and probe are possible not only to be used alone, it is also possible to arbitrarily combination of two uses.
In the A group reaction system of technique scheme, described No. 21 chromosome special repetitive sequence chr21 and No. 18 dyeing
Body special repetitive sequence chr18 is two similar sequences, wherein, and the base sequence of No. 21 chromosome special repetitive sequence chr21
As shown in SEQ ID NO:9, the base sequence of No. 18 chromosome special repetitive sequence chr18 is as shown in SEQ ID NO:10.Institute
Stating SEQ ID NO:1 and SEQ ID NO:2 is pair of primers, can expand simultaneously chr21 on No. 21 and No. 18 chromosomes with
Two similar sequences of chr18.
In the A group reaction system of technique scheme, described No. 13 chromosome special repetitive sequence chr13 and No. 1 dyeing
Body special repetitive sequence chr1-1 is two similar sequences, wherein, and the base sequence of No. 13 chromosome special repetitive sequence chr13
As shown in SEQ ID NO:11, the base sequence of No. 1 chromosome special repetitive sequence chr1-1 is as shown in SEQ ID NO:12.Institute
Stating SEQ ID NO:5 and SEQ ID NO:6 is pair of primers, can expand simultaneously chr13 on No. 13 and No. 1 chromosome with
Two similar sequences of chr1-1.
In the A group reaction system of technique scheme,
5 ' end flag F AM of Taqman probe chr21-Probe (SEQ ID NO:3), 3 ' end labelling BHQ1, can be special
Detect the amplification amount of sequence chr21 on No. 21 chromosomes；
5 ' the end labelling HEX of Taqman probe chr18-Probe (SEQ ID NO:4), 3 ' end labelling BHQ1, can be special
Detect the amplification amount of sequence chr18 on No. 18 chromosomes；
5 ' the end labelling CY5 of Taqman probe chr13-Probe (SEQ ID NO:7), 3 ' end labelling BHQ2, can be special
Detect the amplification amount of sequence chr13 on No. 13 chromosomes；
5 ' the end labelling ROX of Taqman probe chr1-1-Probe (SEQ ID NO:8), 3 ' end labelling BHQ2, can be special
No. 1 chromosome of detection on the amplification amount of sequence chr1-1.
In the B group reaction system of technique scheme, described No. 16 chromosome special repetitive sequence chr16 and X chromosome
Special repetitive sequence chrX is two similar sequences, and wherein, the base sequence of No. 16 chromosome special repetitive sequence chr16 is such as
Shown in SEQ ID NO:21, the base sequence of X chromosome special repetitive sequence chrX is as shown in SEQ ID NO:22.Described SEQ
ID NO:13 and SEQ ID NO:14 is pair of primers, can expand two phases of chr16 with chrX on No. 16 and X chromosome simultaneously
Like sequence.
In the B group reaction system of technique scheme, described No. 1 chromosome special repetitive sequence chr1-2 and Y chromosome
Special repetitive sequence chrY is two similar sequences, and wherein, the base sequence of No. 1 chromosome special repetitive sequence chr1-2 is such as
Shown in SEQ ID NO:23, the base sequence of Y chromosome special repetitive sequence chrY is as shown in SEQ ID NO:24.Described SEQ
ID NO:17 and SEQ ID NO:18 is pair of primers, can expand two phases of chr1-2 with chrY on No. 1 and Y chromosome simultaneously
Like sequence.
In the B group reaction system of technique scheme,
5 ' the end labelling CY5 of Taqman probe chr16-Probe (SEQ ID NO:15), 3 ' end labelling BHQ2, can be special
Detection 16 chromosome on the amplification amount of sequence chr16；
Taqman probe chrX-Probe (SEQ ID NO:16) holds labelling ROX, 3 ' end labelling BHQ2 for 5 ', can be special
Detection X chromosome on the amplification amount of sequence chrX.
5 ' the end labelling HEX of Taqman probe chr1-2-Probe (SEQ ID NO:19), 3 ' end labelling BHQ1, can be special
No. 1 chromosome of detection on the amplification amount of sequence chr1-2；
5 ' end flag F AM of Taqman probe chrY-Probe (SEQ ID NO:20), 3 ' end labelling BHQ1, can be special
The amplification amount of sequence chrY on detection Y chromosome.
Primer involved in test kit of the present invention is all derived from the repetitive sequence that filtered out interchromosomal is special,
The exploitation of these special repetitive sequences is the key of achievement in research, and the repetitive sequence that test kit is developed mainly has:
(1) No. 21 chromosome and No. 18 interchromosomal repetitive sequences are respectively No. 21 chromosome sequence (NC_
000021.8:14678083-14695820；29363117-29409417) He No. 18 chromosome sequences (NC_0000018.10:
15042954-15089199)；
(2) No. 13 chromosomes and No. 1 interchromosomal repetitive sequence are respectively No. 13 chromosome sequence (NC_
000013.11:24678454-24692625) He No. 1 chromosome sequence (NC_000001.10:79324763-79325050)；
(3) No. 16 repetitive sequences between chromosome and X chromosome be respectively No. 16 chromosome sequences (NC_000016.9:
69151913-69154553) with X chromosome sequence (NC_000023.11:44633469-44636065)；
(4) No. 1 repetitive sequences between chromosome and Y chromosome are respectively No. 1 chromosome sequence (202371840-
202414823) and Y chromosome sequence (NC_000024.10:26328480-26365418).
