CN105802965A - Primer pair, probe and kit for detecting SEPT7P2-PSPH fusion genes - Google Patents
Primer pair, probe and kit for detecting SEPT7P2-PSPH fusion genes Download PDFInfo
- Publication number
- CN105802965A CN105802965A CN201610300303.4A CN201610300303A CN105802965A CN 105802965 A CN105802965 A CN 105802965A CN 201610300303 A CN201610300303 A CN 201610300303A CN 105802965 A CN105802965 A CN 105802965A
- Authority
- CN
- China
- Prior art keywords
- probe
- primer
- sept7p2
- fusion gene
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a combined product of a primer pair and a probe for detecting SEPT7P2-PSPH fusion genes. The nucleotide sequence of a primer of the primer pair is represented by SEQ ID NO.1, and the nucleotide sequence of the other primer of the primer pair is represented by SEQ ID NO.2; and the nucleotide sequence of the probe is represented by SEQ ID NO.3. The invention further discloses a kit containing the combined product of the primer pair and the probe and a detection method of the SEPT7P2-PSPH fusion genes. Aiming at the detection of the SEPT7P2-PSPH fusion genes, specific primers and fluorescence probes are designed, the detection sensitivity and specificity of the SEPT7P2-PSPH fusion genes are improved, and the false positive rate is low.
Description
Technical field
The invention belongs to technical field of molecular biological detection, be specifically related to a kind of for detecting SEPT7P2-PSPH fusion gene
Primer to, probe and test kit.
Background technology
Nasopharyngeal carcinoma (Nasopharyngeal carcinoma, NPC) is a kind of the most unbalanced malignant tumor of Area distribution, for grade of malignancy
One of higher tumor, its sickness rate is first of hals,Nasen und Ohrenheilkunde malignant tumor.China is high risky area of nasopharyngeal carcinoma, according to world health
The data of tissue (WHO) international cancer research institution (IARC), in year of world statistics in nasopharyngeal carcinoma new cases 64796 people,
China reaches 28022 people, accounts for 43.2%；Except Guangdong Province and other Hunan, four provinces occurred frequently, south China, Jiangxi, Guangxi and Fujian
Outside, some countries around Southeast Asia, Africa and Mediterranean also have higher sickness rate, and these populations add up, nasopharynx
Cancer threatens number more than 400,000,000.Showing according to epidemiology of immigration research, it is low that prevalent area in China resident migrates the U.S., Australia etc.
After sending out country's several years, although nasopharyngeal carcinoma sickness rate has declined, but still far above local resident, therefore nasopharyngeal carcinoma be commonly called as " in
State's cancer " (Chinese cancer), although prompting living environment changes, but the heredodiathesis of himself is likely to nasopharyngeal carcinoma
Continue one of key factor occurred frequently.
Nasopharyngeal carcinoma (NPC) is a kind of polygenic inheritance disease (polygenetic diseases), its morbidity and something lost
The multiple tumorigenesis factors such as biography factor (genetic predisposition), ebv infection, environmental factors, dietary habit are relevant.Nasopharyngeal carcinoma is fallen ill
Position is hidden, and particularly at pharyngeal recess and nasopharynx roof, early symptom is inconspicuous, easy delay diagnosis and treatment.Many special
Family scholar is devoted to the early diagnosis of finding effective method to assist nasopharyngeal carcinoma always, observation of curative effect and Index for diagnosis, but at present
The pathogenesis of nasopharyngeal carcinoma is the most fully aware of, and therapeutic effect is the most undesirable, and within 5 years, survival rate is still hovered about 50%, and it is former
Cause is main and nasopharyngeal carcinoma site of pathological change is hidden, nasopharynx part organizational composition is complicated, and therapeutic modality is more single, lack specific treatment medicine
Thing is relevant, and different Nasopharyngeal Carcinoma Patients histological type, tumor differentiation degree, medical time lesion severity, clinical manifestation,
Physical condition, difference to Concurrent Chemoradiotherapy Sensitivity aspect all various degrees.The development of adjoint Protocols in Molecular Biology, with
The biological marker that nasopharyngeal carcinoma is relevant more and more receives publicity, if it is possible to find the mechanism that these crowds are susceptible, identify one or
Several nasopharyngeal carcinoma susceptibility genes, so that it may develop high-risk group's kit for screening, early diagnosis kit pointedly, also can develop
Go out special novel targets medicine, not only there is important theory value and academic significance, also will there is great economic worth and society
Can benefit.Therefore, the early stage realizing nasopharyngeal carcinoma is examined by the specificity molecular marker that searching nasopharyngeal carcinoma early diagnosis and prognosis are correlated with
Disconnected and individualized treatment has far reaching significance.
