CN104087673B - A kind of rapid detection people No. 21 chromosome number object test kits - Google Patents
A kind of rapid detection people No. 21 chromosome number object test kits Download PDFInfo
- Publication number
- CN104087673B CN104087673B CN201410333075.1A CN201410333075A CN104087673B CN 104087673 B CN104087673 B CN 104087673B CN 201410333075 A CN201410333075 A CN 201410333075A CN 104087673 B CN104087673 B CN 104087673B
- Authority
- CN
- China
- Prior art keywords
- karyomit
- necrosis factor
- probe
- special tumor
- factor glycoproteins
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of rapid detection people No. 21 chromosome number object test kits, comprise augmentation detection reagent, described augmentation detection reagent comprises: the primer pair of simultaneously increase No. 21 special tumor-necrosis factor glycoproteinss of karyomit(e) and No. 6 special tumor-necrosis factor glycoproteinss of karyomit(e); The fluorescent probe of the above-mentioned No. 21 special tumor-necrosis factor glycoproteinss of karyomit(e) of specific detection; The fluorescent probe of the above-mentioned No. 6 special tumor-necrosis factor glycoproteinss of karyomit(e) of specific detection.A pair similar sequences that test kit of the present invention adopts pair of primers to increase between coloured differently body simultaneously, avoid different primers increase different sequence produce mutual interference or other interference, ensure that the consistence of amplification efficiency, select that there is the DNA sequence dna position design fluorescent probe of base difference, so that the △ CT value by the real-time fluorescence PCR of repeated fragment accurately detects the amplification amount of two sequences respectively, further increase accuracy and the reliability of detected result, reduce the probability causing false negative or false positive results.
Description
Technical field
The present invention relates to a kind of rapid detection people No. 21 chromosome number object test kits, belong to biology field.
Background technology
Mongolism (Down ' ssyndrome) also referred to as mongolism, be the aneuploid disease that the modal numerical abnormalities of chromosomes of the mankind causes, newborn infant's incidence is 1/600 ~ 1/800.Infant main manifestations is serious congenital dysnoesia and various organ congenital abnormality, and most of patients life cannot be taken care of oneself.At present, this disease there is no effective methods for the treatment of, therefore, carries out antenatal diagnosis and prevents the birth of infant from being the pathogenetic main method of such disease of prevention.For a long time, amniotic fluid cell culture, chromosome karyotype analysis become the classical way (CasperssonT of antenatal diagnosis, ZechL, JohanssonC, etal.IdentificationofhumanchromosomesbyDNA-bindingfluore scentagents [J] .Chromosoma, 1970,30 (2): 215-227.), but there is time-consuming (generally wanting more than two weeks), easily cultivate unsuccessfully and the shortcomings such as less chromosomal structural aberration can not be detected in the method.Fluorescence in situ hybridization (FISH) technology is applied to antenatal quick diagnosis, without the need to carrying out cell cultures, just can show in 24 hours that assay becomes possible (HoSSY, ChuaC, GoleL, etal.Same-dayprenataldiagnosisofcommonchromosomalaneuplo idiesusingmicrofluidics-fluorescenceinsituhybridization [J] .PrenatalDiagnosis, 2012,32 (4): 321-328. etc.); But because this technological operation is loaded down with trivial details and require to have good technology specialty, make the application carrying out clinical samples that this technology can not be a large amount of.Therefore, should need to set up more fast and effective methods for prenatal diagnosis to make up some defects and the deficiency of above method.