In fluorescent probe of the present invention, FAM refers to that CF 5(6)-Carboxyfluorescein, HEX refer to chlordene-6-methyl fluorescein, and ROX refers to carboxylic
Base-X-rhodamine, CY5 refers to cyanine dye molecule 5, BHQ1 and BHQ2 refers to fluorescent quenching group.In the application, by test kit
Fluorescently-labeled probe respectively with FAM, HEX, ROX and CY5, but fluorescent labeling used is not limited to these several fluorescence used
Labelling, it would however also be possible to employ other fluorescent labeling commonly used in the prior art replaces, can reach the same Detection results.
Test kit of the present invention also includes conventional and necessary component in some available reagent boxes, such as positive control mould
Plate, negative control template, buffer, enzyme liquid, dNTP, Mg2+Deng.
Compared with prior art, present invention is characterized in that
1, by designing a pair common amplification at identical DNA sequence position, the two ends of interchromosomal similar sequences
Primer, it is to avoid what the different sequence of different primers amplification produced interferes or the interference of other condition, thus ensure that amplification
The concordance of efficiency；And select the DNA sequence position having base difference to design Taqman probe, in order to can be by repeating sheet
The 2 of the relative real-time fluorescence PCR of section-△△CTValue accurately detects the relative amplification amount of two sequences.
2, by No. 21 and No. 18 interchromosomal repetitive sequences of A group reaction system, and the body weight that dyes between No. 13 and No. 1
Complex sequences achieves the detection of the number of No. 13, No. 18 and No. 21 chromosomes；By No. 16 and X chromosome of B group reaction system
Between between repetitive sequence, and No. 1 and Y chromosome repetitive sequence achieve the detection of the number of X and Y chromosome.
3, test kit of the present invention has highly sensitive, high specificity and the advantage such as fast and convenient.
Accompanying drawing explanation
Fig. 1 is No. 18 and No. 21 interchromosomal special repetitive sequences positions on chromosome, and wherein, (a) is No. 18
The special repetitive sequence chr18 on chromosome position on No. 18 chromosomes, (b) is the special repetition sequence on No. 21 chromosomes
Row chr21 position on No. 21 chromosomes；
Fig. 2 is the special repetitive sequence chr21 on No. 21 chromosomes and the special repetitive sequence on No. 18 chromosomes in Fig. 1
Chr18, and according to the consensus primer of sequential design and respective Taqman probe；
Fig. 3 is No. 1 and No. 13 interchromosomal special repetitive sequence position on chromosome, and wherein, (a) is No. 1 dye
The special repetitive sequence chr1-1 on colour solid position on No. 1 chromosome, (b) is the special repetitive sequence on No. 13 chromosomes
Chr13 position on No. 13 chromosomes；
Fig. 4 is the special repetitive sequence chr13 on No. 13 chromosomes and the special repetitive sequence on No. 1 chromosome in Fig. 3
Chr1-1, and according to the consensus primer of sequential design and respective Taqman probe.
Fig. 5 is X and No. 16 interchromosomal special repetitive sequences position on chromosome, and wherein, (a) is X chromosome
On special repetitive sequence chrX position on X chromosome, (b) is that the special repetitive sequence chr16 on No. 16 chromosomes exists
Position on No. 16 chromosomes；
Fig. 6 is the special repetitive sequence chr16 on No. 16 chromosomes and the special repetitive sequence on X chromosome in Fig. 5
ChrX, and according to the consensus primer of sequential design and respective Taqman probe；
Fig. 7 is No. 1 and No. Y interchromosomal special repetitive sequence position on chromosome, and wherein, (a) is No. 1 dyeing
The special repetitive sequence chr1-2 on body position on No. 1 chromosome, (b) is the special repetitive sequence chrY on Y chromosome
Position on Y chromosome；
Fig. 8 is the special repetitive sequence chr1-2 on No. 1 chromosome and the special repetitive sequence on Y chromosome in Fig. 7
ChrY, and according to the consensus primer of sequential design and respective Taqman probe.
Detailed description of the invention
Below in conjunction with specific embodiment, the present invention is described in further detail, to be more fully understood that present disclosure, but
The present invention is not limited to following example.
