CN105820227A - Multiple improved orange/red fluorescence protein - Google Patents

Abstract

The invention relates to multiple improved orange/red fluorescence protein. By modification of amino acid sequence of red fluorescence protein DsRed from Discosoma sp., the obtained novel fluorescence protein has different characteristics from a wild type. A brighter monomer structure orange fluorescence protein similar to mOrange2 is obtained, and the fluorescent brightness is 2.0 times higher than fluorescent brightness of the mOrange2. According to the invention, a novel purple red fluorescence protein is also obtained, and the fluorescence protein has specific maximum excitation wavelength and maximum emission wavelength. The invention also relates to research of the improved fluorescence protein applied in multi-fields. Positioning, tracing, functional display and the like of target proteins in cells, subcells and in-vivo tissues can be analyzed.

Description

Multiple modified model orange/red fluorescent protein

Technical field

The present invention relates to some follow-on orange/red fluorescent proteins, by to the transformation from coral polyp Discosomasp. red fluorescent protein DsRed sequence, gained novel fluorescence albumen and wild type have the features such as visibly different color (excitation spectrum and emission spectrum), fluorescence intensity.The invention still further relates to the clone of above-mentioned fluorescence protein gene, expression and can with albumen N end or C end merge, cell line or living animal are expressed, target proteins can carry out the location in cell, subcellular fraction and biological tissue, spike, function displaying etc. carries out multiple analysis.

Background technology

Fluorescin, as molecular label, has a wide range of applications in terms of analyzing biotechnology and intracellular molecules spike.Especially in the application aspect of cellular elements image, fusion protein technology can be passed through, fluorescin is fused on certain target proteins intracellular, with labelling and analyze target proteins in intracellular location, be distributed and move and with the interaction of other intracellular molecules.Fluorescence labels is numerous, how to select fluorescin preferably to show spike and the function of target proteins, mainly considers the following aspects: 1) fluorescent protein expression brightness is high, avirulence；2) fluorescin has good light stability；3) polymeric fluorescin can not be selected；4) fluorescin can not be sensitive to express cell or organizational environment factor；5) multichannel to be had, the fluorescin of non-interference.

Red fluorescent protein drFP583 (DsRed) is from Discosomasp. isolated (Matzetal., NatureBiotech.17:969-973 (1999), Grossetal., Proc.Nat ' LAcad.Sci.USA97:11990-11995 (2000)), its advantage is apparent: can share with GFP line fluorescent albumen, and excite and to launch wavelength longer, intracellular imaging background is low, good pardon can be had with existing copolymerization Jiao and wide visual field microscope optical filter etc., the penetrance of HONGGUANG is particularly suited for the imaging to living animal tissue, thus red fluorescent protein is particularly important.In mammalian cell, either the light of red light district is still absorbed and is all greatly reduced by autofluorescence, and therefore the development of red fluorescence probe specimen thick for detection and living animal imaging are all very important.In follow-up fluorescence uses, gradually in the singulation of fluorescin, adapt to many cells Zonal expression, fluorescent stability etc. are many-sided more demand to red fluorescent protein, and DsRed is 4 glycoprotein polyprotein precursors, the form of high aggregation is unfavorable for protein fusion expression to observe the expression and localization of albumen, the ability of function etc., has therefore carried out the work of more massive red fluorescent protein screening mutant.But after DsRed is sported monomer, its light stability is greatly shortened, it is impossible to meet the imaging requirements that copolymerization is burnt, and owing to changing the structure of luminous body, easily form the red fluorescent protein of more different colours differences.Therefore, the focus that current red fluorescent protein is evolved concentrates in two targets, and first improves the current monomer red fluorescent protein that oneself has so that the features such as their fluorescent characteristic or stability optimize further；Second is the fluorescin that exploitation can glow, and even emission band is in the fluorescin of far-infrared band.The short several years, a series of researchs to red fluorescent protein, it is greatly enriched the spectral diversity of fluorescin, provides more fluorescence labels for intracellular multi-color marking.

MOrange2 obtains orange-red Fluorescence Mutation of A body for sudden change from DsRed protein-base, and its excitation spectrum is 549nm, and emission spectrum is 565nm.Both can glow under red fluorescence, it is also possible to issue orange light in fluorescent orange.Relative to DsRed red fluorescent protein, mOrange2 defines the monomeric form being more beneficial for protein fusion expression, and protein maturation speed is fast, but though fluorescence intensity is declined slightly, though its light stability is poorer than the DsRed tetramer, but relative to most of monomer red fluorescent proteins, its light stability can ensure that the imaging requirements (table 1) that copolymerization is burnt completely.Due to mOrange2 obvious light stable superiority, with the albumen of its amalgamation and expression can clearly indicate under the Laser Scanning Confocal Microscope of high intensity albumen intracellular or tissue in expression fluoroscopic image (NathanC.Shaner etc., Improvingthephotostabilityofbrightmonomericorangeandredf luorescentproteins.NatMethods.2008；5 (6): 545-551).

