CN105821041A

CN105821041A - Related gene for regulating and controlling wood development and application thereof

Info

Publication number: CN105821041A
Application number: CN201610174055.3A
Authority: CN
Inventors: 李来庚; 赵运军
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Center for Excellence in Molecular Plant Sciences of CAS
Priority date: 2012-06-01
Filing date: 2012-06-01
Publication date: 2016-08-03
Anticipated expiration: 2032-06-01
Also published as: CN105821041B

Abstract

The invention relates to a related gene for regulating and controlling wood development and application thereof, and particularly provides a novel PtMAN6 polypeptide or a coding sequence thereof. An amino acid sequence of the PtMAN6 polypeptide is shown as SEQ ID NO.:2, and the coding sequence is shown as SEQ ID NO.:1.The invention further provides a PtMAN6 gene and application of protein coded by the PtMAN6 gene. The PtMAN6 gene can reduce synthesis of xylem secondary cell walls and/or reduce accumulation of crystalline fiber biomass; mannan hydrolase of mannan hemicellulose can be enriched and degraded in plants by excessively expressing the PtMAN6; meanwhile, due to the regulating and controlling effect of the PtMAN6, the lignin content in transgenic plants is decreased, crystalline cellulose is decreased, and therefore the cost in lignocelluloses ethanol producing and paper making industry is greatly reduced; a promoter of the PtMAN6 gene has the specific duct cell positioning function and can precisely regulate and control expression of the gene in xylem duct cells.

Description

A kind of regulate and control timber grow related gene and application

The application is the divisional application of the patent application of filing date on June 1st, 2012, Application No. 201210179885.7, invention entitled " a kind of regulate and control the related gene grown of timber and application thereof ".

Technical field

The invention belongs to biotechnology and field of biological energy source, in particular it relates to a kind of regulate and control timber grow related gene and application.

Background technology

Along with being continuously increased of socio-economic development and population, the demand of the energy is got more and more by the mankind, and owing to fossil energy is limited, the price of the products such as oil rises steadily, and threatens economic stable sustainable development.

Reproducible biomass energy is one of preferable alternative energy source, and bio-ethanol is at present most to have prospect and topmost biomass energy.Since the oil crisis in 20 century 70 mid-terms, having started actively to carry out bio-ethanol development plans based on some countries of the U.S. and Brazil, since this century, global bio-ethanol yield increases sharply.Utilize in early days cereal crops such as Semen Maydis etc. as raw material production ethanol more, cause higher food prices, there is contradiction with national grain security, it is impossible to carry out large-scale production.In recent years, the state such as American-European puts into the bio-ethanol production technology and industrial practice carried out with lignocellulose as raw material in a large number, the most actively cultivates the energy crop being suitable for this country.China is also in the positive research carrying out lignocellulose ethanol fermentation.

Lignocellulose alcohol production mainly has four steps: 1 pretreatment, the structure of destruction lignocellulose, removal hinders the materials such as the lignin of saccharifying and fermentation；2 acid or enzyme hydrolysis cellulose become monosaccharide with hemicellulose；Hexose and pentose are fermented into ethanol with zymocyte by 3；4 distillation dehydration purifying ethanols so that it is reach the requirement as the energy.Wherein the 1st, the production cost of 2 steps too high, efficiency is the lowest, seriously limits the development of the fibrous biomass energy, causes lignin alcohol production cost to remain high.

Additionally, lignocellulose is also widely used in paper industry.Currently mainly there are two big class paper-making pulping process: mechanical feedback and chemical pulping.Mechanical separation paper fiber is passed through in mechanical feedback, does not remove lignin therein, can obtain high paper output, but due to the existence of lignin cause its can bleachability low, the paper of production easily turns to be yellow under light.Chemical pulping utilizes chemical substance to remove the lignin in cell wall, can obtain long and pliable and tough paper fiber, thus can produce the paper of high-quality.The bleaching of paper pulp is other one important procedure of pulp and paper industry, is mainly removed the lignin in paper pulp by chemical substance further or changes lignin chromophoric group, thus improving whiteness and the retention of whiteness of paper pulp.Traditional bleach mostly is chlorine bleaches, contains the noxious substance with strong carcinogenecity in waste water, and environmental pollution is the biggest.

Therefore this area does not also have a kind of to be suitable to produce bio-fuel and the xylplant of papermaking, and the related gene therefore grown in the urgent need to research regulation and control timber is, and develop and be applicable to produce regenerative resource and the timber variety of papermaking.

Summary of the invention

It is an object of the invention to provide a kind of regulate and control timber grow related gene and application.

In a first aspect of the present invention, it is provided that a kind of PtMAN6 polypeptide or the coded sequence of PtMAN6 polypeptide, the aminoacid sequence of described PtMAN6 polypeptide is as shown in SEQIDNO.:2, and the coded sequence of described PtMAN6 polypeptide is as shown in SEQIDNO.:1.

In a second aspect of the present invention, it is provided that PtMAN6 polypeptide or the purposes of its coded sequence, described purposes is optionally from one or more of lower group:

(1) synthesis of xylem secondary cell wall is reduced；

(2) accumulation of crystalline fibers biomass is reduced；

(3) content of lignin (preferably reducing plant stem lignin) is reduced.

In another preference, described PtMAN6 polypeptide is selected from lower group:

(I) there is the polypeptide of aminoacid sequence shown in SEQIDNO.:2 or SEQIDNO.:17；

(II) by the aminoacid sequence as shown in SEQIDNO.:2 or SEQIDNO.:17 through one or several amino acid residue replacement, lack or add and the polypeptide derivative by (1) that formed；Or

(III) homology >=90% (preferably >=95%, more preferably 98%) of aminoacid sequence shown in aminoacid sequence and SEQIDNO.:2 or SEQIDNO.:17 is by (1) derivative polypeptide.

In another preference, the coded sequence of described PtMAN6 polypeptide is selected from lower group:

I () coding has the polynucleotide of the polypeptide of aminoacid sequence shown in SEQIDNO.:2 or SEQIDNO.:17；

(ii) sequence polynucleotide as shown in SEQIDNO.:1 or SEQIDNO.:16；

(iii) polynucleotide of homology >=95% (preferably >=98%, more preferably >=99%) of sequence shown in nucleotide sequence and SEQIDNO.:1 or SEQIDNO.:16；

(iv) 5 ' ends and/or 3 ' of polynucleotide as shown in SEQIDNO.:1 or SEQIDNO.:16 are held truncates or add the polynucleotide of 1-60 (preferably 1-30, more preferably 1-10) nucleotide；Or

V polynucleotide that () described polynucleotide arbitrary with (i)-(iv) are complementary.

In a third aspect of the present invention, it is provided that a kind of method improveing plant trait, described improvement plant trait is selected from lower group: (1) reduces the secondary cell wall synthesis of plant xylem；(2) accumulation of plant crystalline fibers biomass is reduced；(3) content of plant lignin (preferably reducing plant stem lignin) is reduced；

Described method includes step: improve in described plant PtMAN6 polypeptide or the expression of its coded sequence or activity.

In another preference, described method includes step: is imported in plant cell by the coded sequence of PtMAN6 polypeptide, cultivates described plant cell, regeneration plant.

In another preference, described plant is Salicaceous Plants, preferably willow.

In a fourth aspect of the present invention, it is provided that a kind of promoter element, described promoter element is the promoter of plant PtMAN6 gene, and described promoter element has the function that plant xylem vessel cell-specific starts.