Embodiment 1: use test kit of the present invention to normal specimen, 13-to be measured tri-body specimen, 18-to be measured tri-body mark
Basis, 21-to be measured tri-body specimen, to be measured 47, XXY specimen, to be measured 45, X specimen, to be measured 47, XYY specimen detects.
1, the comparison inquiry of repetitive sequence
By the Blast function of NCBI, the sequence on coloured differently body is compared, find out target chromosome wherein
The repetitive sequence special with two chromosomes on reference sequences chromosome, and by designing the different primers spy to repetitive sequence
The opposite sex is verified, the repetitive sequence that last examination goes out is as follows:
(1) No. 21 chromosome and No. 18 interchromosomal repetitive sequences are respectively No. 21 chromosome sequence (NC_
000021.8:14678083-14695820；29363117-29409417) He No. 18 chromosome sequences (NC_0000018.10:
15042954-15089199)；
(2) No. 13 chromosomes and No. 1 interchromosomal repetitive sequence are respectively No. 13 chromosome sequence (NC_
000013.11:24678454-24692625) He No. 1 chromosome sequence (NC_000001.10:79324763-79325050)；
(3) No. 16 repetitive sequences between chromosome and X chromosome be respectively No. 16 chromosome sequences (NC_000016.9:
69151913-69154553) with X chromosome sequence (NC_000023.11:44633469-44636065)；
(4) No. 1 repetitive sequences between chromosome and Y chromosome are respectively No. 1 chromosome sequence (202371840-
202414823) and Y chromosome sequence (NC_000024.10:26328480-26365418)；
2, the composition of test kit:
2.1A group reaction system
(1) the detection primer of No. 21 and No. 18 chromosomes and probe:
Select No. 21 and No. 18 interchromosomal special repetitive sequence chr21 and chr18 for target sequence design primer and
Taqman probe, base sequence composition is as follows:
The public amplimer of repetitive sequence chr21 and chr18:
Chr21-18-F:5 '-GAAACAGGTCTAGGAGTG-3 ' (SEQ ID NO:1)；
Chr21-18-R:5 '-TGTAGCTTGATGTTTAGTAGG-3 ' (SEQ ID NO:2)；
The chr21-probe taqman probe of detection repetitive sequence chr21:
Chr21-probe:FAM-5 '-CATGTTATTCAGCTACTGCAATAT-3 '-BHQ1 (SEQ ID NO:3)；
The chr18-probe taqman probe of detection repetitive sequence chr18:
Chr18-probe:HEX-5 '-TTCTACATGTTACTCAGTTACTACA-3 '-BHQ1 (SEQ ID NO:4)；
The base sequence of repetitive sequence chr21 and chr18:
Chr21:GAAACAGGTCTAGGAGTGGATGGTGACCCCTTTCTACATGTTATTCAGCT ACTGCAATATATG
TTAATCAAGTTGAATAATATATGTCATTCAAACCTACTAAACATCAAGCTACA (SEQ ID NO:9)；
Chr18:GAAACAGGTCTAGGAGTGGATGGTGACCCCTTTCTACATGTTACTCAGTT ACTACAATATATG
TTAATCAAGTTGAATAATATATGTCATTCAAACCTACTAAACATCAAGCTACA (SEQ ID NO:10)；
Sequence chr21 and chr18 in the location of chromosome as it is shown in figure 1, the concrete base sequence of repetitive sequence and phase
The primer answered and the design of probe are as shown in Figure 2.
(2) the detection primer of No. 13 and No. 1 chromosomes and probe:
Select No. 13 and No. 1 interchromosomal special repetitive sequence chr13 and chr1-1 for target sequence design primer and
Taqman probe, base sequence composition is as follows:
The public amplimer of repetitive sequence chr13 and chr1-1:
Chr13-1-F:5 '-GAGGTGTGGAAAATCTAAG-3 ' (SEQ ID NO:5)
Chr13-1-R:5 '-GAGGGAATTTGAAGTGTTAG-3 ' (SEQ ID NO:6)
The chr13-probe taqman probe of detection repetitive sequence chr13:
Chr13-probe:CY5-5 '-AGTATCTTTGTCTCTACTGCTAC-3 '-BHQ2 (SEQ ID NO:7)；
The chr1-1-probe taqman probe of detection repetitive sequence chr1-1:
Chr1-1-probe:ROX-5 '-AGCATCTTTGTTTCTACCGC-3 '-BHQ2 (SEQ ID NO:8)；
The base sequence of repetitive sequence chr13 and chr1-1:
Chr13:GAGGTGTGGAAAATCTAAGATCACAAATATGCCATGAGAAAGTATCTTTG TCTCTACTGCTAC
TTTACAAAACCACGTCTCTAACTGCTAACACTTCAAATTCCCTC (SEQ ID NO:11)；
Chr1-1:GAGGTGTGGAAAATCTAAGATCACAAATATGCCATGAGAAAGCATCTTT GTTTCTACCGCTA
CTTTACAAAACCACATCTCTTACTACTAACACTTCAAATTCCCTC (SEQ ID NO:12)；
Sequence chr13 and chr1-1 in the location of chromosome as it is shown on figure 3, the concrete base sequence of repetitive sequence and phase
The primer answered and the design of probe are as shown in Figure 4.
