CN105859749A - Hotair small-molecule inhibitor and application thereof in preparation of tumor treating drugs - Google Patents

Abstract

The invention discloses a Hotair small-molecule inhibitor and application thereof in preparation of tumor treating drugs and belongs to the field of pharmaceutical preparations containing organic effective ingredients. The chemical name of the Hotair small-molecule inhibitor is 7-nitrogen-2-[4-(7-nitrogen-3-oxy-4,9-dihydrofuran[3,2-b]quinoxaline-2-yl)phenyl]-4,9-dihydrofuran[3,2-b]quinoxaline-3-ketone, and the molecular weight is 540. The Hotair small-molecule inhibitor can specifically inhibit binding between the 5' end of Hotair and EZH2 protein in PRC2, effectively inhibit EZH2 nucleus entry in U87 cells, and effectively inhibits growth and lung metastasis of a breast cancer tumor model in an in-vivo experiment of a rat. The Hotair small-molecule inhibitor can be applied to the preparation of the tumor treating drugs, has a great clinical significance on tumor occurrence, development and treatment and has broad application prospects.

Description

Hotair micromolecular inhibitor and the application in preparation tumor

Technical field

The invention belongs to the medical configuration product field containing organic effective component, specifically a kind of Hotair micromolecular inhibitor And the application in preparation tumor.

Background technology

People Hotair is in chromosome 12q13 region, between HOXC12 and HOXC11 coding region.Initial research work Starting from 2007, Chang seminar finds during research HOXA-HOXD family epigenetic regulation, Hotair's Mechanism of action is realized by a series of albumen compositions.First the albumen composition found is by histone H 3 K27 first Based transferase (H3K27 histone methyl transferase, HMTase), EZH2, EED and SUZ12 collectively constitute many Comb albumen suppression complex (Polycomb Repressive Complex 2, PRC2), it is with trans-acting mode (in Trans) the tri-methylated of 27 lysines of H3 histone on HOXD site, and then the genetic transcription in suppression HOXD site are affected. Recent study finds, the functional activity of the lncRNAs of at least 20% including Hotair is all relevant to PRC2.2010 Year, Chang seminar publishes thesis at Nature and Science magazine simultaneously, proposes lysine specific histone demethyl Change enzyme 1 (Lysine specific demethylase 1, LSD1)/CoREST/REST complex by 3 ' the end institutes of Hotair Raise, play respectively to the tri-methylated of 27 lysines of H3 histone and to H3 group with the PRC2 complex raised by 5 ' ends 4 lysines of albumen go base effect.In the same year, Reinberg seminar is further discovered that the 354 of PRC2 important member EZH2 The phosphorylation of position threonine is most important with the combination of Hotair to it.

Hotair research in tumor starts from 2010, and Chang seminar is in primary breast carcinoma and aggressive breast carcinoma Clinical samples in had been found that the high expressed of Hotair, the experiment in vitro of cell line finds that process LAN Hotair can increase swollen Oncocyte aggressive, and breast cancer cell after striking low Hotair, can be suppressed in the growth of nude mice by subcutaneous tumor.The studies above Once the malignant phenotype of Hotair with tumor is connected, and speculate that its mechanism is probably PRC2 and inhibits invasion and attack inhibitive factor Expression caused by.Subsequently, Chang proposes the possible mechanism of action of lncRNAs a example by Hotair, including lncRNA and other The complementary combination of RNA (lncRNA, mRNA and short non-coding RNA), RNA-DNA complementation combination, lncRNA structure is situated between Lead albumen and couple the effect of son (linker) with directly effect and the protein of mRNA, and then this seminar is again connexon Conception deriving becomes scaffold RNA (Scaffold RNA).

In liver cancer patient excision specimen, the expression of Hotair and the progression of disease close relation of patient energy Enough recurrences of tumor after prediction liver cancer patient liver transplantation；Tumor proliferation and aggressive can be suppressed after the external Hotair of knocking out raw Long and relevant with the sensitivity of amycin with cisplatin.In cancer of pancreas, gastrointestinal stromal and nasopharyngeal carcinoma, the expression of Hotair Level is relevant to the prognosis of tumor and disease rank, and the strong signal of the in situ hybridization of Hotair and EZH2 in aggressive breast carcinoma Then declare publicly the pernicious prognosis of patient.Simultaneously it was also found that the expression of Hotair and the methylation level of genome are relevant, especially It is relevant with the promoter methylation of Anti-oncogene PTEN.Being subsequently found, there is PRC2 and depends in Hotair effect in cancer of pancreas Rely property and dependent/non-dependent both of which, and in cell line gene knockout experiment, confirm that Hotair is relevant with cell cycle regulating.