Table 1: the fluorescent characteristic of red fluorescent protein

The present invention is intended to the sequence of DsRed as template, the structure site of its fluorescence structure is carried out saturation mutation, and add the library of random mutation to screen monomer structure, fluorescence intensity is high, the red fluorescent protein of the characteristics such as light stability is strong, i.e. ensure monomer structure be suitable to target proteins amalgamation and expression on the basis of, emphasis optimizes its brightness and light stability.Present invention obtains the high brightness fluorescent albumen that 3 plant mutants are different colours, wherein the brightness of strain fluorescent red-orange albumen OFPSpark (sRFP10) is remarkably reinforced, and can preferably strengthen the fluorescin brightness after protein fusion.Another strain sRFP2 albumen is the fluorescin of a new excitation wavelength, relative to common red fluorescent protein, this fluorescin excite and to launch wavelength longer, there is certain characteristic.

Summary of the invention

One aspect of the present invention, it is provided that a kind of new fluorescin OFPSpark (sRFP10), this fluorescin is to be suddenlyd change by DsRed red fluorescent protein, it is characterized in that by aminoacid sequence shown in SEQ.ID.NO:7 contains E10P, R17H, E32V, H41F, Q64H, K83L, F99Y, T147S, replaced by corresponding aminoacid on L150M, E160K, L225Q position.Described fluorescin excitation peak is 549nm, and emission peak is 566nm, in orange red, and can reflected fluorescent light under orange and red excitation spectrum respectively.(excitation peak of DsRed is 558nm compared with Parent Protease, emission peak is 583nm), described fluorescin is monomeric form, and remains the strongest fluorescent brightness, can can obtain good representation in multiple mammalian cell, inspire obvious fluorescence.

Another aspect of the present invention, it is provided that a kind of by the fluorescin sRFP2 of aminoacid sequence shown in SEQ.ID.NO:5, this fluorescin is to be suddenlyd change by DsRed red fluorescent protein, wherein comprises following aminoacid and replaces: E10Q, V16I, R17Y, E32V, R36K, H41T, K47Q, A64H, C116T, F117L, K121H, M141L, A145P, L150N, I161N, K163M, V175C, Q188K, Y193H, S197Y, I210V, G219A, L225Q.With Parent Protease ratio, its spectral region red shift, described fluorescin excitation peak is 577nm, and emission peak is 602nm, in the most beautiful a kind of aubergine.

Another aspect of the present invention, providing a kind of by the fluorescin sRFP12 of aminoacid sequence shown in SEQ.ID.NO:9, this fluorescin is to be suddenlyd change by DsRed red fluorescent protein, wherein comprises following aminoacid and replaces: E10P, R17H, E32V, R36K, K47Q, K83C, L85A, I210Y, L225Q.With Parent Protease ratio, described fluorescin excitation peak is 547nm, and emission peak is 565nm, in the most beautiful a kind of rose.

Another aspect of the present invention, additionally provides OFPSpark and sRFP2 fluorescin and is expressed in target proteins in various kinds of cell device and carries out amalgamation and expression, can detect the multiple uses such as the expression of intracellular target proteins, location, and labelling interaction protein.OFPSpark fluorescence protein gene sequence will be placed on the N end of target proteins or after C end merges, it is loaded in the expression vector of mammalian cell, by expression vector transfectional cell in different ways or biological tissue, after transfecting 24～120 hours, fluoroscopic image can be observed under specialty fluorescence imaging device.

Accompanying drawing explanation

Fig. 1: highly purified 3 strain red mutation cloned proteins solution, the color of sRFP2, OFPSpark (sRFP10) and sRFP12 is the purplishhest red, orange red and rhodo；

Fig. 2: the fluorescence spectrometry of red fluorescence mutain, wherein transverse axis is wavelength, and the longitudinal axis is fluorescence intensity, the maximum excitation wavelength 578nm of result display sRFP2, optimal transmitting wavelength 602nm；The maximum excitation wavelength 549nm of OFPSpark (sRFP10), optimal transmitting wavelength 566nm；The maximum excitation wavelength 548nm of sRFP12, optimal transmitting wavelength 565nm；

Fig. 3: pCMV3-sRFP2, pCMV3-sRFP10 and pCMV3-sRFP12 be express fluorescent protein intensity in 293H cell, red fluorescence is gone out under scope is 532.5～587.5nm wavelength channel exciting lights, the fluorescence intensity of sRFP10 is the brightest, the fluorescence intensity of sRFP12 is taken second place, and the fluorescence intensity of sRFP2 is the most weak；

Fig. 4: pCMV3-OFPSpark (sRFP10) and pCMV3-mOrange2 be express fluorescent protein intensity in 293H cell and Hela cell, red fluorescence is gone out under scope is 532.5～587.5nm wavelength channel exciting lights, in 2 kinds of cells, the OFPSpark brightness than mOrange2 is remarkably reinforced；Fluorescent orange is gone out under scope is 503.5～547.5nm wavelength channel exciting lights；In 293H cell, the OFPSpark brightness than mOrange2 is remarkably reinforced.