(3) Hotstar-Taq enzyme, buffer, dATP, dTTP, dCTP and dGTP and Mg2+It is generation etc. being purchased from Beijing health
Discipline bio tech ltd.
2.2B group reaction system
(1) detection 16 and the primer of X chromosome and probe:
Select special repetitive sequence chr16 and chrX between No. 16 and X chromosome for target sequence design primer and
Taqman probe, base sequence composition is as follows:
The public amplimer of repetitive sequence chr16 and chrX:
Chr16-X-F:5 '-GTCCATCTCCCTGTTCTG-3 ' (SEQ ID NO:13)；
Chr16-X-R:5 '-GCTCACTGCTCTCTAGAA-3 ' (SEQ ID NO:14)；
The chr16-probe taqman probe of detection repetitive sequence chr16:
Chr16-probe:CY5-5 '-AACGGACCATGCTTCCGTA-3 '-BHQ2 (SEQ ID NO:15)；
The chrX-probe taqman probe of detection repetitive sequence chrX:
ChrX-prob:ROX-5 '-AACTGACCATTCTTCCATAGCTC-3 '-BHQ2 (SEQ ID NO:16)；
The base sequence of repetitive sequence chr16 and chrX:
Chr16:GTCCATCTCCCTGTTCTGTGTTCAAGCCCCCAGGGAAAGGTATGGCAGTA GAGGATGACCAGG
TCCAAGCTGCCCAGGTCAGAGCTACGGAAGCATGGTCCGTTCACCAACGCCACGTTTCTAGAGAGCAGTGAGC(SEQ
ID NO:21)；
ChrX:GTCCATCTCCCTGTTCTGTGTTCAAGCCCCCAGGGAAAGGTATGGCAGTTG AGGATGACCAGTT
CCAAGCTGCCCAGGTCAGAGCTATGGAAGAATGGTCAGTTCACCAATGCCACGTTTCTAGAGAGCAGTGAGC(SEQ
ID NO:22)；
Sequence chr16 and chrX in the location of chromosome as it is shown in figure 5, the concrete base sequence of repetitive sequence and corresponding
Primer and probe design as shown in Figure 6.
(2) detection 1 and the primer of Y chromosome and probe:
Select special repetitive sequence chr1-2 and chrY between No. 1 and Y chromosome for target sequence design primer and
Taqman probe, base sequence composition is as follows:
The public amplimer of repetitive sequence chr1-2 and chrY:
Chr1-Y-F:5 '-GCTTGTTTAGCCTGCTTC-3 ' (SEQ ID NO:17)；
Chr1-Y-R:5 '-GCCCACTTATAAAACTGTTTC-3 ' (SEQ ID NO:18)；
The chr1-2-probe taqman probe of detection repetitive sequence chr1-2:
Chr1-2-probe:HEX-5 '-ACTTCAACACCATACCTCTACACA-3 '-BHQ1 (SEQ ID NO:19)；
The chrY-probe taqman probe of detection repetitive sequence chrY:
ChrY-probe:FAM-5 '-ACTTCAACATCACGCCTCTACA-3 '-BHQ1 (SEQ ID NO:20)；
The base sequence of repetitive sequence chr1-2 and chrY:
Chr1-2:GCTTGTTTAGCCTGCTTCCCAAGAAAAGGAAAGACCTATCTCTCTGGAA GGTTTAGCATAGC
TCTGTGTAGAGGTATGGTGTTGAAGTTCATGTCCCTGGAAACAGTTTTATAAGTGG GC (SEQ ID NO:23)；
ChrY:GCTTGTTTAGCCTGCTTCCCAAGAAAAGGAAAGACCTATCTCTCTGGAAGA TTTAGCATAGTTC
TGTGTAGAGGCGTGATGTTGAAGTTCATGACCCTGGAAACAGTTTTATAAGTGGGC (SEQ ID NO:24)；
Sequence chr1-2 and chrY in the location of chromosome as it is shown in fig. 7, the concrete base sequence of repetitive sequence and phase
The primer answered and the design of probe are as shown in Figure 8.
(3) Hotstar-Taq enzyme, buffer, dATP, dTTP, dCTP and dGTP and Mg2+It is generation etc. being purchased from Beijing health
Discipline bio tech ltd.
3, the preparation of PCR reaction system:
The preparation of the reaction system of 3.1A group PCR
By table 1 below preparation PCR reaction system:
Table 1:(mM represents mmol/L, μM expression μm ol/L)
PCR reaction system is 50uL.