In another preference, described promoter element does not have the function of the plant special startup of xylem cambial cell.

In another preference, described promoter element is selected from lower group:

A () has the polynucleotide of sequence as shown in SEQIDNO.:3；

Homology >=95% (preferably >=98%, more preferably >=99%) of sequence shown in (b) nucleotide sequence and SEQIDNO.:3, and there are the polynucleotide of plant xylem vessel cell-specific startup function；

C () 5 ' ends and/or 3 ' of polynucleotide as shown in SEQIDNO.:3 hold truncate 1-60 (preferably 1-30, more preferably 1-6) nucleotide, and have the polynucleotide of plant xylem vessel cell-specific startup function.

In a fifth aspect of the present invention, it is provided that a kind of construction, described construction contains exogenous gene and the promoter element described in fourth aspect present invention being operatively connected with exogenous gene.

In another preference, described exogenous gene is selected from lower group:

Resistant gene, riddled basins, antigenic protein gene, RNAi gene, microRNA gene, biological preparation gene or plant quality related gene.

In a sixth aspect of the present invention, it is provided that a kind of expression cassette, described expression cassette has following element successively from 5 ' to 3 ': promoter element, gene ORF sequence and the terminator described in fourth aspect present invention.

In a seventh aspect of the present invention, it is provided that a kind of carrier, described carrier contains the promoter element described in fourth aspect present invention or the expression cassette described in sixth aspect present invention.

In a eighth aspect of the present invention, providing a kind of host cell, described host cell contains the carrier described in seventh aspect present invention or its chromosomal integration has the promoter element described in fourth aspect present invention of external source or its chromosomal integration to have the expression cassette described in sixth aspect present invention.

In a ninth aspect of the present invention, it is provided that the promoter element described in fourth aspect, the construction described in the 5th aspect or the purposes of the expression cassette described in the 6th aspect, for specific regulatory control exogenous gene in the expression of plant xylem vessel cell.

In a tenth aspect of the present invention, it is provided that a kind of method at plant xylem vessel cell specific expression exogenous gene, including step:

A () provides a construction, described construction to contain exogenous gene and the promoter element described in fourth aspect being operably connected with this exogenous gene；

B construction in step (a) is imported plant xylem vessel cell by (), it is thus achieved that xylem vessel's cell of conversion.

In should be understood that within the scope of the present invention, can be combined with each other between above-mentioned each technical characteristic and each technical characteristic specifically described in below (eg embodiment) of the present invention, thus constitute new or preferred technical scheme.As space is limited, the most tired at this state.

Accompanying drawing explanation

Drawings below is used for illustrating specific embodiments of the present invention, rather than limits the scope of the invention being defined by the claims.

Fig. 1 shows 35S:PtMAN6 over-express vector structure.

Fig. 2 shows 35S:PtMAN6-GFP over-express vector structure.

Fig. 3 shows 35S:PtMAN6AS antisense expression vector structure.

Fig. 4 shows MAN6G transient expression vector structure.

Fig. 5 shows MAN6sG transient expression vector structure.

Fig. 6 shows various transfer-gen plant phenotype.Fig. 6 A display WersternBlot detects transfer-gen plant result；Fig. 6 B display overexpression PtMAN6 (OE), wild type (WT), the phenotype of antisense expression PtMAN6 (AS) plant, scale is 20 centimetres；Fig. 6 C-Fig. 6 E shows transfer-gen plant petiole mechanical strength, and overexpressing plants (Fig. 6 D, OE) is relative to wild type (Fig. 6 C, and antisense expression plant (Fig. 6 E WT), AS) petiole deliquescing, arrow shows petiole, and scale is 10 centimetres；Fig. 6 F-Fig. 6 H shows in Fig. 6 C-Fig. 6 E the deposition of lignin in plant cane petiole respectively, and petiole is 500 microns through freehand section, phloroglucinol stain, the deposition of red display lignin, scale.

Fig. 7 shows lignin deposition and the result of variations of wood components in transgenic and wild type willow stem.Fig. 7 A)-Fig. 7 C): wild type (Fig. 7 A), PtMAN6OE (Fig. 7 B), and the freehand section phloroglucinol stain of 14 joint stems, red display lignin deposition, the accumulation of lignin in arrows myelocyte in PtMAN6AS (Fig. 7 C) plant；Fig. 7 D-Fig. 7 F: be the enlarged drawing of black surround part, the accumulation of lignin in arrows vessel cell in Fig. 7 A-Fig. 7 C respectively；Fig. 7 G-Fig. 7 I: ultraviolet detection wild type (Fig. 7 G), PtMAN6OE (Fig. 7 H), and 12 joint section in PtMAN6AS (Fig. 7 I) plant, lignified cell autofluorescence is stronger, in blueness, the cell that lignifying is more weak, autofluorescence is more weak in purple, the immature vessel cell of arrows；Fig. 7 J is the comparative result of ABSL lignin in transfer-gen plant timber, and in process LAN PtMAN6 plant (OE), lignin significantly reduces；Fig. 7 K is the comparison of crystalline cellulose in transfer-gen plant timber, and in process LAN PtMAN6 plant (OE), crystalline cellulose significantly reduces；Fig. 7 L is that the area of transfer-gen plant immaturity vessel cell changes result, and institute's survey conduit is the conduit of arrows in figure G-I；Statistical analysis uses T inspection, and * represents p < 0.05, * * and represents scale in p < 0.01, Fig. 7 A-Fig. 7 C is 500 μm；In Fig. 7 D-Fig. 7 I, scale is 100 μm, and Fig. 7 J-Fig. 7 L error line refers to the standard error of statistics.

Fig. 8 shows height and the girth analysis result of 1.5 years raw transgenic poplar timber, wherein, Fig. 8 A display overexpression PtMAN6 willow (OE), the willow of antisense expression PtMAN6 does not has notable difference with the trunk height of wild type (WT) willow；Fig. 8 B display OE, AS do not have notable difference with the girth of the butt of WT willow, and statistical analysis uses T inspection.

Fig. 9 shows the enzyme activity assay of PtMAN6；Wherein, Fig. 9 A is the optimum pH measurement result of PtMAN6, substrate is the 1%AZCL-glactomannan suspension being dissolved in the 0.1M citrate phosphate buffer that pH scope is 3.0-8.0, WT and PtMAN6 refers to the pheron (lower same) extracted from wild type and process LAN plant mature leaf respectively；The optimal reactive temperature measurement result of Fig. 9 B display PtMAN6, substrate is the 1%AZCL-glactomannan suspension of the 0.1M citrate phosphate buffer being dissolved in pH5.0；Fig. 9 C shows PtMAN6 deglycosylation result, the PtMAN6 (the first swimming lane) extracted in Werstern hybridization analysis plant, and EndoH_fProcess the protein label of PtMAN6, M: the pre-dyed of 0.5 hour (the second swimming lane) and 1 hour (the 3rd swimming lane)；Fig. 9 D is glycosylation effects enzymatic activity result, and compared with comparison (control), PtMAN6 is through EndoH_fDeglycosylation 2 hours, enzymatic activity is about reduced to original 50%.

Figure 10 shows the quantitative PCR analysis result of PtMAN6 gene in willow.Respectively from the xylem of 1 year growing poplar, phloem, spire, Lao Ye and stem apical meristem extraction RNA carries out quantitative RT PCR analysis, and in willow, Actin gene is as internal reference.