The SDS-PAGE gel electrophoresis of protein detection of Fig. 5: mOrange2 and OFPSpark；

Fig. 6: mOrange2 (figure A) and the SEC-HPLC detection of OFPSpark (figure B)；

The pH Stability Determination of Fig. 7: mOrange2 and OFPSpark, the pH stability of OFPSpark is slightly better than mOrange2；

The fluorescence extinction coefficient detection of Fig. 8: mOrange2 (upper figure) and OFPSpark (figure below), the fluorescence extinction coefficient of mOrange2 albumen is 50000M^-1cm^-1, the fluorescence extinction coefficient of OFPSpark albumen is 84000M^-1cm^-1；

The transmitting light wave spectrum of Fig. 9: mOrange2 and OFPSpark, under identical protein concentration, the wave spectrum area launching light of mOrange2 is 122736, and the wave spectrum area launching light of OFPSpark is 216142, and its emissioning light spectrum is stronger 1.8 times than mOrange2；

The light stability characteristic (quality) detection under ultraviolet high light of Figure 10 A:OFPSpark and mOrange2 albumen, its result is similar to；Figure 10 B is under Laser Scanning Confocal Microscope, and the high-strength light of 561nm red-light spectrum stimulates the light stability detection of lower OFPSpark and mOrange2, and its result displays that similar；

Figure 11: OFPSpark with genes of interest fusion expression vector schematic diagram, figure A be OFPSpark be placed on genes of interest N end express carrier schematic diagram, figure B be OFPSpark be placed on genes of interest C end express carrier schematic diagram；

Figure 12: pCMV-TUBB-OFPSpark tubulin TUBB fusion protein expresses figure in Hela cell, and exciting light is to go out red fluorescence under 561nm wavelength channel exciting light；

Figure 13: pCMV-GOLM1-OFPSpark Golgi apparatus protein GOLM1 fusion protein is expressed in Hela cell, and exciting light is to go out red fluorescence under 561nm wavelength channel exciting light；

Figure 14: pCMV-ACTB-OFPSpark Cytoskeleton protein A CTB fusion protein is expressed in Hela cell, and exciting light is to go out red fluorescence under 561nm wavelength channel exciting light；

Figure 15: pCMV-LAMP1-OFPSpark lysosomal protein LAMP1 fusion protein is expressed in Hela cell, and exciting light is to go out red fluorescence under 561nm wavelength channel exciting light；

Figure 16: pCMV-CCNE1-sRFP2 Nuclear extract CCNE1 fusion protein is expressed in Hela cell, and exciting light is to go out red fluorescence under 561nm wavelength channel exciting light.

Detailed description of the invention

The structure of embodiment 1.DsRed mutated library:

nullBy the analysis to DsRed (aminoacid sequence is shown in SEQ.ID.NO:1) protein structure of the Discoverystudio4.0 software，Find out 48 sites that may affect DsRed structure，These 48 sites are: R2，S4，K5，E10，V16，R17，T21，E32，R36，H41，N42，V44，K47，Q64，F65，Q66，V71，V73，K83，L85，F91，E99，C117，F118，F124，I125，V127，T147，L150，R153，V156，E160，I161，H162，K163，A164，L174，V175，F177，S179，I180，Y192，Y194，S197，I210，T217，G219，L225，These 48 points are staggered and is divided into 12 groups (tables 2)，Respectively the aminoacid often organizing each site is done saturation mutation，This results in the gene bank of 12 groups of saturation mutations；Additionally by fallibility PCR method, DsRed gene is carried out random mutation, obtain one group of mutant gene storehouse；The method of these 13 groups of mutant gene application DNAShuffling is recombinated at random, inserts pQE30 carrier, set up pQE30-DsRed-DS library, to obtaining the saltant type of fluorescence spectrum variation.

The mutation library of table 2:13 group DsRed

Sudden change library name	Mutation method	Mutational site
			DsRed-m1	Fixed point saturation mutation	R2, K47, F124, L174
DsRed-m2	Fixed point saturation mutation	S4, Q64, I125, V175
			DsRed-m3	Fixed point saturation mutation	K5, F65, V127, F177
DsRed-m4	Fixed point saturation mutation	E10, Q66, T147, S179
			DsRed-m5	Fixed point saturation mutation	V16, V71, L150, I180
DsRed-m6	Fixed point saturation mutation	R17, V73, R153, Y192
			DsRed-m7	Fixed point saturation mutation	T21, K83, V156, Y194
DsRed-m8	Fixed point saturation mutation	E32, L85, E160, S197
			DsRed-m9	Fixed point saturation mutation	R36, F91, I161, I210
DsRed-m10	Fixed point saturation mutation	H41, E99, H162, T217
			DsRed-m11	Fixed point saturation mutation	N42, C117, K163, G219
DsRed-m12	Fixed point saturation mutation	V44, F118, A164, L225
			DsRed-m13	Fallibility PCR suddenlys change	At random

Head and the tail at DsRed gene design primer respectively, and add BamHI and the PstI site that can connect entrance carrier, forward primer sequence is RFP-Bam-F:5 ' GGAGGATCCATGGATAGCACTGAGAACGTCA3 ' (SEQ.ID.NO:2), and downstream primer sequence is RFP-Pst-R:5 ' GGACTGCAGCTACTGGAACAGGTGGTGGC3 ' (SEQ.ID.NO:3).At middle catastrophe point, the saturated design of primers of forward is " NNK ", reverse saturated design of primers is " NNM ", the most often group gene needs to design 4 to mutant primer, expand for template segmentation with plasmid pcDNA3-DsRed, then synthesize complete DsRed-m1～DsRed-m12 mutant gene storehouse by over-lap PCR method with head and the tail primer sets.