4, the source of sample and process
Samples sources in determining the DNA sample of caryogram through traditional chromosome karyotype analysis method, and DNA sample uses experiment
Room routine DNA extraction method is extracted, and is diluted to 20ng/ μ L with distilled water, and saves backup in-20 DEG C.
5, PCR amplification program:
PCR reaction instrument is CFX96 real-time fluorescence quantitative PCR instrument.PCR response procedures is: 95 DEG C of denaturations
10min；95 DEG C of 15sec, 60 DEG C of 1min, 40 circulations, in 60 DEG C of annealing steps ends collection fluorescence signals, after the completion of reaction,
Instrument records the CT value of each every kind of fluorescence of sample, i.e. CT respectivelyFAMValue, CTCY5Value, CTROXValue and CTHEXValue.
6, result detection and analysis:
With 2-[△ (CT target sequence-CT reference sequences) sample to be tested-△ (CT target sequence-CT reference sequences) normal control sample]=2-△△CTValue analyze target coloration
The number of body, makes a concrete analysis of as follows:
6.1A group reaction system
By No. 21 chromosomes and the relative quantification 2 of No. 18 chromosomes-△△CT21-18The different distributions of value is interval, can determine whether out
This specimen is normal specimen, 21-tri-body specimen or 18-tri-body specimen；The most fixed by No. 13 chromosomes and No. 1 chromosome
Amount 2-△△CT13-1The different distributions of value is interval, can determine whether out that this specimen is normal specimen or 13-tri-body specimen.
No. 21 chromosomes of normal specimen and the 2 of No. 18 chromosomes-△△CT21-18Theoretical value 1；No. 21 of 21-tri-body specimen
Chromosome and the 2 of No. 18 chromosomes-△△CT21-18Theoretical value 1.5；No. 18 chromosomes of 18-tri-body specimen and No. 21 chromosomes
2-△△CT21-18Theoretical value 2/3.Between normal specimen, 21-tri-body or 18-tri-body specimen 2-△△CTValue is without juxtaposition, by 2-△△CTThe interval range of value can judge the number of No. 21 and No. 18 chromosomes of specimen to be measured.
No. 13 chromosomes of normal specimen and the 2 of No. 1 chromosome-△△CT13-1Theoretical value 1；No. 13 of 13-tri-body specimen
Chromosome and the 2 of No. 1 chromosome-△△CT13-1Theoretical value 1.5.Between normal specimen and 13-tri-body specimen 2-△△CTValue is without intersecting
Overlap, by 2-△△CTThe interval range of value can judge the number of No. 13 chromosomes of specimen to be measured.
6.2B group reaction system
Relative quantification 2 by No. 16 chromosomes Yu Y chromosome-△△CT16-XThe different distributions of value is interval, and can determine whether out should
Specimen is normal specimen or the specimen of X chromosome numerical abnormality；Relative quantification 2 by No. 1 chromosome Yu Y chromosome-△△CT1-YThe different distributions of value is interval, can determine whether out that this specimen is normal specimen or the specimen of Y chromosome numerical abnormality, all
The nominal reference sample of sample is normal male sample.
No. 16 chromosomes of normal male specimen and the 2 of X chromosome-△△CT16-XTheoretical value 1；The 1 of normal male specimen
Number chromosome and the 2 of Y chromosome-△△CT1-YTheoretical value 1.
No. 16 chromosomes of normal female specimen and the 2 of X chromosome-△△CT16-XTheoretical value 2；The Y of normal female sample
The sequence of chromosome does not expand, therefore, and Y=0.
Therefore, by No. 16 and X chromosome, the relative quantification 2 of repetitive sequence between No. 1 and Y chromosome-△△CTThe interval of value
Scope can judge the X chromosome of specimen to be measured and the number of Y chromosome.
6.3 conventional cell genetic analysis
(karyotype result is expressed as 46, XX or 46, XY, 46 and represents normal person the clinical normal karyotype specimen of detection
Chromosome number；XX represents two sex chromosomies of normal female；XY represents two sex chromosomies of normal male)；Dyeing
Body caryogram is 47, XX ,+21 or 47, XY, and+21,47 represent the number of chromosomes, XX or XY represents normal sex chromosome ,+21
No. 21 chromosomes how are represented；Karyotype is 47, XX ,+18 or 47, XY, and+18,47 represent the number of chromosome, XX
Or XY represents normal sex chromosome, how+18 represented No. 18 chromosomes；Karyotype is 47, XX ,+13 or 47,
XY ,+13,47 represent the number of chromosome, XX or XY represents normal sex chromosome, and how+13 represented No. 13 chromosomes；
Karyotype is 45, X, 45 numbers representing chromosome, and X represents only one sex chromosome；Karyotype is 47, XXY,
Chromosome number is 47, and how XXY has represented an X sex chromosome.
Experimental result shows, the detection system of test kit is consistent with conventional cell genetic analysis, can highly effective detection
Going out No. 21, No. 18, No. 13, X and the number of Y chromosome, therefore, test kit of the present invention can be used for the detection of clinical samples.