At the beginning of 2012, this seminar has carried out express spectra and analysis of clinical to the glioma of 220 example different stages, Find that 112 lncRNAs there are differences expression between different stage glioma, wherein in High Grade Gliomas 74 LncRNAs raises and 38 downwards；Multinomial logistic regression finds that Hotair is independently of of routine pathology diagnosis index The prognostic indicator of independent patients with gliomas.Meanwhile, more significant discovery is: (Gene is analyzed in application gene set enrichment Set Enrichment Analysis, GSEA) express the mRNA of consistent rise with Hotair, find the cell of its significant enrichment Signal path is the promotion of cell cycle.Additionally, in glioblastoma multiforme, the expression of Hotair is at american cancer base Because four hypotypes of group collection of illustrative plates plan (TCGA) have obvious difference, wherein in classic and interstitial type glioblastoma multiforme Gene expression abundance is apparently higher than neuron pattern and front neuron pattern, the β-catenin/STAT3 regulation and control that this discovery and early stage find Genetic superiority expresses the classic concordance with interstitial type glioblastoma multiforme with height, Hotair Yu β-catenin/ is described Certain inherent contact is there is between STAT3 signal path；This seminar finds that Hotair effect in glioma is deposited simultaneously Match in PRC2 dependency and dependent/non-dependent both of which, such conclusion and previous studies result.Although Hotair with Tumor occurs the research of relation between development to reach its maturity, but the research to the specific inhibitor of Hotair also belongs to blank.

Summary of the invention

The present invention is contemplated to the problem solving to there is no the specific inhibitor of Hotair at present, the one proposed Hotair micromolecular inhibitor and the application in preparation tumor.

The present invention realizes according to techniques below scheme.

A kind of Hotair micromolecular inhibitor, the chemical name of described Hotair micromolecular inhibitor is 7-nitrogen-2-[4- (7-nitrogen-3-oxygen-4,9-dihydrofuran [3,2-b] quinoxaline-2-base) phenyl]-4,9-dihydrofuran [3,2-b] quinoxaline-3- Ketone, molecular weight is 540, and 5 ' ends and the EZH2 protein binding in PRC2 of its specific suppression Hotair, chemical structural formula is。

Described Hotair micromolecular inhibitor connects binding ability deltaG=-10.5kcal/ with hotair's and EZH2 mol。

The application in preparation tumor of a kind of above-mentioned Hotair micromolecular inhibitor.

Present invention obtains following beneficial effect.

The problem that the present invention effectively solves the specific inhibitor that there is no Hotair at present.Of the present invention Hotair micromolecular inhibitor can the activity of specific suppression Hotair, effectively reduce the expression of EZH2, and suppress β- The expression of catenin and PKM2；Effectively EZH2 can be suppressed to enter core in U87 cell；Mice experiment in vivo shows, it can have The growth of effect suppression breast cancer tumour model and Lung metastases, realize effective suppression to tumor.The present invention is to tumorigenesis Research with treatment has great clinical meaning, has broad application prospects.

Accompanying drawing explanation

Fig. 1 is the chemical structural formula of micromolecular inhibitor NSC372295 of the present invention；

Fig. 2 is the chemical structural formula of micromolecular inhibitor NSC372315 of the present invention；

Fig. 3 is the chemical structural formula of micromolecular inhibitor NSC372303 of the present invention；

Fig. 4 is that 3 kinds of micromolecular inhibitors of the present invention affect figure to Hotair downstream activity；

Fig. 5 is that the micromolecular inhibitor NSC372295 of variable concentrations of the present invention affects figure to Hotair downstream activity；

Fig. 6 be 3 kinds of micromolecular inhibitors of the present invention in U87 cell, EZH2 is entered core affect figure；

Fig. 7 is that micromolecular inhibitor NSC372295 of the present invention affects figure to what human breast cancer in nude mice model grew；

Fig. 8 be human breast cancer in nude mice model of the present invention is injected micromolecular inhibitor NSC372295 natural law and tumor fluorescence intensity it Between curvilinear motion figure；

Fig. 9 is to inject between micromolecular inhibitor NSC372295 natural law and gross tumor volume in human breast cancer in nude mice model of the present invention Curvilinear motion figure；

Figure 10 is that micromolecular inhibitor NSC372295 of the present invention affects figure to human breast cancer in nude mice model tumor in situ；

What Figure 11 was micromolecular inhibitor NSC372295 of the present invention on the transfer of human breast cancer in nude mice model pulmonary affects figure；

What Figure 12 was micromolecular inhibitor NSC372295 of the present invention on the transfer of human breast cancer in nude mice model pulmonary affects figure；

Figure 13 is 35th day mouse lung slice map of matched group of the present invention；

Figure 14 is 35th day mouse lung slice map of NSC372295 administration group of the present invention；

Figure 15 is 42nd day mouse lung slice map of matched group of the present invention；

Figure 16 is 42nd day mouse lung slice map of NSC372295 administration group of the present invention.