Along with molecular biological development, there has been the method for several rapid molecular diagnosis aneuploid.QF-PCR method is a kind of method most widely used at present, the method can realize the accurate detection (AtefSH of aneuploid, HafezS, HelmyS, etal.QF-PCRasaRapidTechniqueforRoutinePrenatalDiagnosiso fFetalAneuploidies [J] .PediatricResearch, 2011, 70:412-412.), the main drawback of this technology is that diagnosis needs to rely on pleomorphism site, and pleomorphism site may be diagnosed preferably in a certain people's group energy, and because the difference of race may appear at the situation (MannK occurring in other crowd cannot carrying out diagnosing, DonaghueC, FoxSP, etal.Strategiesfortherapidprenataldiagnosisofchromosomea neuploidy [J] .EurJHumGenet, 2004, 12:907-915.), further, it also needs its fragment sheet degree of capillary electrophoresis analysis after pcr amplification, and therefore, the expense of instrument and reagent also limit the widespread use of the method.Multiple linking probe amplification (MLPA) technology starts the change being applied to gene copy number most, be applied to the diagnosis (SlaterHR of aneuploid disease afterwards, BrunoDL, RenH, etal.Rapid, highthroughputprenataldetectionofaneuploidyusinganovelqu antitativemethod (MLPA) [J] .Journalofmedicalgenetics, 2003, 40 (12): 907-912.), because this technology needs hybridized overnight, the steps such as the follow-up capillary electrophoresis analysis of connection and product, test the relatively loaded down with trivial details and subsequent analysis expensive cost impacts widespread use (WillisAS of this technology, VeyverI, EngCM.Multiplexligation ?dependentProbeamplification (MLPA) andprenataldiagnosis [J] .PrenatDiagn, 2012, 32:315-320.).
Real time fluorescence quantifying PCR method diagnosis aneuploid does not need PCR aftertreatment or electrophoresis detection, and easy, quick, the judgement of whole operation and result can complete in 4 hours; And the reading of data is undertaken by instrument completely, eliminate the impact of subjective factor, other tens samples can once complete, and provide technical guarantee for carrying out large-scale Prenatal Screening.Current research mainly adopts No. 21 chromosomal DSCR3 gene fragments and No. 12 chromosomal GAPDH gene fragments to carry out relative quantification (ZimmermannB, HolzgreveW, WenzelF, etal.Novelreal-timequantitativePCRtestfortrisomy21 [J] .Clinicalchemistry, 2002, 48 (2): 362-363. etc.), or adopt the distinguished sequence between other coloured differently bodies to carry out relative quantification research (ZimmermannBG, DudarewiczL.Real-timequantitativePCRforthedetectionoffet alaneuploidies [M] .PrenatalDiagnosis.HumanaPress, 2008:95-109, Sui builds loyalty, Zhang Huimin, Sun Xiaofang. multiple real-time quantitative PCR Kuai Suzhenduantangshi and edward's syndrome [J]. and Chinese Journal of Medical Genetics, 2010 (4): 449-452.).But, to increase respectively different fragments owing to adopting two pairs of primers, the change of very small annealing temperature or the difference of DNA quality all can cause false negative or false-positive result, thus cause the inaccuracy (HelmySM of result, IsmailS, BassiouniR, etal.SensitivityofDCSR3/GAPDHratiousingquantitativereal-timePCRintherapidprenataldiagnosisfordownsyndrome [J] .FetalDiagnTher, 2009,25 (2): 220-223.).
Publication number is the patent of invention of CN100338227A, CN102086469A, all disclose by detecting No. 21 chromosomal numbers to the distinguished sequence design different primers of coloured differently body and the method for probe, but these class methods exist due to the difference of the change of annealing temperature or DNA quality, thus may cause false negative or false-positive result foregoing.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of rapid detection people No. 21 chromosome number object test kits.This test kit adopts pair of primers to increase to a pair similar sequences between coloured differently body simultaneously, avoid different primers increase different sequence produce mutual interference or other interference, ensure that the consistence of amplification efficiency, improve accuracy and the reliability of detected result, reduce the probability causing false negative or false positive results.