Figure 11 shows the immunolocalization analysis result of PtMAN6；Wherein, Figure 11 A and Figure 11 B is the sectional view of 1 year raw wild type willow the 6th internode, and display PtMAN6 is positioned xylem vessel's cell；Figure 11 B is the enlarged drawing at black surround position in Figure 11 A；Figure 11 C is the rip cutting figure of 1 year raw wild type willow the 6th internode, and display PtMAN6 is positioned xylem vessel's cell；Figure 11 D and Figure 11 E is the sectional view of 1 year raw wild type willow stem apical meristem, and display PtMAN6 is positioned xylem vessel's cell；Figure 11 E is the enlarged drawing at black surround position in Figure 11 D；Figure 11 F is negative control, the sectional view of 1 year raw wild type willow the 6th internode, fails any framing signal to be detected.

Figure 12 shows that PtMAN6-GFP protein localization is in plasma membrane.Stably expressing PtMAN6-GFP albumen in Figure 12 A and Figure 12 B display arabidopsis root, this protein localization is in plasma membrane；Figure 12 C and Figure 12 D, 30% sucrose plasmolysis arabidopsis root cells, display PtMAN6-GFP protein localization is in plasma membrane；Figure 12 E is the carrier for transient expression；Figure 12 F is the Werstern detection of subcellular components, and M is for indicating protein molecular, and 1 is cytosolic fraction, and 2 is membrane component；Figure 12 G and Figure 12 H particle bombardment MAN6G carrier in transient expression Figure 12 E in onion epidermis cell；Figure 12 I and Figure 12 J shows with particle bombardment MAN6sG carrier in transient expression Figure 12 E in onion epidermis cell；Figure 12 K and Figure 12 L particle bombardment carrier of CK in transient expression Figure 12 E in onion epidermis cell；A, C, G, I, K are GFP fluorescence picture；B, D, H, J, L are light field picture, and scale is 50 μm.

Figure 13 shows the relative expression levels of secondary wall formation associated transcription factor in the plant of overexpression PtMAN6.RNA extracts from 1 year growing poplar xylem, and the expression of wild type is defined as 1, and willow Actin gene is as internal reference.

Figure 14 shows in the plant of overexpression PtMAN6 that the expression with secondary wall component synthetic gene changes.In the plant of Figure 14 A display overexpression PtMAN6, gene and lignin polymerization's related gene of lignin monomer route of synthesis are suppressed；In the plant of Figure 14 B display overexpression PtMAN6, the expression of cellulosic electrode gene C esA8 that secondary wall is relevant is suppressed；In the plant of Figure 14 C display overexpression PtMAN6, the expression of the xylan synthetic gene GT43B that secondary wall is relevant is suppressed.RNA extracts from 1 year growing poplar xylem, and the expression of wild type is defined as 1, and willow Actin gene is as internal reference.

Detailed description of the invention

The present inventor, through extensively in-depth study, is found that a kind of new PtMAN6 polypeptide or its coded sequence first, and the aminoacid sequence of described PtMAN6 polypeptide is as shown in SEQIDNO.:2, and described coded sequence is as shown in SEQIDNO.:1.Additionally, the purposes of the albumen of the PtMAN6 gene that present invention also offers in plant and coding thereof, they may be used for regulating and controlling the secondary cell wall synthesis of xylem and the accumulation of regulation and control fibrous biomass；Overexpression PtMAN6 can be enriched with the mannan hydrolytic enzyme of degraded mannans hemicellulose in plant, simultaneously because the regulating and controlling effect of PtMAN6, in this transfer-gen plant, content of lignin reduces, crystalline fibers cellulose content reduces, thus reduces the cost of lignocellulose alcohol production and papermaking；Additionally, PtMAN6 albumen has special vessel cell positioning function, its gene promoter energy accuracy controlling gene expression in xylem vessel's cell.Complete the present invention on this basis.

Term

As used herein, term " polypeptide of the present invention ", " albumen of the present invention ", " PtMAN6 polypeptide ", " PtMAN6 albumen " or " hemicellulose mannose hydrolytic enzyme " can exchange use.In a preference, refer to the polypeptide with aminoacid sequence shown in SEQIDNO.:2 or SEQIDNO.:17, or its active fragment, or derivant.

The PtMAN6 polypeptide of the present invention is preferably derived from plant, preferably derives from Salicaceae, Populus, Salix or Chosenia etc..

As used herein, term " gene of the present invention ", " PtMAN6 gene " can exchange use, all referring to deriving from a kind of nucleotide sequence encoding hemicellulose mannose hydrolytic enzyme and derived sequence thereof.In a preference of the present invention, described nucleotide sequence is as shown in SEQIDNO.:1 or SEQIDNO.:16.

The PtMAN6 gene of the present invention is preferably derived from plant, preferably derives from Salicaceae, Populus, Salix or Chosenia etc..

As used herein, term " separation " refers to that material separates (if crude, primal environment is i.e. natural surroundings) from its primal environment.As the polynucleotide under the native state in active somatic cell and polypeptide do not have isolated and purified, but same polynucleotide or polypeptide are as separated with in other materials existed from native state, then be isolated and purified.

The PtMAN6 polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthesis polypeptide.The polypeptide of the present invention can be native purified product, or the product of chemosynthesis, or uses recombinant technique to produce from protokaryon or eucaryon host (such as, antibacterial, yeast, higher plant, insecticide and mammalian cell).According to the host used by recombinant production scheme, the polypeptide of the present invention can be glycosylated, can be maybe nonglycosylated.The polypeptide of the present invention may also include or not include the methionine residues initiateed.

Present invention additionally comprises and there is regulation and control xylem secondary cell wall synthesis and fibrous biomass accumulation activity and the PtMAN6 protein fragments of function and analog.As used herein, term " fragment " refers to be kept substantially the identical biological function of the natural PtMAN6 albumen of the present invention or many skins of activity with " analog ".

The polypeptide fragment of the present invention, derivant or the like may is that the polypeptide that (i) has one or more conservative or non-conservative amino acid residue (preferably conservative amino acid) to be replaced, and such substituted amino acid residue can may not be and be encoded by genetic code；Or (ii) has the polypeptide of substituted radical in one or more amino acid residues；Or (iii) mature polypeptide merges, with another compound (such as extending the compound of polypeptide half-life, such as Polyethylene Glycol), the polypeptide formed；Or polypeptide that (iv) additional aminoacid sequence is fused to this peptide sequence and is formed (such as targeting sequencing or secretion sequence or sequence or the proprotein sequence being used for this polypeptide of purification, or fusion protein).Scope known to those skilled in the art is belonged to according to these fragments of definition, derivant and analog herein.

Present invention additionally comprises the PtMAN6 polypeptide with the present invention or albumen has 50% or above (preferably more than 60%, more than 70%, more than 80%, more preferably more than 90%, more preferably more than 95%, most preferably more than 98%, such as 99%) polypeptide with same or similar function of homology or albumen.Several (usually 1-60 can be passed through in protein variants, preferably 1-30, more preferably 1-20, most preferably 1-10) replace, lack or add the derived sequence of at least one aminoacid gained, and add one or several (usually within 20 at C-terminal and/or N-terminal, within preferably 10, within being more preferably 5) aminoacid.Such as, in described albumen, when replacing with similar nature or similar aminoacid, generally will not change the function of protein, C-terminal and/or end add one or several aminoacid and generally also will not change the function of protein.These conservative variation are replaced preferably based on table 1 and produce.