Detailed description of the invention

The present invention is described further with embodiment below in conjunction with the accompanying drawings.

One, the nucleotide sequence (NR_003716.3) of Hotair

1 cctccaggcc ctgccttctg cctgcacatt ctgccctgat ttccggaacc tggaagccta

61 ggcaggcagt ggggaactct gactcgcctg tgctctggag cttgatccga aagcttccac

121 agtgaggact gctccgtggg ggtaagagag caccaggcac tgaggcctgg gagttccaca

181 gaccaacacc cctgctcctg gcggctccca cccgggactt agaccctcag gtccctaata

241 tcccggaggt gctctcaatc agaaaggtcc tgctccgctt cgcagtggaa tggaacggat

301 ttagaagcct gcagtagggg agtggggagt ggagagaggg agcccagagt tacagacggc

361 ggcgagagga aggaggggcg tctttatttt tttaaggccc caaagagtct gatgtttaca

421 agaccagaaa tgccacggcc gcgtcctggc agagaaaagg ctgaaatgga ggaccggcgc

481 cttccttata agtatgcaca ttggcgagag aagtgctgca acctaaacca gcaattacac

541 ccaagctcgt tggggcctaa gccagtaccg acctggtaga aaaagcaacc acgaagctag

601 agagagagcc agaggaggga agagagcgcc agacgaaggt gaaagcgaac cacgcagaga

661 aatgcaggca agggagcaag gcggcagttc ccggaacaaa cgtggcagag ggcaagacgg

721 gcactcacag acagaggttt atgtattttt attttttaaa atctgatttg gtgttccatg

781 aggaaaaggg aaaatctagg gaacgggagt acagagagaa taatccgggt cctagctcgc

841 cacatgaacg cccagagaac gctggaaaaa cctgagcggg tgccggggca gcacccggct

901 cgggtcagcc actgccccac accgggccca ccaagccccg cccctcgcgg ccaccggggc

961 ttccttgctc ttcttatcat ctccatcttt atgatgaggc ttgttaacaa gaccagagag

1021 ctggccaagc acctctatct cagccgcgcc cgctcagccg agcagcggtc ggtgggggga

1081 ctgggaggcg ctaattaatt gattcctttg gactgtaaaa tatggcggcg tctacacgga

1141 acccatggac tcataaacaa tatatctgtt gggcgtgagt gcactgtctc tcaaataatt

1201 tttccatagg caaatgtcag agggttctgg atttttagtt gctaaggaaa gatccaaatg

1261 ggaccaattt taggaggccc aaacagagtc cgttcagtgt cagaaaatgc ttccccaaag

1321 gggttgggag tgtgttttgt tggaaaaaag cttgggttat aggaaagcct ttccctgcta

1381 cttgtgtaga cccagcccaa tttaagaatt acaaggaagc gaaggggttg tgtaggccgg

1441 aagcctctct gtcccggctg gatgcagggg acttgagctg ctccggaatt tgagaggaac

1501 atagaagcaa aggtccagcc tttgcttcgt gctgattcct agacttaaga ttcaaaaaca

1561 aatttttaaa agtgaaacca gccctagcct ttggaagctc ttgaaggttc agcacccacc

1621 caggaatcca cctgcctgtt acacgcctct ccaagacaca gtggcaccgc ttttctaact

1681 ggcagcacag agcaactcta taatatgctt atattaggtc tagaagaatg catcttgaga

1741 cacatgggta acctaattat ataatgcttg ttccatacag gagtgattat gcagtgggac

1801 cctgctgcaa acgggacttt gcactctaaa tatagacccc agcttgggac aaaagttgca

1861 gtagaaaaat agacatagga gaacacttaa ataagtgatg catgtagaca cagaaggggt

1921 atttaaaaga cagaaataat agaagtacag aagaacagaa aaaaaatcag cagatggaga

1981 ttaccattcc caatgcctga acttcctcct gctattaaga ttgctagaga attgtgtctt

2041 aaacagttca tgaacccaga agaatgcaat ttcaatgtat ttagtacaca cacagtatgt

2101 atataaacac aactcacaga atatattttc catacattgg gtaggtatgc actttgtgta

2161 tatataataa tgtattttcc atgcagtttt aaaatgtaga tatattaata tctggatgca

2221 ttttctgtgc actggtttta tatgccttat ggagtatata ctcacatgta gctaaataga

2281 ctcaggactg cacattcctt gtgtaggttg tgtgtgtgtg gtggttttat gcataaataa

2341 agttttacat gtggtgaata taaa

Two, the screening of micromolecular inhibitor