Rapid detection people of the present invention No. 21 chromosome number object test kits, comprise augmentation detection reagent, described augmentation detection reagent comprises the primer of the special tumor-necrosis factor glycoproteins that can simultaneously increase for a pair on No. 21 karyomit(e)s and No. 6 karyomit(e)s, article 2, can detect the difference fluorescently-labeled probe of No. 21 karyomit(e)s and No. 11 Genomic signature amplification amounts respectively, described amplimer and fluorescent probe are specially:
(1) increase the primer pair of No. 21 special tumor-necrosis factor glycoproteins chr6-1 of karyomit(e) special tumor-necrosis factor glycoproteins chr21-1 and No. 6 karyomit(e) simultaneously, and its base sequence is respectively as shown in SEQIDNO:1 and SEQIDNO:2;
(2) the Taqman probe chr21-1-Probe of the special tumor-necrosis factor glycoproteins chr21-1 of specific detection No. 21 karyomit(e)s, its base sequence is as shown in SEQIDNO:3;
(3) the Taqman probe chr6-1-Probe of the special tumor-necrosis factor glycoproteins chr6-1 of specific detection No. 6 karyomit(e)s, its base sequence is as shown in SEQIDNO:4.
Test kit of the present invention is by designing a pair common amplimer at the identical DNA sequence dna position, two ends of special tumor-necrosis factor glycoproteins (two similar sequences), avoid different primers to increase the mutual interference or other interference that different sequence produces, thus ensure that the consistence of amplification efficiency; Select that there is the DNA sequence dna position design Taqman probe of base difference, so that the amplification amount of the accurate detection of △ CT value difference two sequences by the real-time fluorescence PCR of repeated fragment, and the relative quantification △ CT of the special tumor-necrosis factor glycoproteins passed through on No. 21 karyomit(e)s and the special tumor-necrosis factor glycoproteins on No. 6 karyomit(e)s
21-6the distributed area of value judges to detect sample whether as normal specimen or 21-tri-body caryogram sample, and detected result is more accurate, reliability.
In technique scheme, the described No. 21 special tumor-necrosis factor glycoproteins chr6-1 of karyomit(e) special tumor-necrosis factor glycoproteins chr21-1 and No. 6 karyomit(e) are two similar sequences, wherein, the base sequence of No. 21 special tumor-necrosis factor glycoproteins chr21-1 of karyomit(e) is as shown in SEQIDNO:5, and the base sequence of No. 6 special tumor-necrosis factor glycoproteins chr6-1 of karyomit(e) is as shown in SEQIDNO:6.5 ' the end mark CY5 of the described Taqman probe chr21-1-Probe for the special tumor-necrosis factor glycoproteins chr21-1 of specific detection No. 21 karyomit(e)s, 3 ' end mark BHQ1; 5 ' the end flag F AM of the described Taqman probe chr6-1-Probe for the special tumor-necrosis factor glycoproteins chr6-1 of specific detection No. 6 karyomit(e)s, 3 ' end mark BHQ1.Described Taqman probe chr21-1-Probe and Taqman probe chr6-1-Probe can detect the special tumor-necrosis factor glycoproteins chr6-1 on special tumor-necrosis factor glycoproteins chr21-1 and No. 6 karyomit(e) on No. 21 karyomit(e)s respectively, then passes through the relative quantification index △ CT of Taqman probe chr21-1-Probe and Taqman probe chr6-1-Probe
21-6value judgement No. 21 chromosomal numbers.As △ CT
21-6=Ct
cY5-Ct
fAMwhen=0.23 ~ 0.65, represent to detect sample be No. 21 karyomit(e) normal specimen; As △ CT
21-6=Ct
cY5-Ct
fAMwhen=-0.32 ~-0.05, represent to detect sample be 21-tri-body caryogram sample.
In fluorescent probe of the present invention, FAM refers to Fluoresceincarboxylic acid, and CY5 refers to that cyanine dyes molecule 5, BHQ1 refers to fluorescent quenching group.
Test kit of the present invention also comprises component conventional and necessary in some available reagent boxes, as positive control template, negative control template, damping fluid, enzyme liquid, dNTP, Mg
2+deng.