Table 1

The present invention includes that PtMAN6 protein analogue can be the difference on aminoacid sequence with the difference of natural PtMAN6 albumen, it is also possible to is not affect the difference on the modified forms of sequence, or haves both at the same time.The analog of these albumen includes the natural or genetic variant of induction.Induction variant can obtain by various technology, as by radiating or being exposed to mutagenic agent and produce random mutagenesis, also by site-directed mutagenesis or other known divided biological technology.Analog also includes the analog with the residue (such as D-aminoacid) being different from natural L-amino acids, and there is non-naturally-occurring or the analog of aminoacid (such as β, gamma-amino acid) of synthesis.Should be understood that the albumen of the present invention is not limited to the above-mentioned representational albumen enumerated.

(the most the not changing primary structure) form of modification includes: the chemically derived form such as acetoxylation or carboxylated of inner or in vitro albumen.Modify and also include glycosylation, as those carry out glycosylation modified in protein synthesis and processing.This modification can carry out glycosylated enzyme (such as glycosylase or the deglycosylating enzyme of mammal) by being exposed to by albumen and completes.Modified forms also includes the sequence with phosphorylated amino acid residue (such as phosphotyrosine, phosphoserine, phosphothreonine).

Present invention also offers coding PtMAN6 polypeptide, albumen or the polynucleotide sequence of its variant.The polynucleotide of the present invention can be DNA form or rna form.DNA form includes: the DNA of DNA, genomic DNA or synthetic, DNA can be strand or double-strand.DNA can be coding strand or noncoding strand.The polynucleotide of encoding mature polypeptide include: the coded sequence of an encoding mature polypeptide；The coded sequence of mature polypeptide and various additional coding sequence；The coded sequence (with optional additional coding sequence) of mature polypeptide and non-coding sequence.

Term " polynucleotide of coded polypeptide " can be the polynucleotide including encoding such peptides, it is also possible to is the polynucleotide also including additional code and/or non-coding sequence.The invention still further relates to the variant of above-mentioned polynucleotide, its coding and the present invention have many glycosides or the fragment of polypeptide, the sum analogous to general Dedekind sum of identical aminoacid sequence.The variant of these polynucleotide can be allelic variant or the variant of non-natural generation of natural generation.These nucleotide variants include replacing variant, Deletion variants and insertion variant.As known in the art, allelic variant is the alternative forms of polynucleotide, and it is probably the replacement of one or more nucleotide, lacks or insert, but will not be from the function of the polypeptide substantially changing its coding.

The invention still further relates to have at least 50% between above-mentioned sequence hybridization and two sequences, preferably at least 70%, the polynucleotide of more preferably at least 80% homogeny.The present invention be more particularly directed to polynucleotide interfertile with polynucleotide of the present invention under strict conditions.In the present invention, " stringent condition " refers to: (1) hybridization under relatively low ionic strength and higher temperature and eluting, such as 0.2 × SSC, 0.1%SDS, 60 DEG C；Or added with denaturant during (2) hybridization, such as 50% (v/v) first phthalein amine, 0.1% calf serum/0.1%Ficoll, 42 DEG C etc.；Or (3) only homogeny between two sequences, at least more than 90%, just hybridizes when more preferably more than 95%.

It should be understood that, although the PtMAN6 gene of the present invention is preferred from willow, but (such as have more than 80% from other plant with willow PtMAN6 gene very high homology, such as 85%, 90`%, 95%, even 98% sequence thereto) other gene also within the scope of the present invention contemplates.The Method and kit for of aligned sequences homogeny is also well known in the art, such as BLAST.

The PtMAN6 nucleotide full length sequence of the present invention or its fragment generally can use the method for PCR TRAP, recombination method or synthetic to obtain.For PCR TRAP, can be according to relevant nucleotide sequence disclosed in this invention, especially open reading frame sequence designs primer, and with commercially available DNA library or the cDNA storehouse as prepared by conventional method well known by persons skilled in the art as template, amplification and obtain relevant sequence.When sequence is longer, it is often necessary to carry out twice or repeatedly PCR amplification, the fragment that the most each time amplifies is stitched together by proper order.Once obtain relevant sequence, it is possible to obtain relevant sequence in large quantity with recombination method.It is typically to be cloned into carrier, then proceeds to cell, then by conventional method relevant sequence of isolated from the host cell after propagation.

Additionally, can also be used with the method for synthetic to synthesize relevant sequence, when especially fragment length is shorter.Generally, by first synthesizing multiple small fragment, it is attached the most again obtaining the fragment that sequence is the longest.At present, it is already possible to obtained the DNA sequence of code book invention albumen (or its fragment, or derivatives thereof) completely by chemosynthesis.Then this DNA sequence can be introduced in various existing DNA moleculars (or such as carrier) as known in the art and cell.Additionally, sudden change is introduced in protein sequence of the present invention also by chemosynthesis.

The present invention also provides for including recombinant vector and the application thereof of the gene of the present invention.As the preferred mode of one, the promoter downstream of recombinant vector comprises multiple clone site or at least one restriction enzyme site.When the object of the invention gene expressed by needs, genes of interest is connected in applicable multiple clone site or restriction enzyme site, thus genes of interest is operably connected with promoter.As another kind of optimal way, described recombinant vector includes in (direction from 5 ' to 3 '): promoter, genes of interest, and terminator.If it is required, described recombinant vector can also include the element selected from lower group: 3 ' polymerized nucleosides are acidified signals；Untranslated nucleotide sequence；Transhipment and targeting nucleotide sequence；Resistance selective marker (dihydrofolate reductase, neomycin resistance, hygromycin resistance and green fluorescent protein etc.)；Enhancer；Or operator.

It is well known to those of ordinary skill in the art for preparing the method for recombinant vector.Expression vector can be bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus or other carriers.In a word, as long as it can replicate in host and stablize, any plasmid and carrier are all can be adopted.

Those of ordinary skill in the art can use known to method build containing the expression vector of gene of the present invention.These methods include recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc..When using the gene constructed recombinant expression carrier of the present invention, can be plus any enhancement mode, composing type, organizing specific type or inducible promoter before its transcription initiation nucleotide.

Including gene of the present invention, expression cassette or carrier may be used for converting suitable host cell, so that host expresses protein.Host cell can be prokaryotic cell, such as escherichia coli, streptomyces, Agrobacterium；Or the eukaryotic cell such as low, such as yeast cells；Or higher eucaryotic cells, such as plant cell.Persons skilled in the art are aware that how to select suitable carrier and host cell.Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell.When host is prokaryote (such as escherichia coli), CaCl can be used₂Method processes, it is also possible to electroporation is carried out.When host is eukaryote, can be selected for following DNA transfection method: calcium phosphate precipitation, conventional mechanical methods (such as microinjection, electroporation, liposome packaging etc.).Convert plant and be used as the method such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, such as leaf disk method, rataria conversion method, bud infusion method etc..Plant cell, tissue or organ for converting can use conventional method regeneration plant, thus obtain the plant of transgenic.

The described polypeptide of the present invention can intracellular or on cell membrane express or be secreted into extracellular.If it is required, its physics, chemical being separated and the albumen of purification of Recombinant by various separation methods with other characteristic can be utilized.These methods are well-known to those skilled in the art.The example of these methods includes (but being not limited to): conventional renaturation processes, process (salting-out method) with protein precipitant, centrifugal, the broken bacterium of infiltration, super process, ultracentrifugation, sieve chromatography (gel filtration), adsorption chromatography, ion-exchange chromatography, high performance liquid chroma-tography (HPLC) and other various liquid chromatography (LC) technology and the combination of these methods.