The micromolecular inhibitor of Hotair is that the cancer treatment plans (DTP) from american cancer academy (NIH), screening obtains. The present invention utilizes the 3D structure (MC-SYM) that computer configuation simulation Hotair 5 ' holds, and screens in combination from DTP data base The compound that site matches, and pick out the compound of matching degree front three, be respectively 7-nitrogen-2-[4-(7-nitrogen-3-oxygen-4, 9-dihydrofuran [3,2-b] quinoxaline-2-base) phenyl]-4,9-dihydrofuran [3,2-b] quinoxaline-3-ketone, named NSC372295, chemical structural formula is as shown in Figure 1；Double (4,9-dihydrofuran (2,3-b) quinoxaline-3-of 2,2 '-benzene-1,4-diyl (2H)-one), named NSC372315, chemical structural formula is as shown in Figure 2；7-chloro-2-(4-(7-chloro-3-oxo-4,9- Dihydrofuran (3,2-b) quinoxaline-2-base) phenyl)-4,9-dihydrofuran (3,2-b) quinoxaline-3-ketone, named NSC372303, chemical structural formula is as shown in Figure 3.These 3 kinds of micromolecular inhibitors all can freely obtain (station address from DTP Http:// dtp.cancer.gov/OrderAuth)

Three, the detection of micromolecular inhibitor IC50

Utilize the 503nhibiting concentration of the antagonist measured for IC50(of mtt assay three kinds of micromolecular inhibitors of detection, half Maximal inhibitory concentration), experimental technique is as follows:

(1) be in exponential phase tumor cell conventional digestion (the big ware of 100mm diameter, with 1ml pancreatin 37 ° digest 30s- 1min), it is inoculated in 96 orifice plates, inoculum concentration 4000 (200 μ l)/hole；

(2) after inoculation 24 hours, add Concentraton gradient be 100,200,300,400,500,600,700,800,900, NSC372295, NSC372315 and the NSC372303 compound of 1000ug/ml；

(3) MTT detection is carried out after processing 72hrs: the MTT liquid that concentration is 5mg/ml is added 96 orifice plates to be measured with every hole 20 μ l In, to cultivate 4 hours, carefully abandon supernatant for 37 DEG C, every hole adds DMSO 200 μ l and the 15min that vibrates has been completely dissolved crystallization, finally Measure the absorbance (A value) in each hole with ultraviolet spectrophotometer 570nm wavelength, take the average often organizing 10 holes；

(4) tumor cell survival computational methods: compare with cell (Control) conduct not doing any process, obtain test Group tumor cell survival:

(5) statistical procedures

Experimental data used uses SPSS16 statistical package to carry out statistical analysis, and one factor analysis of variance carries out adding up credit Analysis, according to P ＜ 0.05 as inspection level.

Result shows, NSC372295 IC50 value in U87 cell is 384nM, is 290nM in U87vIII； NSC372315 IC50 value in U87 cell is 297nM, is 189nM in U87vIII；NSC372303 is in U87 cell IC50 value is 356nM, is 264nM in U87vIII.

Four, the micromolecular inhibitor impact on Hotair downstream activity

Take 540mg micromolecular compound NSC372295 to be dissolved in 0.5ml DMSO, be formulated as the mother solution of 0.2M.6 orifice plates connect Planting tumor cell, cell quantity is 10-15 ten thousand, and using middle ware then inoculum concentration is 20-30 ten thousand；24h is cultivated with the DMEM of 10% FBS After, add NSC372295 mother solution and make final concentration be respectively 50,100,200 μMs, after cultivating 24h, utilize western blot to exist In glioma U87 and U87-vIII cell line, the expression of detection EZH2, β-catenin and PKM2.Western blot is concrete Method is as follows:

(1) process after cell 24h with the PBS(0.01M, pH7.4 of pre-cooling) washed cell 2 times, the albumen adding 400 l pre-coolings splits Solve liquid (0.1mol/L NaCl, 0.01mol/L Tris-Cl PH7.6,0.001mol EDTA PH8.0,1 μ g/ml Aprotinin, 100 μ g/ml PMSF, 1% NP40), put 30min in ice bath and make it fully crack.4 DEG C, 12000 revs/min are centrifuged 15min, takes supernatant 2 l NanoDrop ND-1000 and carries out protein quantification, and remaining mixture delays with equal-volume 2 × SDS loading 10 points are boiled after rushing liquid (Tris100mmol/L, DTT 200mmol/L, SDS 4%, bromjophenol blue 0.2%, glycerol 20%) mixing Clock.