Compared with prior art, adopt pair of primers to increase to a pair similar sequences between coloured differently body in test kit of the present invention simultaneously, avoid different primers increase different sequence produce mutual interference or other interference, ensure that the consistence of amplification efficiency, select that there is the DNA sequence dna position design Taqman probe of base difference, so that the △ CT value by the real-time fluorescence PCR of repeated fragment accurately detects the amplification amount of two sequences respectively, further increase accuracy and the reliability of detected result, reduce the probability causing false negative or false positive results, meanwhile, test kit of the present invention also has highly sensitive, high specificity and the advantage such as fast and convenient.
Accompanying drawing explanation
Fig. 1 is the special tumor-necrosis factor glycoproteins on No. 21 karyomit(e)s and the special tumor-necrosis factor glycoproteins position on chromosome on No. 6 karyomit(e)s, wherein, a () is the position of special tumor-necrosis factor glycoproteins chr21-1 on No. 21 karyomit(e)s on No. 21 karyomit(e)s, (b) is the position of special tumor-necrosis factor glycoproteins chr6-1 on No. 6 karyomit(e)s on No. 6 karyomit(e)s;
Fig. 2 is the special tumor-necrosis factor glycoproteins in Fig. 1 on No. 21 karyomit(e)s and the special tumor-necrosis factor glycoproteins on No. 6 karyomit(e)s, and according to the consensus primer of sequences Design and respective Taqman probe, wherein, 21-Taqmanprobe in figure is Taqman probe chr21-1-Probe, and the 6-Taqmanprobe in figure is Taqman probe chr6-1-Probe.
Embodiment
With specific embodiment, the invention will be further described below, but the present invention is not limited to these embodiments.
Embodiment 1: adopt test kit of the present invention to detect normal specimen and 21-to be measured tri-body sample
1, the composition of test kit:
The design of the selection of 1.1 target sequences and primer and probe
Detection site: select the special tumor-necrosis factor glycoproteins chr21-1 on No. 21 karyomit(e)s increase for relative real-time fluorescence quantitative PCR with special tumor-necrosis factor glycoproteins chr6-1 on No. 6 karyomit(e)s (chr21-1 and chr6-1 is two similar sequences) and detect sequence, as shown in Figure 1, wherein:
The base sequence of the special tumor-necrosis factor glycoproteins chr21-1 on No. 21 described karyomit(e)s is: 5 '-acaggacctgaccctggctcccggccagcctcacctcccatggctttcctgcccct gtattacctcacttccttcccctttagccatccttcgggcctcagttcaagttcac atcttcaggatggt-3 ' (SEQIDNO:5);
The base sequence of the special tumor-necrosis factor glycoproteins chr6-1 on No. 6 described chromosome is: 5 '-acaggacctgaccctggctcccggccagcctcatctcccatggctttcctgtccct gtactacctcgcttccttcccctttagcctcagttcaagttcacatcttcaggatg gt-3 ' (SEQIDNO:6).
A pair common primers is designed in the identical base sequence site in both sides of No. 21 chromosomal special tumor-necrosis factor glycoproteins chr21-1 and No. 6 chromosomal special tumor-necrosis factor glycoproteins chr6-1, as shown in Figure 2, this primer pair can increase No. 21 special tumor-necrosis factor glycoproteins chr6-1 of karyomit(e) special tumor-necrosis factor glycoproteins chr21-1 and No. 6 karyomit(e) simultaneously, in this primer pair:
Upstream primer (uses chr below
21-6-F replaces) be: 5 '-acaggacctgaccctggc-3 ' (SEQIDNO:1);
Downstream primer (uses chr below
21-6-R replaces) be: 5 '-accatcctgaagatgtgaacttg-3 ' (SEQIDNO:2).
The sequence site in the centre of No. 21 chromosomal special tumor-necrosis factor glycoproteins chr21-1 and No. 6 chromosomal special tumor-necrosis factor glycoproteins chr6-1 with base difference is designed for the Taqman probe chr21-1-Probe of specific detection No. 21 karyomit(e) special tumor-necrosis factor glycoproteins chr21-1 and the Taqman probe chr6-1-Probe of the special tumor-necrosis factor glycoproteins chr6-1 of specific detection No. 6 karyomit(e)s, as shown in Figure 2, wherein:
The base sequence of Taqman probe chr21-1-Probe is: 5 '-CY5-ccctttagccatccttcgggcctcagt-BHQ1-3 ' (SEQIDNO:3);
The base sequence of Taqman probe chr6-1-Probe is: 5 '-FAM-acctcgcttccttcccctttagcctca-BHQ1-3 ' (SEQIDNO:4).