The invention provides the purposes of PtMAN6 polypeptide or its coded sequence, described purposes is optionally from lower group:

The synthesis reducing xylem secondary cell wall, the accumulation reducing crystalline fibers biomass, the content of reduction lignin (preferably reducing plant stem lignin).

Described PtMAN6 polypeptide is selected from lower group: (I) has the polypeptide of aminoacid sequence shown in SEQIDNO.:2 or SEQIDNO.:17；(II) by the aminoacid sequence as shown in SEQIDNO.:2 or SEQIDNO.:17 through one or several amino acid residue replacement, lack or add and the polypeptide derivative by (1) that formed；Or homology >=90% (preferably >=95%, more preferably 98%) of aminoacid sequence shown in (III) aminoacid sequence and SEQIDNO.:2 or SEQIDNO.:17 is by (1) derivative polypeptide.

The coded sequence of described PtMAN6 polypeptide is selected from lower group: (i) coding has the polynucleotide of the polypeptide of aminoacid sequence shown in SEQIDNO.:2 or SEQIDNO.:17；(ii) sequence polynucleotide as shown in SEQIDNO.:1 or SEQIDNO.:16；(iii) polynucleotide of homology >=95% (preferably >=98%, more preferably >=99%) of sequence shown in nucleotide sequence and SEQIDNO.:1 or SEQIDNO.:16；(iv) 5 ' ends and/or 3 ' of polynucleotide as shown in SEQIDNO.:1 or SEQIDNO.:16 are held truncates or add the polynucleotide of 1-60 (preferably 1-30, more preferably 1-10) nucleotide；Or the polynucleotide that (v) described polynucleotide arbitrary with (i)-(iv) are complementary.

Present invention also offers a kind of method preparing transgenic plant, including step: imported in plant cell by the coded sequence of PtMAN6 polypeptide, cultivate described plant cell, regeneration plant.

Present invention also offers a kind of method improveing plant trait, described improvement plant trait is selected from lower group: (1) reduces the secondary cell wall synthesis of plant xylem；(2) accumulation of plant crystalline fibers biomass is reduced；(3) content of plant lignin is reduced；Described method includes step: improve in described plant PtMAN6 polypeptide or the expression of its coded sequence or activity.

Present invention also offers the plant of a kind improvement, compared with wild-type plant, in described plant, the content of lignin and/or crystalline cellulose declines more than 10%, preferably declines more than 20%, more preferably declines 50%, most preferably declines more than 100%.

Described plant is Salicaceous Plants, preferably willow.

As used herein, term " promoter of the present invention ", " promoter of xylem vessel's specifically expressing ", " promoter of the special location of xylem vessel " are used interchangeably, refer to derive from plant, preferably derive from Salicaceae, the promoter element of the PtMAN6 of Populus, Salix or Chosenia etc., a kind of typical promoter element sequence of the present invention is as shown in SEQIDNO.:3.

As used herein, term " promoter " or " promoter region (territory) " refer to the nucleotide sequence of a kind of accurate and effective initial gene functional transcription, guiding gene nucleotide sequence is transcribed into mRNA, it is typically found in the upstream (5 ' end) of genes of interest coded sequence, usually, promoter or promoter region provide the recognition site of other factors necessary to RNA polymerase and correct initiation transcription.

The invention provides the promoter that a kind of xylem vessel specifically expressing is specific expressed, described promoter derives from plant, preferably derives from the PtMAN6 gene of Salicaceae.The nucleotide sequence of a kind of preferred promoter is as shown in SEQIDNO.:3.

The promoter of the present invention can efficiently, exclusively in xylem vessel's cell be expressed, and does not has any expression in cambial cell, and the promoter of the present invention may be used for specificity and improves plant xylem vessel cell characteristics.

In this article, described promoter or promoter region (territory) include the variant of promoter, and promoter variants can be by inserting or delete regulation and control region, and carry out at random or rite-directed mutagenesis etc. obtains.

Present invention additionally comprises the preferred promoter sequence (SEQIDNO.:3) with the present invention and have 50% or above (preferably more than 60%, more than 70%, more than 80%, more preferably more than 90%, more preferably more than 95%, most preferably more than 98%, such as 99%) nucleic acid of homology, described nucleic acid also has specific regulatory control and starts the function that xylem vessel's cell is expressed." homology " refers to the percentage ratio identical according to position, the similar level (i.e. sequence similarity or homogeneity) between two or more pieces nucleic acid.

It should be understood that, although the example of the present invention provides the PtMAN6 gene promoter deriving from Salicaceae, but be derived from other similar plant (especially belonging to the plant of a section or genus with willow) and promoter of the present invention there is the promoter of certain homology (conservative), it is intended to be included within the scope of the present invention, as long as the information that those skilled in the art provide according to the application after having read the application can this promoter of isolated from other plant easily.

As used herein, term " specific expressed " refers to genes of interest specific time and/or expression of specific tissue in plant.Described " expression of plant xylem vessel cell-specific " refers under the promoter regulation of the present invention, genes of interest high degree of specificity and expression in plant xylem vessel cell in specific manner.

As used herein, " external source " or " allos " refers to the relation between two or more pieces nucleic acid or the protein sequence of separate sources.Such as, if promoter is the most naturally occurring with the combination of genes of interest sequence, then promoter is external source for this genes of interest.Particular sequence is " external source " for its cell inserted or organism.

As used herein, " cis-regulating element " refers to the conservative base sequence that the transcription initiation to gene and transcriptional efficiency play regulatory role.

The promoter of the present invention can be operationally connected with exogenous gene, and this exogenous gene can be external source (allos) for promoter.Exogenous gene of the present invention (also referred to as genes of interest) has no particular limits, and can be RNAi gene or the coding gene with specific function albumen, and such as some has the albumen of key property or function in agricultural or plant improvement.

The representative example of described exogenous gene includes, but is not limited to: resistant gene, riddled basins, antigenic protein gene and biological preparation gene or plant quality related gene.

Described resistant gene is selected from lower group: anti-herbicide gene, antiviral gene, cold tolerance gene, high temperature resistant gene, anti-drought gene, waterlogging-resistant gene or anti insect gene.Described riddled basins is selected from lower group: gus (β-glucuronidase) gene, hyg (hygromycin) gene, neo (neomycin) gene or gfp (green fluorescent protein) gene.Described antigenic protein gene and biological preparation gene are selected from lower group: antibacterial class antigen protein is (such as cholera toxin B, tetanus toxin etc.), virus type antigen protein (such as Canine Parvovirus), protozoa antigen protein (ameba cause of disease LecA), autoantigen protein (such as the CTB pins of type i diabetes) or biological preparation (such as α 2b interferon, insulin like growth factor etc.).Described plant quality related gene is selected from lower group: aminoacid improvement related gene, fat improvement related gene, starch improvement related gene or male sterility related gene.

Present invention also offers a kind of expression casette, described expression cassette is from 5 '-3 ' there is following elements successively: promoter, gene ORF sequence and terminator.Preferably, described promoter sequence as shown in SEQIDNO.:3 or with homology >=95% of sequence shown in SEQIDNO.:1, preferably >=98%, more preferably >=99%.