SEPT7P2(septin 7pseudogene 2,ENSG00000214765,synonyms:DKFZp313J1114,SEPT13,
SEPT7B), it is positioned at No. 7 chromosome 7p12.3, minus strand, has 13 exons, have now been found that owing to variable sheer can have
9 kinds of transcripts, for pseudogene not encoding proteins.Septins family is conservative gtp binding protein, it is possible to as dynamic,
Regulatable scaffolds raises other albumen, with film power, vesicle motion, apoptosis, cytoskeleton restructuring, infection, nerve
Degeneration is closely related with the formation of tumor.PSPH (Phosphoserine Phosphatase) belongs to phosphotransferase subfamily,
The albumen of this gene expression belongs to phosphotransferase (phosphotransferases) subfamily, and PSPH is positioned at No. 7 chromosomes
Galianconism 7p11, the 3rd step and final step of regulation and control Serine synthesis, catalysis depends on the L-phosphoserine of magnesium ion, also
Participate in Serine and the exchange of L-phosphoserine.This enzyme is responsible for Serine synthesis the 3rd step and final step, is catalyzed magnesium
The hydrolysis of the L-phosphoserine of ionic dependent, simultaneously participates in Serine and the interchange reaction of L-phosphoserine.The life related to
Thing path is mainly serine anabolism and carbon metablism path. and serine path is albumen, the synthesis of nucleic acid, esters provides necessary
Precursor, so this metabolism cell proliferation includes that tumor cell plays an important role.Have been reported for many years and demonstrate,prove from genome and function
The activation of bright serine synthesis path causes tumor.Pubmed document is reported, serine in the cloudy breast carcinoma cell strain of the three of 70%
Synthesis path all raises, regulation and control serine and the synthesis of glycine, promote tumor growth, serine synthesis path to be formed with tumor,
Shift relevant.SEPT7P2 and PSPH the two gene is adjacent, is respectively positioned on chromosome 7, is that minus strand is transcribed under normal circumstances,
When there is pathological changes, 1 exon exon1 of SEPT7P2 gene and 4 exon exon4 of PSPH gene is fused into
The activation of path causes tumor.Research shows, SEPT7P2-PSPH fusion gene is likely to be present in including nasopharyngeal carcinoma many
Planting in entity tumor, but the recall rate with nasopharyngeal carcinoma is the highest, SEPT7P2-PSPH fusion gene patient has the clinical special of distinctness
Levying, pointing out this target spot is the molecular marked compound that nasopharyngeal carcinoma specificity is higher.SEPT7P2-PSPH merges variation and is the most reflected
It is set to a unique molecular isoform of nasopharyngeal carcinoma.SEPT7P2-PSPH fusion gene positive patient has the clinical pathology of its uniqueness
Feature；Detection for this target spot, it will help nasopharyngeal carcinoma early diagnosis and develop special target drug and open nasopharyngeal carcinoma
The frontier of targeted therapy.
The technical method that detection fusion gene is common in the world at present has: RT-polymerase chain reaction (RT-PCR), fluorescence are former
Position hybridization (FISH) and immunohistochemistry (IHC) etc..
RT-PCR is the wide variety of deformation of one of PCR, and in RT-PCR, a RNA chain is reversed record becomes complementary
DNA, then carry out DNA cloning as template by PCR.RT-PCR is probably and confirms that the one of fusion gene is quickly examined
Disconnected method, in theory, the advantage of this technology is the hypersensitivity of its detection sudden change transcription, and as found, amplified production is then anticipated
Taste fusion gene.But in clinical practice, this technology faces lot of challenges: (1) complex operation step, easily pollutes；(2)
Paraffin-embedded tissue DNA height fragmentation fixed by formalin, is unfavorable for detection；(3) often there is false positive in PCR result,
It is difficult to as routine clinical detection method.
FISH is to hybridize with target DNA with specific fluorescent label probe, connects upper fluorescein by immunocytochemical procedures
Label, in fluorescence microscopy Microscopic observation probe labelling or the technology in site.FISH is the side that detection fusion gene is more special
Method, it is advantageous that can business development plurality of probes, be applied to detection fusion gene.Although FISH is a kind of sensitive and special
The method of detection fusion gene, but the most safe against all possibilities, the therapeutic strategy of varying number break signal and result interpretation
The most still without unified standard.In addition the experimental implementation of FISH detection is more complicated, and sample disposal is the most relatively difficult to detect, and easily goes out
Existing false-positive result, costly, needs certain equipment, makes FISH be difficult to promote in clinical application.