Carrying out fallibility PCR with plasmid pcDNA3-DsRed for template with RFP-Bam-F/RFP-Pst-R primer equally and expand total length DsRed random mutation gene bank, be randomly incorporated into mutational site, fallibility PCR condition is: 6mMMgCl₂And 5mMMnCl₂In the presence of, by dATP, dGTP, dCTP, dTTP press different proportion mixing, carry out fallibility PCR, and PCR cycle condition is: 94 DEG C, 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 50s, 30 circulations；72 DEG C of 5min, form DsRed-m13 mutation library.

Becoming the band less than 300bp with DNaseI catapepsis after taking 10 μ gDsRed-m1～DsRed-m12 and the mixing of 10 μ g fallibility PCR primer DsRed-m13 respectively, agarose gel reclaims the band between 50-200bp.Taking the DNA mixture that 200ng glue reclaims the 50-200bp of purification, add 5 μ l10xTaqbuffer, 2 μ ldNTP, 0.5 μ ltaq enzyme, splice, cycling condition is: 94 DEG C of 5min；94 DEG C of 30s, 50 DEG C of 30s, 72 DEG C of 50s, 25 circulations；72 DEG C, 5min.Taking the PCR primer above 10 μ l, it is template, adds 10 μ l10xTaqbuffer, 4 μ ldNTP, 1 μ ltaq enzyme and head and the tail l10 μM of RFP-Bam-F/RFP-Pst-R of primer 2 μ, carries out PCR amplification, and cycling condition is: 94 DEG C, 5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 50s, 30 circulations；72 DEG C, 5min.After having expanded, glue reclaims purification 680bp band, after BamHI+PstI double digestion with through as the pQE30 carrier of double digestion be attached reaction, electricity turns XL1-Blue cell, adds 1mlSOC and cultivates based on 37 DEG C, and 180rmp cultivates 40min recovery cell, take 500 μ l and be coated with LB-AT (Amp Yu Tet resistance) plate, average 5 μ l are coated with one piece of plate, cultivate 14h for 37 DEG C and take out plate, put room temperature and observe.Remainder bacterium solution adds glycerol and has prepared in library in-20 DEG C of preservations, DsRed-DS.

The screening of embodiment 2.DsRed mutant clon:

By uniform for DsRed-DS library coated plate in ZYM-AT self-induction culture medium flat plate (1% tryptone, 0.5% yeast extract, 25mMNa₂HPO₄, 25mMKH₂PO₄, 50mMNH₄Cl, 5mMNa₂SO₄, 0.5% glycerol, 0.05% glucose, 0.2%a-lactose, 2mMMgSO₄, 0.2x trace element, 1% agar and 50 μ g/mLAmp) on, 30 DEG C of overnight incubation, the monoclonal in DsRed-DS library is expressed mutant fluorescent protein, is presented different brightness and color.Observe plate, brighter red colonies marking pen is irised out.Lower step preparation ZYM-AT self-induction fluid medium, in 96 hole depth orifice plates, every hole adds in 200 μ lZYM-AT fluid mediums.Then being picked out by the red colonies that these are brighter and be seeded in 96 orifice plates, choose 1820 clones altogether, all deep-well plates put into 30 DEG C, and 200rpm shaking table is cultivated 16h and carried out fluorescent protein expression.To overnight express bacterium solution PBS 5 times (20 μ l bacterium solution+80 μ lPBS) of dilution, detect by microwell plate detecting system SpectraMaxM5, first with length scanning, 96 orifice plate samples are carried out coarse scan, scanning result shows, the excitation peak of all mutants is between 530-590nm, and emission peak, between 550-610nm, writes down excitation peak and the emission peak in every hole, each hole corresponding excitation peak and emission peak detect, and measure the fluorescent value of each sample.Through a large amount of screenings, picking the clone that 3 strains can stably excite the high fluorescent value red fluorescent protein of different colours, be respectively designated as sRFP2, sRFP10, sRFP12, sequence is shown in Table 3.