Present invention also offers a kind of promoter including the present invention and/or the recombinant vector of expression casette.As the preferred mode of one, the promoter downstream of recombinant vector comprises multiple clone site or at least one restriction enzyme site.When genes of interest expressed by needs, genes of interest is connected in applicable multiple clone site or restriction enzyme site, thus genes of interest is operably connected with promoter.As another kind of optimal way, described recombinant vector includes in (direction from 5 ' to 3 '): promoter, genes of interest, and terminator.If it is required, described recombinant vector can also include the element selected from lower group: 3 ' polymerized nucleosides are acidified signals；Untranslated nucleotide sequence；Transhipment and targeting nucleotide sequence；Resistance selective marker (dihydrofolate reductase, neomycin resistance, hygromycin resistance and green fluorescent protein etc.)；Enhancer；Or operator.

Those of ordinary skill in the art can use known to method build containing promoter of the present invention and/or the expression vector of genes of interest sequence.These methods include recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc..

The promoter of the present invention, expression cassette or carrier, may be used for converting suitable host cell, so that host expresses protein.Host cell can be prokaryotic cell, such as escherichia coli, and streptomyces, Agrobacterium: or the eukaryotic cell such as low, such as yeast cells；Or higher eucaryotic cells, such as plant cell.Persons skilled in the art are aware that how to select suitable carrier and host cell.Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell.When host is prokaryote (such as escherichia coli), CaCl can be used₂Method processes, it is also possible to electroporation is carried out.When host is eukaryote, can be selected for following DNA transfection method: calcium phosphate precipitation, conventional mechanical methods (such as microinjection, electroporation, liposome packaging etc.).Convert plant and be used as the method such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, such as leaf disk method, rataria conversion method, bud infusion method etc..Plant cell, tissue or organ for converting can use conventional method regeneration plant, thus obtain the plant of transgenic.

A kind of optimal way as the present invention, the method preparing transgenic plant is: the carrier carrying promoter and genes of interest (both are operably connected) is proceeded to Agrobacterium, and Agrobacterium will be incorporated on the chromosome of plant containing the carrier segments of promoter and genes of interest again.The transgene receptor plant e.g. arabidopsis that relates to, Nicotiana tabacum L., fruit tree etc..

Main advantages of the present invention are:

(1) the present inventor finds that the albumen of the PtMAN6 gene in plant and coding thereof can reduce the secondary cell wall synthesis of xylem and reduce the accumulation of crystalline fibers biomass first.

(2) promoter of PtMAN6 gene has special vessel cell positioning function, can the expression in xylem vessel's cell of the accuracy controlling gene.

Below in conjunction with specific embodiment, the present invention is expanded on further.Should be understood that these embodiments are merely to illustrate the present invention rather than limit the scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, generally according to normal condition such as Sambrook et al., molecular cloning: laboratory manual (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or according to the condition proposed by manufacturer.

Experiment material and method

1. vegetable material and growing environment

Willow gene is cloned from comospore poplar (Populustrichocarpa), expression vector all proceeds in commercially available southern woods 895 kind, poplar seedlings cultivates glasshouse in the controlled environment chamber, 27 DEG C of natural lightings, and within 2 years, raw seedling transplants farm natural climate plantation.

Arabidopsis for converting is Colombia's type, plants in phjytotron 22 DEG C, and 12 hour photoperiod cultivated.

2. gene clone

The genome sequence of PtMAN6 from JGI data base download (USDepartmentofEnergy, JointGenomeInstitute (JGI),http://www.phytozome.net/poplar)。

Extract RNA by CTAB method from the xylem that comospore poplar grows, and remove DNA pollution with the DNaseI of RNase-free.

By primer 5 ' TGAATGGCTAATGGTGGCAAAGA3 ' (SEQIDNO.:4) and 5 ' TCAGGAGCCGATGGTCCATAAAA3 ' (SEQIDNO.:5) Partial cDNA Sequence by the method clone PtMAN6 of RT-PCR, then with the method for 5 ' RACE clone the 5 ' of this gene hold (Kit, Invitrogen).The complete encoding sequence of PtMAN6 is cloned with primer 5 ' CTGACTCAATACTATGGATACCC3 ' (SEQIDNO.:6) and 5 ' CTTCCTTTTCCTGTTGTGACCGA3 ' (SEQIDNO.:7).

3. gene expression analysis

Gene expression analysis uses the method for quantitative RT-PCR, the primer of design gene specific to go to expand specific genetic fragment (100-300bp).1 μ g total serum IgE PrimerScript^TMReverse Transcription box (Dalian treasured is biological) reverse transcription becomes the first chain cDNA. quantitative PCR to use SYBRgreen method at MyiQ^TMThe upper detection of Real-TimePCR instrument (Bole, the U.S.).In willow, PtActin gene is as reference gene.

4. prepared by antibody

Sequence alignment by PtMAN family gene, have selected two little peptide fragments in the non-conservative district of PtMAN6, (37 to 49 amino acids for EQFKTMVEEVDNH, SEQIDNO.14) and ELNDVEEDEWL (61 to 71 amino acids, SEQIDNO.15), by synthetic, it is injected in rabbit generation polyclonal antibody (entrusting Ai Bimate company to complete).Antibody can only detect single band through Western detection in xylem total protein.Monoclonal antibody Anti-GFP and anti-Actin buy from Ai Bimate (Chinese Shanghai) company.

5. vector construction and Plant Transformation

5.135S:PtMAN6 and 35S:PtMAN6AS vector construction:

The CDS sequence of total length PtMAN6 is with following primer 5 ' CTTTCTAGACTGACTCAATACTATGGATACCC3 ' (XbaI) (SEQIDNO.:10) and 5 ' CTGCTCGAGCCGATCAACTACTTTTACAAATC3 ' (XhoI) (SEQIDNO.:11) or:

5’CTTCTCGAGCTGACTCAATACTATGGATACCC3 ' (XhoI) (SEQIDNO.:12) and 5 ' CTGTCTAGACCGATCAACTACTTTTACAAATC3 ' (XbaI) (SEQIDNO.:13) expands, with corresponding cleavage amplified fragments, by its sub-clone to commercially available pBI121 carrier framework.

5.2 transient expression vector build:

The CDS sequence of total length PtMAN6 or its front 31 aminoacid sequences are merged with EGFP on carrier to pA7 carrier by sub-clone.The two carrier is respectively designated as MAN6G or MAN6sG.

5.335S:PtMAN6-GFP vector construction:

By CaMV35S promoter on MAN6G, PtMAN6-GFP and NOS terminator together sub-clone to pCAMBIA2300 carrier.

5.4 Plant Transformation

Stable expression, first enters GV3101 agrobacterium strains, preparation engineering bacterium by vector.

Transformation of Arabidopsis thaliana uses general agriculture bacillus mediated flower-dipping method.

Willow converts and uses general leaf disk method.

6. the extraction of inscribe-1,4-'beta '-mannase and enzyme activity determination in willow

Fresh Tissues of Poplar Clones liquid nitrogen is quickly ground to form fine powder, the pheron Extraction buffer being subsequently adding 1.5 times of volume pre-coolings places 1 hour on ice, 10000g4 DEG C of centrifugal 30min, then supernatant is filtered by Miracloth, is then concentrated and purified by the super filter tube of 10KD.The albumen of purification BCA reagent quantitative.