IHC refer to the specific antibody of band developer labelling histiocyte in situ by antigen antibody reaction and histochemical in
Colour response, carries out a new technique qualitative, that position, quantitative determine to corresponding antigens.The sharpest edges of IHC are detection tumors
The expression of specific antigen and do not lose cell and the characteristics of organizational structure that can differentiate normal structure and pathological tissue.For biopsy group
Knitting section uses tissue staining certainly to express to detect egg, and result is probably faint and local, and IHC method is constantly present one simultaneously
Fixed subjectivity, the judgement to weak positive findings needs to verify by technology such as FISH further.
Real-Time Fluorescent Quantitative PCR Technique (rea1-time fluorescent quantitative PCR, FQ-PCR) in 1996 by
Applied Biosystems company of the U.S. releases, and it is a kind of addition one while adding pair of primers when PCR expands
Specific fluorescent probe, this probe is an oligonucleotide, two ends one reporter fluorescence group of labelling and a quenching fluorescence respectively
Group.When probe is complete, the fluorescence signal that reporter group is launched is quenched group absorptions；When just starting, probe is combined in DNA
On an arbitrary strand；During PCR amplification, 5 ' ends-3 of Taq enzyme ' hold 5 prime excision enzyme activity to be degraded by probe enzyme action, make reporter fluorescence
Group separates with quenching fluorescence group, thus fluorescence monitoring system can receive fluorescence signal, the most often one DNA of amplification,
A fluorescence molecule is just had to be formed, it is achieved that the accumulation of fluorescence signal forms Complete Synchronization with PCR primer.This technology not only realizes
Quantitative to DNA profiling, and there is highly sensitive, specificity and reliability is higher, can realize multiple reaction, automatically
The features such as change degree height, nonstaining property, tool real-time and accuracy, are widely used to molecular biology research and medical science at present
The fields such as research.
But yet there are no the report that SEPT7P2-PSPH fusion gene is detected by application fluorescent quantitative PCR technique.Cause
This, need the fast and convenient detection SEPT7P2-PSPH fusion gene of exploitation a kind of sensitivity height, high specificity, and energy badly
Product and method.
Summary of the invention
For above-mentioned prior art, the present inventor, through performing creative labour and substantial amounts of test, has obtained can be used in detection
The primer of SEPT7P2-PSPH fusion gene to and probe, and have surprisingly found that, described primer to and probe in detecting
The high specificity of SEPT7P2-PSPH fusion gene, highly sensitive.Thus provide following invention:
One aspect of the present invention relates to a kind of primer to (comprising two primers), the wherein nucleotide sequence of a primer such as SEQ
Shown in ID NO.1, the nucleotide sequence of another primer is as shown in SEQ ID NO.2.
Forward primer: Variant 1-Forward Primer:5 '-AGAAGGTGCAACCGATCGC-3 ' (SEQ ID
NO.1)；
Reverse primer: Variant 1-Reverse Primer:5 '-TCCTCAGCTCTGAGTGGGAGAC-3 ' (SEQ ID
NO.2)。
Above-mentioned primer is to can be used in detecting SEPT7P2-PSPH fusion gene.
Another aspect of the present invention relates to a kind of probe, and it comprises the nucleotide sequence shown in SEQ ID NO.3.The present invention's
In one embodiment, the nucleotide sequence of described probe is as shown in SEQ ID NO.3.
Probe sequence: Variant 1-Taqman-Probe:5 '-CTGAGCCTGGGAGGAA-3 ' (SEQ ID NO.3).
The probe of the present invention can be used in detecting SEPT7P2-PSPH fusion gene.
Concrete, described probe is marked with fluorescent reporter group with detectable labelling, 5 ' ends of probe, and 3 ' ends are marked with glimmering
Optical quenching group.
Described fluorescent reporter group is FAM, and fluorescent quenching group is MGB.
3 ' ends of described probe are also associated with dihydro ring annulated indole porphyrin-tripeptides.