Embodiment 2: clinical samples is detected by test kit, method, step etc. described in embodiment 1
Use test kit to 33 example normal specimen, 12 example 21-tri-body specimen, 3 example 13-tri-body specimen, 6 example 18-tri-body marks
This, 3 examples 45, X sample, 2 examples 47, XXY sample, 1 example 47, XYY sample detects, and hangs oneself traditional dye in all sample standard deviations source
Colour solid method of karyotype analysis determines the DNA sample of caryogram.
By No. 21 chromosomes and the 2 of No. 18 interchromosomal repetitive sequences-△△CTValue judges No. 21 chromosomes and No. 18 dyes
The copy number of colour solid.
By No. 13 chromosomes and the 2 of No. 1 interchromosomal repetitive sequence-△△CTValue judges the copy number of No. 13 chromosomes.
By the repetitive sequence between No. 16 and X chromosome 2-△△CTValue judges the copy number of X chromosome.
By the repetitive sequence between No. 1 and Y chromosome 2-△△CTValue judges the copy number of Y chromosome.
No. 21 chromosomes, No. 18 chromosomes and the testing result of No. 13 chromosomes and conventional cell are lost by A group reaction system
Pass credit analysis testing result and be shown in Table 3.
The 2 of table 3:A group reaction system-△△CTValue result and CYTOGENETIC ANALYSIS OF ONE result
X chromosome and the testing result of Y chromosome and conventional cell genetic analysis testing result are shown in by B group reaction system
Table 4.
The 2 of table 4:B group reaction system-△△CTValue result and CYTOGENETIC ANALYSIS OF ONE result
Test result indicate that, the multiplephase of our exploitation can effectively, detect fast and accurately to quantitative PCR kit
No. 21 chromosomes, No. 18 chromosomes, No. 13 chromosomes, X chromosome and the number of Y chromosome, testing result and traditional dyeing
Body method of karyotype analysis is consistent, and accuracy rate is 100%, and result readability is good, analyzes, detection process is simple, efficiently.
Claims (9)
1. the multiplephase of quick detection human chromosome number is to a real-time fluorescence quantitative PCR detection kit, reacts including A group
System and/or B group reaction system, it is characterised in that:
Augmentation detection reagent in described A group reaction system includes:
(1) expand No. 21 chromosome special repetitive sequence chr21 and the primer of No. 18 chromosome special repetitive sequence chr18 simultaneously
Right, their base sequence is respectively as shown in SEQ ID NO:1 and SEQ ID NO:2；
(2) the Taqman probe chr21-Probe of No. 21 chromosome special repetitive sequence chr21 of specific detection, its base sequence
Row are as shown in SEQ ID NO:3；
(3) the Taqman probe chr18-Probe of No. 18 chromosome special repetitive sequence chr18 of specific detection, its base sequence
Row are as shown in SEQ ID NO:4；
(4) expand No. 13 chromosome special repetitive sequence chr13 and the primer of No. 1 chromosome special repetitive sequence chr1-1 simultaneously
Right, their base sequence is respectively as shown in SEQ ID NO:5 and SEQ ID NO:6；
(5) the Taqman probe chr13-Probe of No. 13 chromosome special repetitive sequence chr13 of specific detection, its base sequence
Row are as shown in SEQ ID NO:7；
(6) the Taqman probe chr1-1-Probe of No. 1 chromosome special repetitive sequence chr1-1 of specific detection, its base sequence
Row are as shown in SEQ ID NO:8.
Augmentation detection reagent in described B group reaction system includes:
(1) expand the primer pair of No. 16 chromosome special repetitive sequence chr16 and X chromosome special repetitive sequence chrX simultaneously,
Their base sequence is respectively as shown in SEQ ID NO:13 and SEQ ID NO:14；
(2) the Taqman probe chr16-Probe of No. 16 chromosome special repetitive sequence chr16 of specific detection, its base sequence
Row are as shown in SEQ ID NO:15；
(3) the Taqman probe chrX-Probe of specific detection X chromosome special repetitive sequence chrX, its base sequence is such as
Shown in SEQ ID NO:16；
(4) expand the primer pair of No. 1 chromosome special repetitive sequence chr1-2 and Y chromosome special repetitive sequence chrY simultaneously,
Their base sequence is respectively as shown in SEQ ID NO:17 and SEQ ID NO:18；
(5) the Taqman probe chr1-2-Probe of No. 1 chromosome special repetitive sequence chr1-2 of specific detection, its base sequence
Row are as shown in SEQ ID NO:19；
(6) the Taqman probe chrY-Probe of specific detection Y chromosome special repetitive sequence chrY, its base sequence is such as
Shown in SEQ ID NO:20.