Colorimetry is utilized to carry out enzyme assay.Insoluble substrate A ZCL-galactomannan is bought from Megazyme (Irish), and the substrate of 1% (w/v) is dissolved in the citrate phosphate buffer (pH3.0-8.0) of 0.1M or 0.1M sodium-acetate buffer (pH5.0) makes suspension.Take the 100 above-mentioned substrate suspension of μ l and add the pheron (or BSA comparison) of 20 μ g purification, it is 200 μ l with corresponding buffer polishing to volume, it is subsequently placed in specific reaction temperature reaction 2h, period is always maintained at shake makes reaction system uniform, 100 DEG C of 5min terminate reaction, 12000g is centrifuged 5min, and in the change of 590nm survey absorbance, enzymatic activity is with A590nmmg^-1min^-1Representing, result at least wants three independent repetitions.

7.PtMAN6 deglycosylation

Analyzing for Western, the PtMAN6 of purification first passes through 100 DEG C of degeneration 10min, then adds EndoH according to description_fEnzyme (NewEnglandBiolabs) 37 DEG C processes 30min or 1h, and sample, in 100 DEG C of inactivation 10min, takes 20 μ l and carries out SDS-PAGE detection.

For Enzyme activity assay, it is directly added into the EndoH of 6000 units from the 60 μ g pherons of overexpression PtMAN6 plant or WT lines extraction_fEnzyme 37 DEG C processes 2h, and the albumen taking 20 μ g process carries out enzyme activity assay, and each sample is in triplicate.

8. plant section analysis

Lignin deposition detects: 1 year growing poplar stem or petiole freehand section, then processes 5min with the phloroglucinol (being dissolved in 12% hydrochloric acid) of 1%, and microscope is observed the most at once.

Lignin autofluorescence and the fixing stem section of conduit area measurement: FAA (5% formaldehyde, 5% acetic acid, 70% ethanol), paraffin embedding, after 10 μm section dehydrations, direct ultraviolet is observed.By ImageJ software statistics conduit area, Student ' st inspection statistics result.

9. in the present invention, the willow gene of the research number of logging in NCBI is:

PtMAN6XM_002323644, PtrPAL (XM_002326150),

PtrC4H1 (EU603304), Ptr4CL3 (XM_002297663),

PtrHCT1 (EU603313), PtrC3H1 (XM_002308824),

PtrCCoAOMT1 (XM_002313089, EU603307),

PtrCCR2/7 (EU603310, XM_002303809),

PtrCAld5H1 (EU603312), PtrCOMT2 (XM_002317802, EU603317),

PtrCAD1 (EU603306), PtrLAC17 (XM_002317469),

PtrCesA8 (XM_002316779), PtrGT43B (JF518935),

PtrWND1A (HQ215847, XM_002317023),

PtrWND1B (HQ215848), PtrWND2A (HQ215849),

PtrWND3A (XM_002322362), PtrWND3B (XM_002318252),

PtrWND4A (XM_002329829), PtrWND5A (XM_002310261),

PtrWND6A (XM_002327206), PtrMYB3 (XM_002299908),

PtrMYB20 (XM_002313267), PtrMYB28 (XM_002307154),

Pt-IAA8 (XM_002302315), PtrXCP1 (XM_002328102),

PtrACT1(XM_002298674)。

The expressed sequence of embodiment 1PtMAN6 and the clone of promoter

1. sequence information

CDS sequence complete for PtMAN6 is as follows:

Or

The aminoacid sequence of PtMAN6 albumen is as follows:

Or

The PtMAN6 promoter sequence of clone is as follows:

2. vector construction

2.1 Overexpression vector

35S:PtMAN6 Vector map is shown in Fig. 1；35S:PtMAN6-GFP Vector map Fig. 2.

2.2 antisense expression vector

Fig. 3 is shown in by 35S:PtMAN6AS collection of illustrative plates.

2.3 transient expression vector

MAN6G transient expression vector is shown in that Fig. 4, MAN6sG transient expression vector is shown in Fig. 5.

Embodiment 2 process LAN PtMAN6, makes the content of wood lignin and crystalline cellulose reduce

Western detection proves that PtMAN6 process LAN (OE) carrier and antisense (AS) expression vector successfully proceed to willow, and can express in plant, and play a role (Fig. 6 A) further.

Transfer-gen plant analysis shows, relative to WT lines, OE plant petiole and cane deliquescing (Fig. 6 B, 6C and 6D), AS plant is then contrary (Fig. 6 B, 6C and 6E), illustrates that PtMAN6 participates in the mechanical strength of regulation and control cane.Slice analysis shows further, and in OE plant petiole, the content of lignin reduces (Fig. 6 F-H).In same stem, lignin deposition also reduces (Fig. 7 A-I).Lignin and the crystalline cellulose assay of autumn wood prove PtMAN6 function further, this gene of process LAN, cause lignin and crystalline fibers cellulose content in timber to reduce (Fig. 7 J, 7K).

The biomass of embodiment 3 transgenic poplar the most substantially change

The present embodiment determines the biomass of willow, and result shows, relative to wild type, height and the girth of 1.5 years raw transgenic poplar timber do not have significant change (Fig. 8).

Fig. 8 shows height and the girth analysis result of 1.5 years raw transgenic poplar timber, wherein, Fig. 8 A display overexpression PtMAN6 willow (OE), the willow (AS) of antisense expression PtMAN6 and the trunk height of wild type (WT) willow do not have notable difference；Fig. 8 B display OE, AS do not have notable difference with the girth of the butt of WT willow, and statistical analysis uses T inspection.

Embodiment 4 transgenic plant timber monosaccharide component changes

The present embodiment determines the component of various monosaccharide in poplar wood, and result shows, in transgenic plant, timber monosaccharide component has the biggest change.Compared with WT lines (WT), the monosaccharide component of secondary cell wall enrichment in Poplar Cultivars (PtMAN6OE) timber of process LAN PtMAN6-GFP, as xylose and mannose content reduce, and corresponding primary cell wall enrichment contents of monosaccharides raises；The trend that in antisense expression Poplar Cultivars (PtMAN6AS), monosaccharide component changes is contrary with PtMAN6OE strain timber, and concrete outcome is shown in Table 1.

Monosaccharide component is measured by GC MS, and unit is μ gmg^-1AIR.In table, PtMAN6OE and PtMAN6AS represents process LAN PtiMAN6-GFP and the transgenic poplar of PtiMAN6 antisense vector respectively.Statistical analysis uses T inspection, and * represents p < 0.05, * * and represents p < 0.01 (n=4).

The willow enrichment hemicellulase β-1,4-inscribe mannase of embodiment 5 overexpression PtMAN6

The present embodiment determines the β-1 in willow plant, 4-inscribe Mannanase Activity, result shows, compared with wild type, in PtMAN6 process LAN plant, it is enriched β-1 in a large number, 4-inscribe mannase (Fig. 9), this enzyme optimal reaction pH value is 5.0, and optimal reactive temperature is 50 DEG C, and the glycosylation hydrolysing activity to maintaining PtMAN6 is most important.

Fig. 9 shows the enzyme activity assay of PtMAN6.Wherein, Fig. 9 A is the optimum pH measurement result of PtMAN6, substrate is the 1%AZCL-glactomannan suspension being dissolved in the 0.1M citrate phosphate buffer that pH scope is 3.0-8.0, WT and PtMAN6 refers to the pheron (lower same) extracted from wild type and process LAN plant mature leaf respectively；The optimal reactive temperature measurement result of Fig. 9 B display PtMAN6, substrate is the 1%AZCL-glactomannan suspension of the 0.1M citrate phosphate buffer being dissolved in pH5.0；Fig. 9 C shows PtMAN6 deglycosylation result, the PtMAN6 (the first swimming lane) extracted in Werstern hybridization analysis plant, and EndoH_fProcess the protein label of PtMAN6, M: the pre-dyed of 0.5 hour (the second swimming lane) and 1 hour (the 3rd swimming lane)；Fig. 9 D is glycosylation effects enzymatic activity result, and compared with comparison (control), PtMAN6 is through EndoH_fDeglycosylation 2 hours, enzyme is lived and is reduced to original 50%.