Owing to 3 ' ends of TaqMan-MGB probe have employed the cancellation gene of non-fluorescent to absorb the energy of reporter group, absorb
Do not launch fluorescence after energy, greatly reduce the interference of background signal.Additionally, 3 ' ends of TaqMan-MGB probe are also connected with
One dihydro ring annulated indole porphyrin-tripeptides, can stablize the hybridization of probe and template significantly, raises probe Tm value, makes shorter
Probe can reach higher Tm value equally, and the distance of the fluorescent reporter group of short probe and quenching group closer to, cancellation is imitated
More preferably, fluorescence background is lower so that signal to noise ratio is higher for fruit.In the accuracy of experimental result, repeatability, specificity, sensitivity
Etc. aspect be superior to general T aqMan probe.
The further aspect of the present invention relates to a kind of test kit, its comprise the primer of the present invention to and probe.
In mentioned reagent box, also comprise PCR reaction buffer and Taq enzyme.
In mentioned reagent box, described primer to and probe be dissolved in PCR reaction buffer, concentration is 5uM.
In mentioned reagent box, also comprising positive control, described positive control is detected SEPT7P2-PSPH fusion gene by comprising
The DNA plasmid of genomic fragment.
In one embodiment of the invention, described test kit, comprise: fluorescent quantitation reactant liquor A (primer, spy
Pin mixed liquor, concentration is 5uM, positive control, and 2*Taqman universal PCR Master Mix is (purchased from U.S.'s application biology
Company) and ddH2O。
The test kit of the present invention can be used in detecting SEPT7P2-PSPH fusion gene.
The further aspect of the present invention relates to the method for the detection SEPT7P2-PSPH fusion gene of a kind of non-diagnostic purpose, including making
With the primer of the present invention to, probe or the step of test kit.
In one embodiment of the invention, the detection SEPT7P2-PSPH fusion gene of described non-diagnostic purpose
Method, comprises the steps:
Use above-mentioned primer to carry out PCR amplification to the genes of interest of testing sample, utilize Taqman probe that amplified production is entered
Row specificity microdot detects, after expanding according to PCR the power of fluorescence signal SEPT7P2-PSPH fusion gene is carried out qualitative or
Detection by quantitative.
Said method, the condition of described PCR amplification is: 95 DEG C of denaturations 60 seconds；By 95 DEG C 15 seconds, 60 DEG C 20 seconds, amplification
React 15 circulations；Again by 95 DEG C 15 seconds, 58 DEG C 34 seconds, amplified reaction 40 circulation.
The further aspect of the present invention relates to the primer of the present invention and merges, probe or test kit at preparation detection SEPT7P2-PSPH
Purposes in the reagent of gene.
The principle that SEPT7P2-PSPH fusion gene is detected by the present invention is: use fluorescence quantifying PCR method pair
SEPT7P2-PSPH fusion gene carries out detection by quantitative.Conserved sequence for SEPT7P2-PSPH fusion gene variant is special
Design TaqMan probe and primer a pair, merge variant specific gene sequence accordingly when running into SEPT7P2-PSPH fusion gene
Time, TaqMan probe can be completely combined therewith, and during PCR amplification, fluorescent reporter group sends fluorescence because enzymolysis separates, energy
Enough accumulation detecting corresponding fluorescence signal in real time, thus realize detecting the purpose of SEPT7P2-PSPH fusion gene.
It should be noted that the conserved sequence of SEPT7P2-PSPH fusion gene variant does not also have been reported that at present, therefore, setting
Need during meter primer to carry out the conserved sequence of SEPT7P2-PSPH fusion gene variant screening comparison and experimental verification, in choosing
Carrying out design of primers after reserving conserved sequence again, this considerably increases the difficulty of design of primers undoubtedly.
The present invention is directed the detection of SEPT7P2-PSPH fusion gene variant, wherein, the exon1 of SEPT7P2 gene and
The exon4 of PSPH gene merges.The present invention is the primer design method of fusion gene the most routinely during design of primers,
By design of primers, on the 1st exon or PSPH gene 4 exon of SEPT7P2 gene, (primer sequence sees enforcement
Variant 1-Forward Primer1, Variant 1-Reverse Primer1 in the table 1 of example 1), although can detect most
Fusion gene variant, but missing inspection easily occurs or false-positive phenomenon.Owing to the upstream sequence of SEPT7P2 breakpoint is pseudogene,
The most not expressing protein；PSPH breakpoint, before initiation codon, after merging in theory, comprises whole encoding proteins
Region.The open reading frame of sequence after merging with NCBI ORFfingder prediction, is found to have multiple probability, therefore, increases
Screening comparison and the difficulty of experimental verification to the conserved sequence of SEPT7P2-PSPH fusion gene variant, the present invention is through too much
Find after secondary verification experimental verification, design primer using 19, merging point upstream base and 241, merging point downstream base as conserved sequence,
Can be on the basis of ensureing amplification efficiency and specific amplification, it is achieved to SEPT7P2-PSPH fusion gene variant accurate,
Complete detection, clinical trial shows, uses the primer of optimization of the present invention and probe to detect, non-false positive and false-negative inspection
Survey result.