(2) the of short duration centrifugal rear loading of albumen cooling, each loading hole adds about 30 μ g total proteins.The electrophoresis of 80V is extremely After dyestuff enters separation gel, voltage is increased to 150V until dyestuff arrives bottom separation gel, terminate electrophoresis.

(3) gel after electrophoresis is dipped in electrophoretic transfer liquid (25mmol/L Tris, 92 mmol/L glycine, 1g/L SDS, 20% v/v methanol, pH7.5) in balance about 20 minutes；Determine pvdf membrane equal-sized with gel and 2 3M filters therebetween Paper, is dipped in pvdf membrane in methanol 15 seconds, is dipped in rapidly in DDW 10 minutes, at electricity, pvdf membrane and 3 filter paper are turned liquid after taking-up In be impregnated with；Gel stent is opened and sets level, the sponge plate that layer overlay is impregnated with in advance on minus plate, a filter paper is laid on the moon Pole plate central authorities, drive away bubble；Gel is laid on filter paper, drives away bubble；In gel upper berth pvdf membrane, drive away bubble；Exist again One, its upper berth filter paper, drives away bubble；At one layer of the filter paper upper berth sponge plate being impregnated with, positive plate is closed, close upper bracket；To prop up Frame is inserted perpendicularly in electricity turn trough, vertically puts in transfer box together with the ice bank putting into ice, adds pre-cooling electricity and turns liquid so that it is Upper limb less than electricity turn trough；Under 4 DEG C or condition of ice bath, 80V electricity turns 60min.

(4), after electricity turns, take off PVDF, PBST(PBS pH 7.5,0.1% Tween-20) in wash 2 times each 5min.In confining liquid, room temperature closes 1h(or 4 DEG C overnight), close non-specific antibody binding site；Outwell confining liquid, add one Anti-(dilution of 1:1000 membrane closure liquid), 4 DEG C of hybridized overnight (or room temperature 3-4h)；A large amount of PBST rinse 3 each 10min；Add Two anti-(1:1000PBST dilution) room temperatures hybridize 1 hour, and a large amount of PBST rinse 3 each 10min.

(5) use chemiluminescence detection system, pvdf membrane is laid in plate, Western blot luminescent solution is added on On pvdf membrane, put in gel imaging system (Syngene, G-box), gather image.

(6) will development after pvdf membrane be dipped in 10ml elution buffer (62.5mM Tris-HCl pH6.8,2% SDS, 100mM beta-mercaptoethanol) in, 70 DEG C of water-baths are static hatches 30 minutes；3 each 5min are rinsed with PBST；Membrane closure fluid-tight is closed 1h(or 4 DEG C are overnight)；Outwelling confining liquid, carry out secondary hybridization, add one anti-(dilution of 1:1000 membrane closure liquid), 4 DEG C hybridized Night (or room temperature 3-4h)；

A large amount of PBST rinse 3 each 10min；Adding two anti-(1:1000PBST dilution) room temperatures to hybridize 1 hour, a large amount of PBST float Wash 3 each 10min.Use chemiluminescence detection system, pvdf membrane is laid in plate, by Western blot luminescent solution It is added on pvdf membrane, puts in gel imaging system, gather image.

(7) with the gray value of Quantify One software analysis purpose band, destination protein is represented with gray value size Expression.Destination protein band relative expression quantity computational methods:

As shown in Figure 4, in U87 cell, NSC372295 can maximally effective reduce compared with NSC372315, NSC372303 The expression of EZH2, and suppress the expression of β-catenin and PKM2.Can be shown that NSC372295 is under Hotair by experimental result Trip activity has best inhibition.

Further being studied in U87vIII cell, the NSC372295 cell of detection variable concentrations is under Hotair The impact of trip albumen, finds under the trace of 50nM, i.e. can reach the effect (Fig. 5) that suppression downstream PKM2 can express.