1.2 other moietys:
Hotstar-Taq enzyme, damping fluid, dATP, dTTP, dCTP and dGTP and Mg
2+all purchased from Beijing CoWin Bioscience Co., Ltd..
2, the preparation of PCR reaction system:
PCR reaction system is prepared by following table 1:
Table 1:(mM represents mmol/L, μM expression μm ol/L)
PCR reaction system is 50uL.
3, the source of sample and process
Samples sources is in the DNA sample through traditional chromosome karyotype analysis method determination caryogram, and DNA sample adopts the conventional DNA extraction method in laboratory to extract, and is diluted to 20ng/ μ L, and saves backup in-20 DEG C with distilled water.
4, pcr amplification program:
It is CFX96 real-time fluorescence quantitative PCR instrument that PCR reacts instrument.PCR response procedures is: 95 DEG C of denaturation 10min; 95 DEG C of 15sec, 60 DEG C of 1min, 40 circulations, gather fluorescent signal in 60 DEG C of annealing steps ends.
By normal specimen and 21-to be measured tri-body sample, according to above-mentioned reaction system and response procedures, on quantitative real time PCR Instrument, carry out augmentation detection, record △ CT respectively
fAMvalue and △ CT
cY5value.
5, result examination and analysb:
No. 21 karyomit(e)s of normal specimen and No. 6 chromosomal △ CT
21-6=Ct
cY5-Ct
fAM=0.53, and No. 21 karyomit(e)s of 21-tri-body sample and No. 6 chromosomal △ CT
21-6=Ct
cY5-Ct
fAM=-0.09; By comparing the △ CT value of No. 21 karyomit(e)s and No. 6 karyomit(e) normal specimen and 21-tri-body sample: 0.53 and-0.09, result shows No. 21 karyomit(e)s and copies (in theory than many one of No. 6 karyomit(e)s, when △ CT value difference is 0.5, its copy difference 1 copy), visible, conform to the result of traditional standard detecting method (chromosome karyotype analysis), the 21-tri-body sample of test is 3 No. 21 karyomit(e)s.
Experimental result shows, and test kit of the present invention can detect that 21-tri-body sample to be measured is 21-tri-body, and consistent with the result that traditional chromosome karyotype analysis judges, therefore, test kit of the present invention can be used for the detection of clinical samples.
Embodiment 2: clinical samples is detected by test kit, method, step etc. described in embodiment 1
Adopt test kit to test 35 routine normal specimen and 26 routine 21-tri-body samples, all sample standard deviations are originated the DNA sample of the chromosome karyotype analysis method determination caryogram of hanging oneself traditional.
By No. 21 karyomit(e)s and No. 6 chromosomal relative quantification △ CT
21-6value (△ CT
21-6=Ct
cY5-Ct
fAM) different distributions interval, can judge that this sample is normal specimen or 21-tri-body sample, real time fluorescent quantitative detect △ CT value and scope as follows:
No. 21 karyomit(e)s of normal specimen and No. 6 chromosomal △ CT
21-6value scope is 0.23 ~ 0.65; No. 21 karyomit(e)s of 21-tri-body sample and No. 6 chromosomal △ CT
21-6value scope is-0.32 ~-0.05, in the distribution of interval range, normal specimen and 21-tri-body sample △ CT value between the two, without juxtaposition, judge that sample to be measured is normal specimen or 21-tri-body patient sample by △ CT value.
(karyotype result is expressed as 46, NN to the clinical normal karyotype sample detected, and 46 represent normal chromosome number; NN represents normal sex chromosome) and 21-tri-body caryogram sample (karyotype result is expressed as 47, NN ,+21,47 represent chromosomal number, NN represents normal sex chromosome; + 21 No. 21 karyomit(e)s that represented many) No. 21 karyomit(e)s and No. 6 chromosomal relative quantification △ CT
21-6the concrete outcome of value is in table 2.