The TaqMan-MGB probe that the present invention uses, compared with traditional TaqMan-TAMRA probe, MGB probe
There is raising TM value, make the contraction in length of probe, and it is different to improve the TM value difference between pairing and non-matching template；Improve letter
Making an uproar ratio, make experimental result more accurate, resolution is higher；More simplifying experiment, MGB probe optimum experimental step is simple, hybridization
Stability is greatly improved, and repeatability such as is greatly improved at the advantage.
The two ends that the present invention provides are labeled with the specificity fluorescent probe of fluorescence radiation group, and when probe is complete, two groups are at sky
Between in structure distance close to each other, fluorescence that 5 ' end reporter groups send because FRET (fluorescence resonance energy transfer) (FRET) and by 3 ' ends
Quenching group cancellation, so not having the change of fluorescence signal in system.And once its combination with template specificity, its bound site
O'clock between two primers, along with the extension of primer, Taq archaeal dna polymerase runs into during chain extension and combines with template
Probe, probe will be cut off by its 5 '-3 ' 5 prime excision enzyme activity, and fluorescent reporter group, away from fluorescent quenching group, destroys
FRET between two fluorophors, the fluorescence that reporter group is discharged just can be built in the fluorescence in instrument
Meter detects.PCR is often through a circulation, and fluorescence signal is also the same with purpose fragment, has the process that a sync index increases,
The power of fluorescence signal just represents the number of the copy number of template DNA.Therefore the present invention cannot be only used for simple qualitative inspection
Survey, also can be used as the detection by quantitative of the concrete content of sample.
Beneficial effects of the present invention:
(1) present invention establishes the detection method of SEPT7P2-PSPH fusion gene first, utilizes this detection method to treat
SEPT7P2-PSPH fusion gene in test sample product qualitatively or quantitatively detects.
(2) detection sensitivity is high, and specificity is good: devise spy for SEPT7P2-PSPH fusion gene variant conserved sequence
Specific primer and fluorescent probe, improve detection sensitivity and specificity, and false positive is low.
(3) linear relationship is good, can detection by quantitative, owing to the power of fluorescence signal is linear with the logarithm of template amplification product,
Being carried out sample initial template concentration quantitatively by the detection of fluorescence signal, error is little.
(4) simple to operate, automaticity is high, fluorescent quantitative PCR technique to the amplification of PCR primer and detection at stopped pipe
Situation next step complete, it is not necessary to uncap, cross-contamination and pollute environment machine can lack, the most just reduce the several of result error
Rate.
(5) result interpretation clearly, intuitively, can carry out quantitative analysis to result.The interpretation of fluorescence quantitative PCR method result:
The specimen more than thresholding line having amplification curve is positive sample, and result interpretation is very simple, directly perceived.
(6) safety: do not comprise poisonous and harmful substance in whole system, to operator and environment all non-hazardous.
(7) there is no post processing, need not hybridize, electrophoresis, take pictures.
Accompanying drawing explanation
Fig. 1: SEPT7P2 and the PSPH position view merged；
The FQ-PCR figure of Fig. 2: SEPT7P2-PSPH fusion gene；
The FQ-PCR figure of Fig. 3: normal wild type gene；
The sequencing result figure of Fig. 4: SEPT7P2-PSPH fusion gene.
Detailed description of the invention
The present invention is further illustrated in conjunction with the embodiments, it should explanation, the description below merely to explain the present invention,
Its content is not defined.
Embodiment 1: specific primer and the screening test of probe
1. primer and the probe of detection SEPT7P2-PSPH fusion gene designs
The present inventor devises the multiple fluorescent quantitative PCR primers for SEPT7P2-PSPH fusion gene and probe, tool
Body sequence is as shown in table 1.