Five, micromolecular inhibitor enters the impact of core to EZH2

EZH2 plays the biological function of the H3K27 that methylates in nucleus, and the present invention utilizes immunofluorescence technique to detect little point Sub-inhibitor enters the impact of core to EZH2, and experimental technique is as follows:

(1) agent-feeding treatment or transfection processes the cell of 72 h and is inoculated in copolymerization Jiao's special culture dish, and ice PBS washes three times, often Secondary 5 minutes；

(2), when cell is half-dried, covers and fix 15 minutes with 4% cold paraformaldehyde, lucifuge；

(3) after sucking unnecessary paraformaldehyde, wash three times with the PBS of ice, each 5 minutes；

(4) 0.5 % Triton X-100 cover cell 10 minutes, and ice PBS washes three times, each 5 minutes；

(5) close 30 minutes by import hyclone room temperature；

(6) preparation one anti-(antibody recommendation amount of dilution dilution to specifications)；Adding an anti-covering cell, tinfoil wraps up 4 DEG C Lucifuge is overnight；

(7) take out cell and warm to room temperature about 1 h again；

(8) ice 1 ‰ Tween shakes and washes twice, each 5 minutes；Shaking on ice PBS shaking table washes once, 5 minutes；

(9) with PBS preparation fluorescent labeling two anti-(concentration is with reference to the anti-explanation of fluorescence two)；Add two to resist, incubated at room 1 hour (lucifuge)；

(10) ice 1 ‰ Tween shakes on shaking table and washes twice, each 5 minutes；Shaking on ice PBS shaking table washes once, 5 minutes；

(11) DAPI contaminates core, 1, every ware, covers all cell；

(12) ice 1 ‰ Tween shakes on shaking table and washes twice, each 5 minutes；Shaking on ice PBS shaking table washes once, 5 minutes；

(13) aqueous anti-fluorescent quenching mountant, lucifuge are added；

(14) Laser Scanning Confocal Microscope (Olympus, FV-1000) photograph.

As shown in Figure 6, NSC372295 is in the process of IC50 concentration compared with NSC372315, NSC372303 for experimental result Under, it is possible in U87 cell, maximally effective suppression EZH2 enters core.

Six, the growth of micromolecular inhibitor suppression mouse tumor model

The subcutaneous model in situ of mouse breast cancer is chosen in this experiment

(1) model is set up

Take MCF-7 and the MDA-MB-231 breast cancer cell of recombinant slow virus of transfection process LAN luciferase through 0.125% pancreatin Digestion, 1000rpm room temperature is centrifuged 10 minutes and removes supernatant, with PBS centrifuge washing 2 times；Calculate cell number and adjust cell concentration To 5 × 10⁷/ ml, by cell suspension in serum-free DMEM culture fluid, makes cell suspension.Then it is 100 μ l with range Sterile micro injector extracts 100 μ L (containing about 5 × 10⁶Cell) cell suspension, it is inoculated at the subcutaneous fat pad of nude mice shirtfront. After inoculation, conventional transdermal is sterilized, and is put in cage.

(2) tumor size is observed

MDA-MB-231 tumor-bearing mice is respectively randomly divided into two groups (n=6/group), DMSO treatment group and 372295 treatment groups, opens Begin to carry out the treatment of tumor.Therapeutic dose is respectively DMSO group: the DMEM 1:1 mixed solution of 100 μ l DMSO and serum-free； 372295 groups: be dissolved in the 100 μ l DMSO DMEM 1:1 mixed solution with serum-free according to 25mg/kg dosage.It is administered every other day, It is administered 2 weeks altogether.Treatment takes the method for lumbar injection to treat altogether, every time before treatment, by the length of tumor of vernier caliper measurement Footpath (L) and wide footpath (W), by formula: V=(LW²)/2 calculate gross tumor volume.Simultaneously at the 1st day for the treatment of, two groups of mices are carried out 1st secondary pollutant luminescence imaging, to understand the growing state of tumor cell, and is designated as Days 0.The most every 1 week, carry out 1 time and become Picture, continuous imaging 5 weeks.

Result shows, NSC372295 has the inhibitory action of significance to the growth of human breast cancer in nude mice, administration group compared to DMSO group, gross tumor volume has obtained obvious control (as Figure 7-9).Further, mouse breast cancer Lung metastases is ground Studying carefully discovery, 295 administration group pulmonarys in fluoroscopic examination do not find obvious metastasis inhibition effect (as shown in Figure 10-16).

SEQUENCE LISTING

<110>General Hospital of Tianjin Medical Univ.

<120>Hotair micromolecular inhibitor and the application in preparation tumor

<130> 1

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 2364

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<220>

<221> Hotair

<222> (1)..(2364)