nullBy pQE30-sRFP2、pQE30-sRFP10、PQE30-sRFP12 monoclonal chooses in LB bacteria culture media 37 DEG C，200rpm overnight incubation，It is inoculated in 200mlZYM-AT self-induction fluid medium by 0.5%，37℃，After 20h cultivated by 240rpm shaking table，Harvested by centrifugation bacterium solution，Results thalline (BECKMANCOULTERAvantiJ-26XPI，6500RPM/15min)，By thalline: buffer 1: 20 adds lysis buffer BufferA (50MmTris，pH8.0，500mMNaCl)，Stirring and evenly mixing，High pressure homogenize crusher machine (ATS，200Pa twice，800pa is each)，Centrifugal collection supernatant (BECKMANCOULTERAllegraTM64RCentrifuge，12000RPM/30min)，0.45 μm membrane filtration，Obtain the supernatant of clarification，By Ni post on sample constant flow pump，(use bufferA in advance，3 column volume balances)，Turn on UV lamp simultaneously，On-line monitoring，On sample complete after，With bufferA, UV is balanced to baseline，Stepwise elution step by step，10%B，15%B，20%B，50%B，100%B (bufferB:50mMTris，pH8.0，500mMNaCl，500mMImidazole)，Collect each eluting peak respectively.Denaturing electrophoretic monitoring purity, crosses SephadexG-25Fine post desalination to PBS by component qualified for purity.Fig. 1 shows the visual color of 3 kinds of sudden change RFP albumen, and wherein sRFP2 is aubergine, and sRPF10 is orange red, and sRPF12 is rose.The emission peak of detection these three albumen and excitation peak: concrete mode is: 1) launch wavelength and be set to 0, scanning excitation spectrum A (setting excitation wavelength sweep limits as 200～700nm)；2) fluorescence emission spectrum: find out the wavelength absorbing the strongest (or secondary strong) correspondence and (set transmitting wavelength scanning range as excitation wavelength+5nm～700nm) as excitation wavelength, scanning emission spectrum；3) fluorescence excitation spectrum: find out wavelength corresponding to absorption the strongest (or secondary strong) as transmitting wavelength, scanning excitation spectrum.Fig. 2 shows the fluorescence spectrum of sRFP2, sRFP10, sRFP12, wherein the maximum excitation wavelength 577nm of sRFP2, optimal transmitting wavelength 602nm；The maximum excitation wavelength 549nm of sRFP10, optimal transmitting wavelength 566nm；The maximum excitation wavelength 547nm of sRFP12, optimal transmitting wavelength 565nm (being shown in Table 3).

Table 3: the characteristic of sudden change redness clone and sequence

Embodiment 3.sRFP saltant type fluorescin and the structure of mOrange2 fluorescin carrier for expression of eukaryon and expression:

Use primer sRFP-inf-F:5 ' GGTACCGCTAGCGGATCCATGGATAGCACTGAGAACGTCA3 ' (SEQ.ID.NO:10) and sRFP-inf-R:5 ' GGCCGCTCTAGACTCGAGCTACTGGAACAGGTGGTGGC3 ' (SEQ.ID.NO:11) respectively with this 3 plant mutant type for template amplification sRFP2, sRFP10 and sRFP12 gene, in infusion enzyme is connected into carrier for expression of eukaryon pCMV3, identify and obtain correct plasmid pCMV3-sRFP2, pCMV3-sRFP10 and pCMV3-sRFP12.Purification obtains pCMV3-sRFP2, pCMV3-sRFP10 and the pCMV3-sRFP12 plasmid transfection 293H cell of transfection level purity.Concretely comprise the following steps: the 293H cell DMEM culture medium containing 10% hyclone, cultivate under 37 DEG C and 5% carbon dioxide conditions. before transfection, by cell by 1 × 10⁵The density of cells/well is inoculated in 24 orifice plates, is used for transfecting after cultivating 24h, and cell density is 70%～90%.2 μ gDNA and a certain amount of PEI (in PEI: the ratio of DNA=5: 1 is added) is respectively diluted to final concentration with 50 μ L dilution buffer (25mmol/LHepes, 150mmol/LNaCl, pH7.1).PEI solution after dilution is added dropwise in DNA solution, mixing of vibrating immediately, after room temperature stands 30min, is added to mixed liquor be covered with in 24 orifice plates of cell, 37 DEG C of cultivations in the incubator of 5% carbon dioxide after shake mixing.Respectively at 24h, 48h, 72h fluorescence microscope fluorescence, select the brightest time period shooting photo (Fig. 3).Its result shows, under scope is 532.5～587.5nm wavelength channel exciting lights, the expression of sRFP10 is the brightest, and the color of this albumen is orange red, and its fluorescence spectrum is also consistent with mOrange2, therefore by named for this albumen OFPSpark.

Primer mOrange2-inf-F:5 ' GGTACCGCTAGCGGATCCATGGTGAGCAAGGGCGAGG3 ' (SEQ.ID.NO:12) and mOrange2-inf-R:5 ' GGCCGCTCTAGACTCGAGTTACTTGTACAGCTCGTCCATGC3 ' (SEQ.ID.NO:13) amplification is used to obtain the nucleotide sequence of mOrange2.In infusion enzyme is connected into carrier for expression of eukaryon pCMV3, identifies and obtain correct plasmid pCMV3-mOrange2 (SEQ.ID.NO:14).Extract the transfection level plasmid obtaining pCMV3-mOrange2 and pCMV3-sRFP10 (OFPSpark), transfect 293H and Hela cell.Concrete steps, with above, select the brightest time period shooting photo (Fig. 4).Its result shows, for the red fluorescence of high brightness under scope is 532.5～587.5nm wavelength channel exciting lights, OFPSpark expression in 2 kinds of cells is significantly stronger than mOrange2, for fluorescent orange under scope is 503.5～547.5nm wavelength channel exciting lights, OFPSpark expresses and is also better than mOrange2.