Embodiment 6PtMAN6 gene can be as xylem vessel's cell marking gene

The methods analyst PtMAN6 gene of the present embodiment quantitative RT-PCR, in the expression of different parts, finds that PtMAN6 predominant expression is in xylem (Figure 10).Further immunohistochemical analysis, finds that PtMAN6 is special and is positioned willow immature xylem vessel cell.Framing signal (Figure 11) all can not be detected in cambial cell, xylem fibre cells and parenchyma cell.Therefore this gene can be as the marker gene of xylem vessel's cell.

Figure 10 shows the quantitative PCR analysis result of PtMAN6 gene in willow.Respectively from the xylem of 1 year growing poplar, phloem, spire, Lao Ye and stem apical meristem extraction RNA carries out quantitative RT PCR analysis, and in willow, Actin gene is as internal reference.Figure 11 shows the immunolocalization analysis result of PtMAN6.Wherein, Figure 11 A and Figure 11 B is the sectional view of 1 year raw wild type willow the 6th internode, and display PtMAN6 is positioned xylem vessel's cell；Figure 11 B is the enlarged drawing at black surround position in Figure 11 A；Figure 11 C is the rip cutting figure of 1 year raw wild type willow the 6th internode, and display PtMAN6 is positioned xylem vessel's cell；Figure 11 D and Figure 11 E is the sectional view of 1 year raw wild type willow stem apical meristem, and display PtMAN6 is positioned xylem vessel's cell；Figure 11 E is the enlarged drawing at black surround position in Figure 11 D；Figure 11 F is negative control, the sectional view of 1 year raw wild type willow the 6th internode, fails any framing signal to be detected.

The location of embodiment 7PtMAN6-GFP albumen

The present embodiment is expressed and transient expression PtMAN6-GFP in onion epidermis cell by stable in arabidopsis, and result all shows that PtMAN6 protein localization spreads all over whole cell, including nucleus and kytoplasm in plasma membrane, the comparison display GFP signal only turning GFP.

The expression of embodiment 8PtMAN6 negative regulation wood formation related gene

Quantitative RT-PCR testing result shows, in PtMAN6 overexpressing plants, the PtrWND (PtrWNDA-PtrWND6A) relevant to wood formation and some myb transcription factors (PtrMYB3,20,28) all lower (Figure 13), the biosynthetic pathway of lignin gene relevant to secondary wall synthesis, the expression of cellulosic electrode gene (CesA8) and xylan synthetic gene (GT43B) has declined (Figure 14).PtMAN6 is by these genes of negative regulation thus have impact on the thickening of normal cell wall, have impact on Wood Properties Within further.

Figure 14 shows in the plant of overexpression PtMAN6 that the expression with secondary cell wall composition synthesis related gene changes.In the plant of Figure 14 A display overexpression PtMAN6, gene and lignin polymerization's related gene of lignin monomer route of synthesis are suppressed；In the plant of Figure 14 B display overexpression PtMAN6, the expression of cellulosic electrode gene C esA8 that secondary wall is relevant is suppressed；In the plant of Figure 14 C display overexpression PtMAN6, the expression of the xylan synthetic gene GT43B that secondary wall is relevant is suppressed.RNA extracts from 1 year growing poplar xylem, and the expression of wild type is defined as 1, and willow Actin gene is as internal reference.

The all documents mentioned in the present invention are incorporated as reference the most in this application, are individually recited as with reference to like that just as each document.In addition, it is to be understood that after the above-mentioned teachings having read the present invention, the present invention can be made various changes or modifications by those skilled in the art, these equivalent form of values fall within the application appended claims limited range equally.

Claims

1. a promoter element, it is characterised in that described promoter element is the promoter of plant PtMAN6 gene, and described promoter element has the function that plant xylem vessel cell-specific starts；

Preferably, described promoter element does not have the function of the plant special startup of xylem cambial cell；

It is preferred that described promoter element is selected from lower group:

A () has the polynucleotide of sequence as shown in SEQIDNO.:3；

2. a construction, it is characterised in that described construction contains exogenous gene and the promoter element described in claim 1 being operatively connected with exogenous gene；

It is preferred that described exogenous gene is selected from lower group:

3. an expression cassette, it is characterised in that described expression cassette has following element successively from 5 ' to 3 ': promoter element, gene ORF sequence and the terminator described in claim 1.

4. a carrier, it is characterised in that described carrier contains the promoter element described in claim 1 or the expression cassette described in claim 3.

5. a host cell, it is characterised in that described host cell contains the carrier described in claim 4 or its chromosomal integration has the promoter element described in claim 1 of external source or its chromosomal integration to have the right the expression cassette described in requirement 3.

6. the promoter element described in claim 1, the construction described in claim 2 or the purposes of the expression cassette described in claim 3, it is characterised in that for specific regulatory control exogenous gene in the expression of plant xylem vessel cell.

7. the method at plant xylem vessel cell specific expression exogenous gene, it is characterised in that include step:

A () provides a construction, described construction to contain exogenous gene and the promoter element described in claim 1 being operably connected with this exogenous gene；

8. a PtMAN6 polypeptide or the coded sequence of PtMAN6 polypeptide, it is characterised in that the aminoacid sequence of described PtMAN6 polypeptide is as shown in SEQIDNO.:2, or the coded sequence of described PtMAN6 polypeptide is as shown in SEQIDNO.:1.

9.PtMAN6 polypeptide or the purposes of PtMAN6 polypeptid coding sequence, it is characterised in that described purposes is optionally from one or more of lower group:

(1) synthesis of xylem secondary cell wall is reduced；

(2) accumulation of crystalline fibers biomass is reduced；

(3) content of lignin (preferably reducing plant stem lignin) is reduced；

Preferably, described PtMAN6 polypeptide is selected from lower group:

(II) by the aminoacid sequence shown in SEQIDNO.:2 or SEQIDNO.:17 through one or several amino acid residue replacement, lack or add and the polypeptide derivative by (1) that formed；Or

(III) homology >=90% (preferably >=95%, more preferably 98%) of aminoacid sequence shown in aminoacid sequence and SEQIDNO.:2 or SEQIDNO.:17 is by (1) derivative polypeptide；

It is preferred that described PtMAN6 polypeptid coding sequence is selected from lower group:

(ii) sequence polynucleotide as shown in SEQIDNO.:1 or SEQIDNO.:16；

10. the method improveing plant trait, wherein, described improvement plant trait is selected from lower group:

(1) the secondary cell wall synthesis of plant xylem is reduced；

(2) accumulation of plant crystalline fibers biomass is reduced；

(3) content of plant lignin (preferably reducing plant stem lignin) is reduced；

It is characterized in that, including step: improve in described plant PtMAN6 polypeptide or the expression of its coded sequence or activity；

Preferably, described method includes step: is imported in plant cell by the coded sequence of PtMAN6 polypeptide, cultivates described plant cell, regeneration plant.