<400> 1

cctccaggcc ctgccttctg cctgcacatt ctgccctgat ttccggaacc tggaagccta 60

ggcaggcagt ggggaactct gactcgcctg tgctctggag cttgatccga aagcttccac 120

agtgaggact gctccgtggg ggtaagagag caccaggcac tgaggcctgg gagttccaca 180

gaccaacacc cctgctcctg gcggctccca cccgggactt agaccctcag gtccctaata 240

tcccggaggt gctctcaatc agaaaggtcc tgctccgctt cgcagtggaa tggaacggat 300

ttagaagcct gcagtagggg agtggggagt ggagagaggg agcccagagt tacagacggc 360

ggcgagagga aggaggggcg tctttatttt tttaaggccc caaagagtct gatgtttaca 420

agaccagaaa tgccacggcc gcgtcctggc agagaaaagg ctgaaatgga ggaccggcgc 480

cttccttata agtatgcaca ttggcgagag aagtgctgca acctaaacca gcaattacac 540

ccaagctcgt tggggcctaa gccagtaccg acctggtaga aaaagcaacc acgaagctag 600

agagagagcc agaggaggga agagagcgcc agacgaaggt gaaagcgaac cacgcagaga 660

aatgcaggca agggagcaag gcggcagttc ccggaacaaa cgtggcagag ggcaagacgg 720

gcactcacag acagaggttt atgtattttt attttttaaa atctgatttg gtgttccatg 780

aggaaaaggg aaaatctagg gaacgggagt acagagagaa taatccgggt cctagctcgc 840

cacatgaacg cccagagaac gctggaaaaa cctgagcggg tgccggggca gcacccggct 900

cgggtcagcc actgccccac accgggccca ccaagccccg cccctcgcgg ccaccggggc 960

ttccttgctc ttcttatcat ctccatcttt atgatgaggc ttgttaacaa gaccagagag 1020

ctggccaagc acctctatct cagccgcgcc cgctcagccg agcagcggtc ggtgggggga 1080

ctgggaggcg ctaattaatt gattcctttg gactgtaaaa tatggcggcg tctacacgga 1140

acccatggac tcataaacaa tatatctgtt gggcgtgagt gcactgtctc tcaaataatt 1200

tttccatagg caaatgtcag agggttctgg atttttagtt gctaaggaaa gatccaaatg 1260

ggaccaattt taggaggccc aaacagagtc cgttcagtgt cagaaaatgc ttccccaaag 1320

gggttgggag tgtgttttgt tggaaaaaag cttgggttat aggaaagcct ttccctgcta 1380

cttgtgtaga cccagcccaa tttaagaatt acaaggaagc gaaggggttg tgtaggccgg 1440

aagcctctct gtcccggctg gatgcagggg acttgagctg ctccggaatt tgagaggaac 1500

atagaagcaa aggtccagcc tttgcttcgt gctgattcct agacttaaga ttcaaaaaca 1560

aatttttaaa agtgaaacca gccctagcct ttggaagctc ttgaaggttc agcacccacc 1620

caggaatcca cctgcctgtt acacgcctct ccaagacaca gtggcaccgc ttttctaact 1680

ggcagcacag agcaactcta taatatgctt atattaggtc tagaagaatg catcttgaga 1740

cacatgggta acctaattat ataatgcttg ttccatacag gagtgattat gcagtgggac 1800

cctgctgcaa acgggacttt gcactctaaa tatagacccc agcttgggac aaaagttgca 1860

gtagaaaaat agacatagga gaacacttaa ataagtgatg catgtagaca cagaaggggt 1920

atttaaaaga cagaaataat agaagtacag aagaacagaa aaaaaatcag cagatggaga 1980

ttaccattcc caatgcctga acttcctcct gctattaaga ttgctagaga attgtgtctt 2040

aaacagttca tgaacccaga agaatgcaat ttcaatgtat ttagtacaca cacagtatgt 2100

atataaacac aactcacaga atatattttc catacattgg gtaggtatgc actttgtgta 2160

tatataataa tgtattttcc atgcagtttt aaaatgtaga tatattaata tctggatgca 2220

ttttctgtgc actggtttta tatgccttat ggagtatata ctcacatgta gctaaataga 2280

ctcaggactg cacattcctt gtgtaggttg tgtgtgtgtg gtggttttat gcataaataa 2340

agttttacatgtggtgaata taaa 2364

SEQUENCE LISTING

<110>General Hospital of Tianjin Medical Univ.

<120>Hotair micromolecular inhibitor and the application in preparation tumor

<130> 1

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 2364

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<220>

<221> Hotair

<222> (1)..(2364)