The mensuration of embodiment 4.OFPSpark fluorescin character:

The production of 1.OFPSpark and mOrange2 fluorescin:

Concrete grammar is the same, uses pQE30-sRFP10 (OFPSpark), two kinds of expression plasmids of pQE30-mOrange2 to cultivate 1L expression product, and centrifugal broken bacterium obtains the supernatant of clarification, and Ni column purification obtains highly purified fluorescin, desalination to PBS.The SDS-PAGE electrophoresis result of OFPSpark and mOrange2 albumen is shown in Fig. 5, and display mOrange2 is more bigger than OFPSpark molecular weight for protein band result, all 28～30kD, matches with its theoretical molecular.Purifying protein uses the molecular size range of SDS-PAGE analyzing proteins, use the granular size of SEC-HPLC analysis of fluorescence albumen, the HPLC appearance time of the mOrange2 that molecular weight is bigger is 17.768 minutes, and the appearance time of the HPLC of the OFPSpark that molecular weight is smaller is 18.468 minutes (Fig. 6).This result display OFPSpark albumen is the same with mOrange2 albumen, is the structure of monomer.

2.OFPSparkpH value stabilization measures

PH stability assay method is: the buffer of configuration pH3 to pH12 is standby, with the buffer configured, fluorescin is diluted to 20 μ g/ml, excites with the maximum excitation wavelength of fluorescin, detect fluorescence signal with maximum emission wavelength；Record the fluorescence signal value under corresponding pH value, value the strongest for fluorescence signal is defined as 100%, calculate the fluorescence intensity percentage ratio under corresponding pH value, the pH value under 50% fluorescence intensity is defined as pKa.Fig. 7 shows that the pKa of mOrange2 is 6.8, and the pKa of OFPSpark is 6.2.The pH tolerance mOrange2 to be slightly better than of OFPSpark.PH stability is the lowest, shows that albumen can preferably adapt to the expression of multi-environment system, it is ensured that its range of application is unrestricted.

The mensuration of 3.OFPSpark extinction coefficient

Computing formula according to extinction coefficient: e=A/bc wherein e is extinction coefficient；A is absorbance；C is the concentration of material in solution；B is light light path in the solution.Utilize the concentration of the fluorescin of BCA method detection production, according to the concentration measured, the buffer of sample pH8.0 is diluted to 10 μ g/ml, 20 μ g/ml, 40 μ g/ml, 80 μ g/ml and 160 μ g/ml in 1cm light path cuvette, detects light absorption value；According to light absorption value and the molar concentration mapping of corresponding fluorescin, the fitting a straight line of detection, from computing formula, read extinction coefficient value.Fig. 8 shows that the extinction coefficient of mOrange2 are 50000M^-1cm^-1, the extinction coefficient of OFPSpark are 84000M^-1cm^-1.This result shows that the absorbing properties of OFPSpark is 1.7 times of mOrange2.

4.OFPSpark quantum yield measures

This research detects fluorescin quantum yield by reference method, according to formula: Yu=Ys*Fu/Fs*As/Au；Yu, Ys are the quantum yield of test substance and reference material；Fu, Fs are the integrated fluorescence intensities of test substance and reference material；Au, As are test substance and the reference material light absorption value (A=ebc) (for 548nm) under selected excitation wavelength.The buffer of fluorescent samples pH8.0 is diluted to 20 μ g/ml under the conditions of selected excitation wavelength, with 1cm light path cuvette detects light absorption value, wherein OFPSpark light absorption value under 548nm excitation wavelength is 0.035, and mOrange2 light absorption value under 548nm excitation wavelength is 0.023；Simultaneously by this sample under selected wavelength condition, carry out spectral scan, derive empirical value, map after arrangement, carry out wave spectrum integration.Light absorption value detection obtained, integrated fluorescence intensities, the quantum yield value of reference substance is brought formula into and is calculated the quantum yield obtaining test substance.Analyze the fluorescence emission area under spectrum obtained and see that excitation spectrum strength ratio mOrange2 (light area under spectrum is 122736) of Fig. 9, OFPSpark (light area under spectrum is 216142) is strong 1.8 times.According to quantum yield computing formula, the quantum yield of the mOrange2 in list of references, the quantum yield being calculated OFPSpark is 0.69, slightly above mOrange2 is quantum yield (NathanC.Shaner etc., the Improvingthephotostabilityofbrightmonomericorangeandredf luorescentproteins.NatMethods.2008 of 0.60；5 (6): 545-551).

5.OFPSpark brightness detects

Fluorescent brightness is the energy intensity that the extinction coefficient product with quantum yield of albumen, the i.e. energy absorption of fluorescin are converted to launch light.Calculating according to this formula, the fluorescent brightness of OFPSpark is 58, and the fluorescent brightness of mOrange2 is 29.4.Brightness ratio mOrange2 of OFPSpark is high 2.0 times.This result also difference results with both fluorecytes expression in cell matches.

6.OFPSpark light stability detects

MOrange2 and OFPSpark of 50 μ g/ml is positioned under ultraviolet intense light conditions irradiation, different time points sampling fluorescence intensity by this research simultaneously；With initial fluorescence intensity for 100%, calculate the fluorescence intensity percentage ratio of different time, with time and the deactivation rate of fluorescence intensity plotted as percentage analysis of fluorescence albumen.The light stability matter of Figure 10 A display mOrange2 with OFPSpark is similar, all remains relatively good light stability.