Test kit the most according to claim 1, it is characterised in that: in A group reaction system, described No. 21 chromosomes are special heavy
Complex sequences chr21 and No. 18 chromosome special repetitive sequence chr18 is two similar sequences, and wherein, No. 21 chromosomes are special heavy
The base sequence of complex sequences chr21 as shown in SEQ ID NO:9, the base sequence of No. 18 chromosome special repetitive sequence chr18
As shown in SEQ ID NO:10.
Test kit the most according to claim 1, it is characterised in that: in A group reaction system, described No. 13 chromosomes are special heavy
Complex sequences chr13 and No. 1 chromosome special repetitive sequence chr1-1 is two similar sequences, and wherein, No. 13 chromosomes are special heavy
The base sequence of complex sequences chr13 as shown in SEQ ID NO:11, the base sequence of No. 1 chromosome special repetitive sequence chr1-1
As shown in SEQ ID NO:12.
Test kit the most according to claim 1, it is characterised in that: in A group reaction system,
5 ' end flag F AM of described Taqman probe chr21-Probe, 3 ' end labelling BHQ1；
5 ' the end labelling HEX of described Taqman probe chr18-Probe, 3 ' end labelling BHQ1；
5 ' the end labelling CY5 of described Taqman probe chr13-Probe, 3 ' end labelling BHQ2；
5 ' the end labelling ROX of described Taqman probe chr1-1-Probe, 3 ' end labelling BHQ2.
Test kit the most according to claim 1, it is characterised in that: in B group reaction system, described No. 16 chromosomes are special heavy
Complex sequences chr16 and X chromosome special repetitive sequence chrX is two similar sequences, wherein, and No. 16 chromosome special repetition sequences
Row chr16 base sequence as shown in SEQ ID NO:21, the base sequence such as SEQ ID of X chromosome special repetitive sequence chrX
Shown in NO:22.
Test kit the most according to claim 1, it is characterised in that: in B group reaction system, described No. 1 chromosome is special heavy
Complex sequences chr1-2 and Y chromosome special repetitive sequence chrY is two similar sequences, wherein, and No. 1 chromosome special repetition sequence
Row chr1-2 base sequence as shown in SEQ ID NO:23, the base sequence such as SEQ of Y chromosome special repetitive sequence chrY
Shown in ID NO:24.
Test kit the most according to claim 1, it is characterised in that: in B group reaction system,
5 ' the end labelling CY5 of described Taqman probe chr16-Probe, 3 ' end labelling BHQ2；
5 ' the end labelling ROX of described Taqman probe chrX-Probe, 3 ' end labelling BHQ2；
5 ' the end labelling HEX of described Taqman probe chr1-2-Probe, 3 ' end labelling BHQ1；
5 ' end flag F AM of described Taqman probe chrY-Probe, 3 ' end labelling BHQ1.
Test kit the most according to claim 1, it is characterised in that: this test kit can realize to No. 13, No. 18, No. 21, X and
The detection of Y chromosome, also can realize the aneuploid of No. 1 and No. 16 chromosome is carried out examination.
9. according to the test kit according to any one of claim 1-8, it is characterised in that: the public expansion of repetitive sequence in test kit
Increase Primer Source in following repetitive sequence:
(1) No. 21 chromosome and No. 18 interchromosomal repetitive sequences are respectively No. 21 chromosome sequence NC_000021.8:
14678083-14695820；29363117-29409417 and No. 18 chromosome sequence NC_0000018.10:15042954-
15089199；
(2) No. 13 chromosomes and No. 1 interchromosomal repetitive sequence are respectively No. 13 chromosome sequence NC_000013.11:
24678454-24692625 and No. 1 chromosome sequence NC_000001.10:79324763-79325050；
(3) No. 16 repetitive sequences between chromosome and X chromosome are respectively No. 16 chromosome sequence NC_000016.9:
69151913-69154553 and X chromosome sequence NC_000023.11:44633469-44636065；
(4) No. 1 repetitive sequences between chromosome and Y chromosome be respectively No. 1 chromosome sequence 202371840-202414823 and
Y chromosome sequence NC_000024.10:26328480-26365418.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610320505.5A CN105861699A (en) | 2016-05-16 | 2016-05-16 | Multiple relative real-time fluorescent quantitative PCR detection kit for rapidly detecting number of human chromosomes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610320505.5A CN105861699A (en) | 2016-05-16 | 2016-05-16 | Multiple relative real-time fluorescent quantitative PCR detection kit for rapidly detecting number of human chromosomes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105861699A true CN105861699A (en) | 2016-08-17 |
Family
ID=56631032
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610320505.5A Pending CN105861699A (en) | 2016-05-16 | 2016-05-16 | Multiple relative real-time fluorescent quantitative PCR detection kit for rapidly detecting number of human chromosomes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105861699A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106191233A (en) * | 2016-07-06 | 2016-12-07 | 上海桀蒙生物技术有限公司 | The test kit of multiple real-time quantitative PCR detection chromosome aneuploid and application thereof |