Table 2: the Δ CT value result of the multiple real time fluorescence quantifying of normal karyotype DNA and 21-three body caryogram specimen dna and analysis
Experimental result shows, test kit of the present invention can detect No. 21 chromosomal numbers effectively, accurately, and detected result is consistent with traditional chromosome karyotype analysis method, and accuracy rate is 100%, and result readability is good, and analysis, testing process are simply, efficiently.
Claims (5)
1. rapid detection people No. 21 chromosome number object test kits, comprise augmentation detection reagent, it is characterized in that: described augmentation detection reagent comprises:
(1) increase the primer pair of No. 21 special tumor-necrosis factor glycoproteins chr6-1 of karyomit(e) special tumor-necrosis factor glycoproteins chr21-1 and No. 6 karyomit(e) simultaneously, and its base sequence is respectively as shown in SEQIDNO:1 and SEQIDNO:2;
(2) the Taqman probe chr21-1-Probe of the special tumor-necrosis factor glycoproteins chr21-1 of specific detection No. 21 karyomit(e)s, its base sequence is as shown in SEQIDNO:3;
(3) the Taqman probe chr6-1-Probe of the special tumor-necrosis factor glycoproteins chr6-1 of specific detection No. 6 karyomit(e)s, its base sequence is as shown in SEQIDNO:4.
2. test kit according to claim 1, it is characterized in that: the described No. 21 special tumor-necrosis factor glycoproteins chr6-1 of karyomit(e) special tumor-necrosis factor glycoproteins chr21-1 and No. 6 karyomit(e) are two similar sequences, wherein, the base sequence of No. 21 special tumor-necrosis factor glycoproteins chr21-1 of karyomit(e) is as shown in SEQIDNO:5, and the base sequence of No. 6 special tumor-necrosis factor glycoproteins chr6-1 of karyomit(e) is as shown in SEQIDNO:6.
3. test kit according to claim 1, is characterized in that: 5 ' the end mark CY5 of described Taqman probe chr21-1-Probe, 3 ' end mark BHQ1.
4. test kit according to claim 1, is characterized in that: 5 ' the end flag F AM of described Taqman probe chr6-1-Probe, 3 ' end mark BHQ1.
5. test kit according to claim 1, is characterized in that: with the relative quantification index △ CT of Taqman probe chr21-1-Probe and Taqman probe chr6-1-Probe
21-6value judgement No. 21 chromosomal numbers, described △ CT
21-6=Ct
cY5-Ct
fAM, as △ CT
21-6when=0.23 ~ 0.65, represent to detect sample be No. 21 karyomit(e) normal specimen; As △ CT
21-6when=-0.32 ~-0.05, represent to detect sample be 21-tri-body caryogram sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410333075.1A CN104087673B (en) | 2014-07-14 | 2014-07-14 | A kind of rapid detection people No. 21 chromosome number object test kits |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410333075.1A CN104087673B (en) | 2014-07-14 | 2014-07-14 | A kind of rapid detection people No. 21 chromosome number object test kits |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104087673A CN104087673A (en) | 2014-10-08 |
| CN104087673B true CN104087673B (en) | 2016-02-17 |
Family
ID=51635431
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410333075.1A Expired - Fee Related CN104087673B (en) | 2014-07-14 | 2014-07-14 | A kind of rapid detection people No. 21 chromosome number object test kits |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104087673B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1693480A (en) * | 2005-04-20 | 2005-11-09 | 浙江大学医学院附属妇产科医院 | Method of real time detecting No.21 human chromosome number by quantitative PCR technology |
| CN101525661A (en) * | 2009-03-30 | 2009-09-09 | 山东亚大药业有限公司 | Double-color competitiveness fluorescent quantitation polymerase chain reaction detection kit |
-
2014