By the transfection level plasmid transfection HeLa cell of pCMV3-mOrange2 and pCMV3-OFPSpark (sRFP10).Concrete steps are with above, and transfection 48h selects light cell and detects for photobleaching.NikonA1 laser scanning co-focusing microscope is used to carry out fluorescin photobleaching detection.Object lens are CFIApoTIRF60x, and numerical aperture (N.A.) is 1.49；Laser selects 561nm passage (red-light spectrum), and photomultiplier transit light (photomultiplier) voltage is 80V；Readings region area (ROI) is 15600 μm 2 (130 μm * 120 μm).Bleaching process reads first order fluorescence value every 1.55s, reads 25 times altogether.Map for vertical coordinate with fluorescence intensity with the fluorescent bleach time as abscissa, analyze the fluorescence intensity change with bleaching time of mOrange2 and OFPSpark.The fluorescence intensity change similar trend under relatively light laser is bleached of Figure 10 B display OFPSpark and mOrange2, display OFPSpark Yu mOrange2 has close light stability characteristic (quality).

The structure of embodiment 5.OFPSpark fluorescin fusion protein expression vector and expression:

nullBy tubulin TUBB，Cytoskeleton protein A TCB，ORF (without the termination codon) gene order of lysosomal protein LAMP1 and Golgi apparatus protein GOLM1 expands out with respective special primer，And on upstream and downstream primer, introduce HindIII and NheI site respectively，TUBB-F，5 ' GGCCGCCACCAAGCTTATGAGGGAAATCGTGCACAT3 ' (SEQ.ID.NO:15)，TUBB-R，5 ' ACCATGGATCCGCTAGCGGCCTCCTCTTCGGCCT3 ' (SEQ.ID.NO:16)，GOLM1-F，5 ' GGCCGCCACCAAGCTTATGGTGGACCTCCAGACACGG3 ' (SEQ.ID.NO:17)，GOLM1-R，5 ' ACCATGGATCCGCTAGCGAGTGTATGATTCCGCTTTTCACG3 ' (SEQ.ID.NO:18)，LAMP1-F，5 ' GGCCGCCACCAAGCTTATGGCTGCCCCCGGCAG3 ' (SEQ.ID.NO:19)，LAMP1-R，5 ' CCATGGATCCGCTAGCCATGCTGTTCTCGTCCAGCAGACA3 ' (SEQ.ID.NO:20)，ActB-F，5 ' GGCCGCCACCAAGCTTATGGATGATGATATCGCCGC3 ' (SEQ.ID.NO:21)，ActB-R，5 ' CCATGGATCCGCTAGCGAAGCATTTGCGGTGGACG3 ' (SEQ.ID.NO:22).The gene order that 4 genes need to express is obtained by PCR.It is building up to (Figure 11) in pCMV3-N-OFPSpark or pCMV3-C-OFPSpark carrier by HindIII+NheI double digestion, it is allowed to form amalgamation and expression form with OFPSpark, obtain pCMV3-LAMP1-OFPSpark, pCMV3-ACTB-OFPSpark, pCMV3-GOLM1-OFPSpark, pCMV3-TUBB-OFPSpark expression vector (is shown in Table 4).These fusion plasmids are transfected Hela cell, and transfection method is ibid.Detecting after expressing 48h, observe fluorescence with Confocal confocal fluorescent microscope, exciting light is 561nm (red range), and shoots photo.Test display: OFPSpark can apply to the location of eukaryotic cell with these gene fusion expressions, and the folding on amalgamation and expression genes of interest does not affect (Figure 12,13,14,15).

Table 4:OFPSpark fusion protein sequence

Clone	Nucleotide sequence	Aminoacid sequence
			pCMV3-LAMP1-OFPSpark	SEQ.ID.NO:23	SEQ.ID.NO:24
pCMV3-ACTB-OFPSpark	SEQ.ID.NO:25	SEQ.ID.NO:26
			pCMV3-GOLM1-OFPSpark	SEQ.ID.NO:27	SEQ.ID.NO:28
pCMV3-TUBB-OFPSpark	SEQ.ID.NO:29	SEQ.ID.NO:30

The structure of sRFP2 fluorescin fusion protein expression vector and expression: expand out with respective special primer by ORF (without the termination codon) gene order of nucleoprotein CCNE1, and on upstream and downstream primer, introduce HindIII and NheI site respectively, CCNE1-F, 5 ' GGCCGCCACCAAGCTTATGCCGAGGGAGCGCAGG3 ' (SEQ.ID.NO:31), CCNE1-R, 5 ' CCATGGATCCGCTAGCCGCCATTTCCGGCCCGC3 ' (SEQ.ID.NO:32).The gene order that CCNE1 bar gene needs to express is obtained by PCR.It is building up in pCMV3-C-sRFP2 carrier by HindIII+NheI double digestion, is allowed to form amalgamation and expression form with OFPSpark, it is thus achieved that pCMV3-CCNE1-sRFP2 expression vector (is shown in Table 5).This fusion plasmid is transfected Hela cell, and transfection method is ibid.Detecting after expressing 48h, observe fluorescence with Confocal confocal fluorescent microscope, exciting light is 561nm (red range), and shoots photo.Test display: sRFP2 can send beautiful red fluorescence with CCNE1 gene fusion expression, can be applicable to nuclear location, and the folding on amalgamation and expression genes of interest does not affect (Figure 16).