Table 1 is for detecting primer and the probe of SEPT7P2-PSPH fusion gene
2. the reaction system of quantitative fluorescent PCR and condition
Reaction system and the reaction condition of SEPT7P2-PSPH fusion gene fluorescence quantitative PCR detection are as follows:
Reaction system is 25 μ L, fluorescent quantitation reactant liquor A (primer, probe mixed liquor, concentration is 5uM) 2 μ L, sample mold
Plate DNA 2 μ L (100-300ng/ μ L), 2*Taqman universal PCR Master Mix is (biological public purchased from U.S.'s application
Department) 15 μ L, ddH2O 6μL。
Reaction condition is: 95 DEG C of denaturations 60 seconds；By 95 DEG C 15 seconds, 60 DEG C 20 seconds, amplified reaction 15 circulation；Press again
95 DEG C 15 seconds, 58 DEG C 34 seconds, amplified reaction 40 circulation.
3. result judges
Contrast the amplification situation of different primers pair and probe combinations, it then follows specificity principle, sensitivity principle and the highest amplification are former
Then, selected specificity is good, and sensitivity is high, the SEPT7P2-PSPH fusion gene detection primer of good reliability to and probe groups
Close.
The concrete optimal screening method of primer and probe is as follows:
Optionally pair of primers and a probe is combined, with can obtain simultaneously minimum Ct value and the highest amplification efficiency (according to
" PCR Efficiency " data report that fluorescent PCR instrument provides, the highest amplification efficiency of numerical value is the highest) it is screening criteria, select
Good primer and probe combinations.
By the most repeatedly, contrast test, selected SEPT7P2-PSPH fusion gene detection primer pair and optimal group of probe
Closing, it has extraordinary specificity and optimum amplification efficiency, and slightly, particular sequence is shown in Table 2 to combined sorting result figure.
Table 2: the preferred compositions of primer pair and probe
| Title | Sequence (5 ,-3) |
| Variant 1-Forward Primer3 | AGAAGGTGCAACCGATCGC |
| Variant 1-Reverse Primer4 | TCCTCAGCTCTGAGTGGGAGAC |
| Variant 1-Taqman-Probe1 | CTGAGCCTGGGAGGAA |
Embodiment 2: for the test kit of SEPT7P2-PSPH fusion gene detection
The composition of test kit includes: fluorescent quantitation reactant liquor A (primer, probe mixed liquor, concentration is 5uM, positive control,
2*Taqman universal PCR Master Mix (applying biotech firm purchased from the U.S.) and ddH2O。
Primer and probe are that in embodiment 1, screening and optimizing obtains.
Positive control is the DNA plasmid of detection SEPT7P2-PSPH fusion gene genomic fragment by comprising, for prior art
Conventional method prepares.
Amplification system and amplification method when using this test kit to carry out Clinical detection be:
Reaction system is 25 μ L, fluorescent quantitation reactant liquor A (primer, probe mixed liquor, concentration is 5uM) 2 μ L, sample mold
Plate DNA 2 μ L (100-300ng/ μ L), 2*Taqman universal PCR Master Mix is (biological public purchased from U.S.'s application
Department) 15 μ L, ddH2O 6μL。
Reaction condition is: 95 DEG C of denaturations 60 seconds；By 95 DEG C 15 seconds, 60 DEG C 20 seconds, amplified reaction 15 circulation；Press again
95 DEG C 15 seconds, 58 DEG C 34 seconds, amplified reaction 40 circulation.
Embodiment 3: the sensitivity technique of test kit
Take containing (precious biological engineering (Dalian) the company limited conjunction of SEPT7P2-PSPH fusion gene genomic fragment DNA plasmid
Become), carry out gradient dilution, be respectively 10 to concentration1Copy/microlitre, 102Copy/microlitre, 103Copy/microlitre, 105Copy/
Microlitre, as sample.
Then the test kit of embodiment 2 is used to carry out the detection of ARMS-qPCR in optimizing reaction system: reaction system is 25 μ L,
Fluorescent quantitation reactant liquor A (primer, probe mixed liquor, concentration is 5uM) 2 μ L, sample template DNA 2 μ L (100-300ng/ μ L),
2*Taqman universal PCR Master Mix (applying biotech firm purchased from the U.S.) 15 μ L, ddH2O 6μL。
Reaction condition is: 95 DEG C of denaturations 60 seconds；By 95 DEG C 15 seconds, 60 DEG C 20 seconds, amplified reaction 15 circulation；Again by 95 DEG C
15 seconds, 58 DEG C 34 seconds, amplified reaction 40 circulation.
Result shows that the test kit of the present invention can accurately detect SEPT7P2-PSPH fusion gene variant, minimum is able to detect that 10
Gene mutation in copy SEPT7P2-PSPH fusion gene.
Embodiment 4: clinical sample detects
In the case of tester's informed consent, collecting sample, each sample is all obtained from Tumor Hospital Attached to Zhongshan Univ., sample number
Amount is 148 examples, uses the test kit of the embodiment of the present invention 2 to detect, and detection method is: existed by the sample DNA extracted
The test kit of the present invention is used to detect in PCR reaction tube.