| CN109694907A (en) * | 2017-10-19 | 2019-04-30 | 深圳华大生命科学研究院 | A kind of kit of noninvasive Prenatal Screening patau syndrome and its application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104087672A (en) * | 2014-07-14 | 2014-10-08 | 钦州市妇幼保健院 | Kit for quickly detecting number of human chromosomes 21 by multiplex real-time fluorescence quantitative PCR (polymerase chain reaction) technique |
-
2016
- 2016-05-16 CN CN201610320505.5A patent/CN105861699A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104087672A (en) * | 2014-07-14 | 2014-10-08 | 钦州市妇幼保健院 | Kit for quickly detecting number of human chromosomes 21 by multiplex real-time fluorescence quantitative PCR (polymerase chain reaction) technique |
Non-Patent Citations (2)
| Title |
|---|
| LEI SUN等: "Rapid detection of Down"s syndrome using quantitative real-time PCR (qPCR) targeting segmental duplications on chromosomes 21 and 11", 《GENE》 * |
| XIANGDONG KONG等: "Rapid Diagnosis of Aneuploidy Using Segmental Duplication Quantitative Fluorescent PCR", 《PLOS》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106191233A (en) * | 2016-07-06 | 2016-12-07 | 上海桀蒙生物技术有限公司 | The test kit of multiple real-time quantitative PCR detection chromosome aneuploid and application thereof |
| CN106191233B (en) * | 2016-07-06 | 2019-12-31 | 上海桀蒙生物技术有限公司 | Kit for detecting chromosome aneuploidy by multiple real-time quantitative PCR (polymerase chain reaction) and application thereof |
| CN109694907A (en) * | 2017-10-19 | 2019-04-30 | 深圳华大生命科学研究院 | A kind of kit of noninvasive Prenatal Screening patau syndrome and its application |
| CN109694907B (en) * | 2017-10-19 | 2022-07-26 | 深圳华大生命科学研究院 | Noninvasive prenatal screening trisomy syndrome kit and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200270700A1 (en) | Noninvasive diagnosis of fetal aneuploidy by sequencing | |
| Dong et al. | Low-pass whole-genome sequencing in clinical cytogenetics: a validated approach | |
| CN112063756B (en) | Method and kit for multiple detection of respiratory virus nucleic acid | |
| CN105463122B (en) | A kind of MTHFR, MTRR and RFC1 genetic polymorphism detection Primer composition, kit and its application | |
| CN108342455B (en) | Method for detecting fetal aneuploid chromosome from maternal peripheral blood and kit thereof | |
| US20040137452A1 (en) | Diagnostic test | |
| CN104651488B (en) | Detect the Amplification thing and quick detection kit of chromosome aneuploid numerical abnormality | |
| Picchiassi et al. | The best approach for early prediction of fetal gender by using free fetal DNA from maternal plasma | |
| CN108913757A (en) | A kind of primer sets of chromosome aneuploid numerical abnormality and detection kit and its application | |
| CN105039318A (en) | Kit for screening spinal muscular atrophy virulence gene carrier and application of kit | |
| CN106148484B (en) | A kind of kit that diagnosis Y chromosome is micro-deleted | |
| CN101555528B (en) | Method for testing chromosome 22q11.2 microdeletion and microduplication | |
| CN105925691B (en) | A kind of quick detection people No. 13, No. 18, No. 21, the kit of X and Y chromosome number | |
| CN106795551A (en) | The CNV analysis methods and detection means of unicellular chromosome | |
| CN104087672A (en) | Kit for quickly detecting number of human chromosomes 21 by multiplex real-time fluorescence quantitative PCR (polymerase chain reaction) technique | |
| CN105861699A (en) | Multiple relative real-time fluorescent quantitative PCR detection kit for rapidly detecting number of human chromosomes | |
| CN116949161A (en) | Group of tuberculosis serum exosome miRNA markers and application thereof | |
| CN104087671A (en) | Kit used for detecting number of human chromosomes 21 | |
| CN105018589A (en) | Y chromosome microdeletion multiple real-time fluorescence PCR detection kit, amplimer pairs and probes | |
| CN105316420A (en) | Kit for rapidly detecting numbers of human chromosomes 13 and 18 by virtue of single-tube four-color dual relative fluorescence quantitative PCR technique | |
| CN109628578A (en) | A method of based on general probe detection fetal chromosomal variation | |
| US11001874B1 (en) | Simplified PCR method for the detection of common neuploides in human reimplantation embryos | |
| CN104087673B (en) | A kind of rapid detection people No. 21 chromosome number object test kits | |
| CN109988850B (en) | Kit for rapidly detecting number of all 23 pairs of chromosomes of human | |
| KR101998204B1 (en) | Digital PCR primer set for diagnosis of prostate cancer and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160817 |
|
| RJ01 | Rejection of invention patent application after publication |