<400> 1

cctccaggcc ctgccttctg cctgcacatt ctgccctgat ttccggaacc tggaagccta 60

ggcaggcagt ggggaactct gactcgcctg tgctctggag cttgatccga aagcttccac 120

agtgaggact gctccgtggg ggtaagagag caccaggcac tgaggcctgg gagttccaca 180

gaccaacacc cctgctcctg gcggctccca cccgggactt agaccctcag gtccctaata 240

tcccggaggt gctctcaatc agaaaggtcc tgctccgctt cgcagtggaa tggaacggat 300

ttagaagcct gcagtagggg agtggggagt ggagagaggg agcccagagt tacagacggc 360

ggcgagagga aggaggggcg tctttatttt tttaaggccc caaagagtct gatgtttaca 420

agaccagaaa tgccacggcc gcgtcctggc agagaaaagg ctgaaatgga ggaccggcgc 480

cttccttata agtatgcaca ttggcgagag aagtgctgca acctaaacca gcaattacac 540

ccaagctcgt tggggcctaa gccagtaccg acctggtaga aaaagcaacc acgaagctag 600

agagagagcc agaggaggga agagagcgcc agacgaaggt gaaagcgaac cacgcagaga 660

aatgcaggca agggagcaag gcggcagttc ccggaacaaa cgtggcagag ggcaagacgg 720

gcactcacag acagaggttt atgtattttt attttttaaa atctgatttg gtgttccatg 780

aggaaaaggg aaaatctagg gaacgggagt acagagagaa taatccgggt cctagctcgc 840

cacatgaacg cccagagaac gctggaaaaa cctgagcggg tgccggggca gcacccggct 900

cgggtcagcc actgccccac accgggccca ccaagccccg cccctcgcgg ccaccggggc 960

ttccttgctc ttcttatcat ctccatcttt atgatgaggc ttgttaacaa gaccagagag 1020

ctggccaagc acctctatct cagccgcgcc cgctcagccg agcagcggtc ggtgggggga 1080

ctgggaggcg ctaattaatt gattcctttg gactgtaaaa tatggcggcg tctacacgga 1140

acccatggac tcataaacaa tatatctgtt gggcgtgagt gcactgtctc tcaaataatt 1200

tttccatagg caaatgtcag agggttctgg atttttagtt gctaaggaaa gatccaaatg 1260

ggaccaattt taggaggccc aaacagagtc cgttcagtgt cagaaaatgc ttccccaaag 1320

gggttgggag tgtgttttgt tggaaaaaag cttgggttat aggaaagcct ttccctgcta 1380

cttgtgtaga cccagcccaa tttaagaatt acaaggaagc gaaggggttg tgtaggccgg 1440

aagcctctct gtcccggctg gatgcagggg acttgagctg ctccggaatt tgagaggaac 1500

atagaagcaa aggtccagcc tttgcttcgt gctgattcct agacttaaga ttcaaaaaca 1560

aatttttaaa agtgaaacca gccctagcct ttggaagctc ttgaaggttc agcacccacc 1620

caggaatcca cctgcctgtt acacgcctct ccaagacaca gtggcaccgc ttttctaact 1680

ggcagcacag agcaactcta taatatgctt atattaggtc tagaagaatg catcttgaga 1740

cacatgggta acctaattat ataatgcttg ttccatacag gagtgattat gcagtgggac 1800

cctgctgcaa acgggacttt gcactctaaa tatagacccc agcttgggac aaaagttgca 1860

gtagaaaaat agacatagga gaacacttaa ataagtgatg catgtagaca cagaaggggt 1920

atttaaaaga cagaaataat agaagtacag aagaacagaa aaaaaatcag cagatggaga 1980

ttaccattcc caatgcctga acttcctcct gctattaaga ttgctagaga attgtgtctt 2040

aaacagttca tgaacccaga agaatgcaat ttcaatgtat ttagtacaca cacagtatgt 2100

atataaacac aactcacaga atatattttc catacattgg gtaggtatgc actttgtgta 2160

tatataataa tgtattttcc atgcagtttt aaaatgtaga tatattaata tctggatgca 2220

ttttctgtgc actggtttta tatgccttat ggagtatata ctcacatgta gctaaataga 2280

ctcaggactg cacattcctt gtgtaggttg tgtgtgtgtg gtggttttat gcataaataa 2340

agttttacat gtggtgaata taaa 2364

Claims (3)

1. a Hotair micromolecular inhibitor, it is characterised in that: the chemical name of described Hotair micromolecular inhibitor is 7- Nitrogen-2-[4-(7-nitrogen-3-oxygen-4,9-dihydrofuran [3,2-b] quinoxaline-2-base) phenyl]-4,9-dihydrofuran [3,2-b] Quinoxaline-3-ketone, molecular weight is 540,5 ' ends and the EZH2 protein binding in PRC2 of its specific suppression Hotair, changes Structural formula is。

A kind of Hotair micromolecular inhibitor the most according to claim 1, it is characterised in that: the little molecule of described Hotair Inhibitor connects binding ability deltaG=-10.5kcal/mol with hotair's and EZH2.

3. the application in preparation tumor of the Hotair micromolecular inhibitor described in a claim 1.