Reaction condition is: 95 DEG C of denaturations 60 seconds；By 95 DEG C 15 seconds, 60 DEG C 20 seconds, amplified reaction 15 circulation；Press again
95 DEG C 15 seconds, 58 DEG C 34 seconds, amplified reaction 40 circulation.
Testing result shows, SEPT7P2-PSPH fusion gene suddenlys change to have 4 examples there occurs in the 148 example samples detected.
All of sample standard deviation is through direct Sequencing detection checking, and result is complete with the typing testing result of the test kit using the present invention
Unanimously, illustrating that the test kit of the present invention and detection method thereof are accurate and effective, high specificity, testing result non-false positive and vacation are cloudy
Property.
The FQ-PCR of the detection of part sample schemes as shown in Figures 2 and 3, and wherein, Fig. 2 is wherein 1 example positive sample
FQ-PCR schemes, and has typical S type amplification curve；Fig. 3 is the FQ-PCR of negative sample (i.e. normal wild type genotype)
Figure, without amplification curve.
The positive sample that fluorescent quantitation detects is carried out sequence verification, and result as shown in Figure 4, be can be seen that really by sequencing result
There is corresponding SEPT7P2-PSPH gene fusion in this site tangible, it is completely the same with the result of fluorescent quantitation detection test.
Illustrate that the test kit using the present invention can accurately determine SEPT7P2-PSPH gene fusion catastrophe.
Test kit of the present invention can complete to detect box in two hours and provide examining report, needed 1 little including the extraction of sample DNA
Time about, the detection of quantitative fluorescent PCR about 1 hour.
Claims (10)
1. primer to and a combination product for probe, wherein, the nucleotide sequence such as SEQ ID of a primer of described primer pair
Shown in NO.1, the nucleotide sequence of another primer is as shown in SEQ ID NO.2；The nucleotide sequence of described probe such as SEQ ID
Shown in NO.3.
2. primer as claimed in claim 1 to and the combination product of probe, it is characterised in that 5 ' ends of described probe are marked with
Fluorescent reporter group, 3 ' ends are marked with fluorescent quenching group.
3. primer as claimed in claim 2 to and the combination product of probe, it is characterised in that described fluorescent reporter group is
FAM, fluorescent quenching group is MGB.
4. a test kit, its comprise primer according to any one of claim 1-3 to and the combination product of probe.
5. test kit as claimed in claim 4, it is characterised in that in described test kit, also comprise PCR reaction buffer and
Taq enzyme.
6. test kit as claimed in claim 5, it is characterised in that described primer to and probe be dissolved in PCR reaction buffer,
Concentration is 5uM.
7. test kit as claimed in claim 4, it is characterised in that in described test kit, also comprise positive control, described sun
Property comparison by comprising the DNA plasmid of detection SEPT7P2-PSPH fusion gene genomic fragment.
8. the method for a non-diagnostic purpose detection SEPT7P2-PSPH fusion gene, it is characterised in that use claim 1-3
Primer described in any one to and the combination product of probe or the test kit described in any one of claim 4-7 in primer to be measured
The genes of interest of sample carries out PCR amplification, utilizes probe that amplified production carries out specificity microdot detection, expands according to PCR
SEPT7P2-PSPH fusion gene is qualitatively or quantitatively detected by the power of rear fluorescence signal.
9. method as claimed in claim 8, it is characterised in that the condition of described PCR amplification is: 95 DEG C of denaturations 60 seconds；
By 95 DEG C 15 seconds, 60 DEG C 20 seconds, amplified reaction 15 circulation；Again by 95 DEG C 15 seconds, 58 DEG C 34 seconds, amplified reaction 40
Circulation.