- 2014-07-14 CN CN201410333075.1A patent/CN104087673B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1693480A (en) * | 2005-04-20 | 2005-11-09 | 浙江大学医学院附属妇产科医院 | Method of real time detecting No.21 human chromosome number by quantitative PCR technology |
| CN101525661A (en) * | 2009-03-30 | 2009-09-09 | 山东亚大药业有限公司 | Double-color competitiveness fluorescent quantitation polymerase chain reaction detection kit |
Non-Patent Citations (2)
| Title |
|---|
| Rapid Diagnosis of Aneuploidy Using Segmental Duplication Quantitative Fluorescent PCR;Xiangdong Kong et al;《PLOS》;20140313;第9卷(第3期);e88932 * |
| Same-day prenatal diagnosis of common chromosomal aneuploidies using microfluidics-fluorescence in situ hybridization;Ho SSY,et al;《Prenatal Diagnosis》;20121231;第32卷(第4期);321-328 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104087673A (en) | 2014-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2014003053A1 (en) | Method for detecting pancreatic cancer and detection kit | |
| Hong et al. | Systematic evaluation of multiple qPCR platforms, NanoString and miRNA-Seq for microRNA biomarker discovery in human biofluids | |
| CN105695567A (en) | Kit, primers, probe sequence and method for detecting fetus chromosome aneuploid | |
| CN102985565A (en) | Rapid genotyping analysis for human papillomavirus and the device thereof | |
| CN103725798A (en) | Primer, kit and detection method of detecting haemorrhagic fever with renal syndrome virus by RT-LAMP (Reverse Transcription Loop-Mediated Isothermal Amplification) method | |
| Gehrau et al. | MicroRNA signature at the time of clinical HCV recurrence associates with aggressive fibrosis progression post-liver transplantation | |
| Zhang et al. | A simple and highly efficient method of IFI44L methylation detection for the diagnosis of systemic lupus erythematosus | |
| CN101555528B (en) | Method for testing chromosome 22q11.2 microdeletion and microduplication | |
| CN104087672A (en) | Kit for quickly detecting number of human chromosomes 21 by multiplex real-time fluorescence quantitative PCR (polymerase chain reaction) technique | |
| CN103436609A (en) | Method for noninvasive prenatal disgnosis of congenital deafness genetic disease | |
| CN104293932A (en) | Method for detecting HLA-B * 5801 allele based on real-time fluorescence PCR | |
| CN109182493A (en) | The primer and kit and its detection method of people's 16p11.2 microdeletion syndrome detection | |
| CN104087671A (en) | Kit used for detecting number of human chromosomes 21 | |
| CN103103259A (en) | Method, kit and primers for determining whether two predetermined loci of nucleic acid sample mutate or not | |
| Levy et al. | Non-invasive prenatal aneuploidy testing: technologies and clinical implications. | |
| CN105925691B (en) | A kind of quick detection people No. 13, No. 18, No. 21, the kit of X and Y chromosome number | |
| CN105176995B (en) | Thalassemia α can be detected simultaneously based on hydrolysis probes method21.9The kit that deletion form and α 2 make a variation | |
| CN105624308B (en) | A kind of product that detection chromosome 16p11.2 is micro-deleted | |
| WO2020134950A1 (en) | Gene mutation/fusion combination and kit for identification of benign and malignant pulmonary nodules | |
| Sun et al. | Rapid detection of Down's syndrome using quantitative real-time PCR (qPCR) targeting segmental duplications on chromosomes 21 and 11 | |
| CN104988239A (en) | Method and kit for analyzing ploidy of unicellular sex chromosomes quickly | |
| CN104087673B (en) | A kind of rapid detection people No. 21 chromosome number object test kits | |
| US20160208346A1 (en) | Method and composition for detection of oncogenic hpv | |
| CN105506067A (en) | AMRMS-qPCR detection kit and detection method for NOSLAP genotyping | |
| CN105506068A (en) | AMRMS-qPCR detection kit and detection method for MMP2 genotyping |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160217 Termination date: 20180714 |