Table 5:sRFP2 fusion protein sequence

Clone	Nucleotide sequence	Aminoacid sequence
			pCMV3-CCNE1-sRFP2	SEQ.ID.NO:33	SEQ.ID.NO:34

Claims (9)

1. orange/the red fluorescent protein of a Fluorescence Increasing type, it is characterised in that:

A) nucleotides sequence is classified as SEQ.ID.NO:6, and the aminoacid sequence of its encoding proteins is SEQ.ID.NO:7；

B) aminoacid sequence and SEQ.ID.NO:7 have the mutant of 95% homology；

C) it is the mutant of coral polyp Discosomasp. red fluorescent protein DsRed；

D) E10P is comprised, the orange/red fluorescent protein of R17H, E32V, H41F, Q64H, K83L, F99Y, T147S, L150M, E160K, L225Q site amino acids sudden change；

E) comprising E10P, R17H, E32V, K83L, L225Q be arbitrary or orange/the red fluorescent protein of combination site amino acid mutation；

F) this fluorescin is fluorescent orange under scope is 503.5～547.5nm wavelength channel exciting lights, for the red fluorescence of high brightness under scope is 532.5～587.5nm wavelength channel exciting lights.

2. a novel red fluorescin, it is characterised in that:

A) nucleotides sequence is classified as SEQ.ID.NO:4, and the aminoacid sequence of its encoding proteins is SEQ.ID.NO:5；

B) aminoacid sequence and SEQ.ID.NO:5 have the mutant of 95% homology；

C) it is the mutant of coral polyp Discosomasp. red fluorescent protein DsRed；

D) E10Q is comprised, V16I, R17Y, E32V, R36K, H41T, K47Q, A64H, C116T, F117L, K121H, M141L, A145P, L150N, I161N, K163M, the red fluorescent protein of V175C, Q188K, Y193H, S197Y, I210V, G219A, L225Q site amino acids sudden change；

E) this fluorescin is the red fluorescence of high brightness under scope is 532.5～587.5nm wavelength channel exciting lights.

3. positioning the method that destination protein is expressed at cell, living animal, the method includes:

A) technique for gene engineering is used to be merged by the enhancement mode orange described in destination protein gene and claim 1/red fluorescent protein gene (nucleotides sequence is classified as SEQ.ID.NO:6)；

B) gene order of fusion protein is inserted in applicable expression vector；

C) by fusion protein expression vector transfectional cell or living animal, and cultivate the suitable time under the optimal culture conditions of above-mentioned cell and live body, it is thus achieved that comprise the expression of the orange/red fluorescent protein fusion protein of SEQ.ID.NO:7 aminoacid sequence；

D) under the optimal excitation spectrum of fluorescin described in claim 1, destination protein expression and localization in cell, living animal is observed.

4., in the method described in claim 3, enhancement mode orange/red fluorescent protein gene order can be placed on the C end of genes of interest or N end carries out amalgamation and expression.

5., in the method described in claim 3, the expression vector being suitable for, including but not limited to mammal carrier for expression of eukaryon pCMV3, also comprises antibacterial, insecticide, yeast and Lentiviral, and its carrier is characterised by:

A) transcription initiation region required for expressive host is comprised；

B) nucleotide sequence of orange/red fluorescent protein that claim 1 is comprised is comprised；

C) transcript termination regions required for expressive host is comprised.

6., in the method described in claim 3, the express cell system being suitable for is including but not limited to mammalian cell, insect cell, yeast cells and antibacterial.

7. the method described in claim 3 may be used for the expression and localization of testing goal albumen, the interaction between albumen, the function of Expression element, organelle instruction function.

8. the cell expressing enhancement mode orange/red fluorescent protein or live body, it is characterised in that:

A) expression vector of orange/red fluorescent protein described in claim 1 is comprised；

B) expression vector of the fusion protein of orange/red fluorescent protein described in claim 1 is comprised；

C) during above-mentioned expression vector can dissociate or be reconstituted in the genome of cell or live body；

D) may be used for cell, the spike of live body or functional analysis.

9. positioning the method that destination protein is expressed at cell, living animal, the method includes:

A) technique for gene engineering is used to be merged at N end or the C end of gene by the Enhanced red fluorescent protein gene (nucleotides sequence is classified as SEQ.ID.NO:4) described in destination protein gene and claim 2；

B) gene order of fusion protein is inserted in applicable expression vector；

C) by fusion protein expression vector transfectional cell or living animal, and cultivate the suitable time under the optimal culture conditions of above-mentioned cell and live body, it is thus achieved that comprise the expression of the red fluorescent protein fusion protein of SEQ.ID.NO:5 aminoacid sequence；

D) under the optimal excitation spectrum of fluorescin described in claim 2, destination protein expression and localization in cell, living animal is observed.