10. primer described in any one of claim 1-3 to and the combination product of probe or the examination described in any one of claim 4-7
Agent box purposes in the reagent of preparation detection SEPT7P2-PSPH fusion gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610300303.4A CN105802965B (en) | 2016-05-09 | 2016-05-09 | Primer pair, probe and kit for detecting SEPT7P2-PSPH fusions |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610300303.4A CN105802965B (en) | 2016-05-09 | 2016-05-09 | Primer pair, probe and kit for detecting SEPT7P2-PSPH fusions |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105802965A true CN105802965A (en) | 2016-07-27 |
| CN105802965B CN105802965B (en) | 2018-10-23 |
Family
ID=56456513
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610300303.4A Active CN105802965B (en) | 2016-05-09 | 2016-05-09 | Primer pair, probe and kit for detecting SEPT7P2-PSPH fusions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105802965B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103757101A (en) * | 2013-12-23 | 2014-04-30 | 成都艾迪康医学检测实验室有限公司 | Method for detecting relative expression quantity of fusion gene ATIC-ALK and oligonucleotide |
| CN104195255A (en) * | 2014-09-09 | 2014-12-10 | 广州蓝吉生物技术有限公司 | Kit for detecting fusion gene AML1-ETO mRNA expression and detection method using kit |
-
2016
- 2016-05-09 CN CN201610300303.4A patent/CN105802965B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103757101A (en) * | 2013-12-23 | 2014-04-30 | 成都艾迪康医学检测实验室有限公司 | Method for detecting relative expression quantity of fusion gene ATIC-ALK and oligonucleotide |
| CN104195255A (en) * | 2014-09-09 | 2014-12-10 | 广州蓝吉生物技术有限公司 | Kit for detecting fusion gene AML1-ETO mRNA expression and detection method using kit |
Non-Patent Citations (7)
| Title |
|---|
| BABICEANU M等: "Recurrent chimeric fusion RNAs in non-cancer tissues and cells", 《NUCLEIC ACIDS RESEARCH》 * |
| BACHELOR MA: "Homo sapiens phosphoserine phosphatase (PSPH), mRNA", 《GENEBANK》 * |
| HALL PA等: "Homo sapiens septin 7 pseudogene 2 (SEPT7P2), noncoding", 《GENEBANK》 * |
| QIN F等: "Chimeric RNA profiling demonstrates an association of alveolar rhabdomyosarcoma with specific stages of normal myogenesis", 《GEO数据库》 * |
| XIE ZHONGQIU等: "Fusion transcriptome profiling provides insights into alveolar rhabdomyosarcoma", 《PNAS》 * |
| 周国华: "《SNP检测技术与个体化药物治疗》", 28 February 2015 * |
| 郑自强等: "《出入境检验检疫行业标准汇编》", 31 August 2012 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105802965B (en) | 2018-10-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2875710C (en) | Molecular malignancy in melanocytic lesions | |
| US20180135131A1 (en) | Neuroendocrine tumors | |
| JP4435259B2 (en) | Detection method of trace gastric cancer cells | |
| EP2121988B1 (en) | Prostate cancer survival and recurrence | |
| CN106868204A (en) | A kind of biomarker for sdenocarcinoma of stomach diagnosis | |
| JP2011525106A (en) | Markers for diffuse B large cell lymphoma and methods of use thereof | |
| CN113355415B (en) | Detection reagent and kit for diagnosis or auxiliary diagnosis of esophageal cancer | |
| WO2007089880A2 (en) | Method to detect breast cancer cells | |
| JP4317854B2 (en) | Detection method of trace gastric cancer cells | |
| US20180051342A1 (en) | Prostate cancer survival and recurrence | |
| CN110331207A (en) | Adenocarcinoma of lung biomarker and related application | |
| Ma et al. | Discovery of candidate gene expression signatures in peripheral blood for the screening of cervical cancer | |
| CN113249479B (en) | Pancreatic cancer related lncRNA marker, probe and application of detection kit in pancreatic cancer diagnosis | |
| US20150329911A1 (en) | Nucleic acid biomarkers for prostate cancer | |
| CN108424962A (en) | The miRNA detection markers and its diagnostic kit of mesangial proliferative glomerulonephritis | |
| CN109628594B (en) | One kind long-chain non-coding RNA relevant to liver cancer and its application | |
| CN105802965B (en) | Primer pair, probe and kit for detecting SEPT7P2-PSPH fusions | |
| JP2010502179A (en) | Prognosis method | |
| CN116949176B (en) | Application of reagent for detecting FAS gene mutation site in preparation of pancreatic duct adenocarcinoma prognosis detection product | |
| JP2019076068A (en) | Ovarian cancer tissue type discrimination method | |
| CN109706146A (en) | Application of the finger-print of tiny RNA composition in the Cancerous Pleural Effusion diagnosing and treating of people | |
| CN115074436A (en) | Application of lung cancer early diagnosis marker in preparation of lung cancer early diagnosis reagent | |
| CN117701720A (en) | Cervical cancer CLIP3 gene methylation detection reagent and kit | |
| CN117701721A (en) | Detection reagent and kit for methylation of SOX1-SEPTIN9-TAC1 gene of cervical cancer | |
| CN107988355A (en) | For detecting and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |