CN105801709B - CBLB502-Fc fusion protein and preparation method thereof - Google Patents

CBLB502-Fc fusion protein and preparation method thereof Download PDF

Info

Publication number
CN105801709B
CN105801709B CN201610284241.2A CN201610284241A CN105801709B CN 105801709 B CN105801709 B CN 105801709B CN 201610284241 A CN201610284241 A CN 201610284241A CN 105801709 B CN105801709 B CN 105801709B
Authority
CN
China
Prior art keywords
cblb502
fusion protein
cell
preparation
expression vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610284241.2A
Other languages
Chinese (zh)
Other versions
CN105801709A (en
Inventor
胡显文
段海峰
陈柯言
陈强
张伟
高丽华
王友亮
邵勇
焦长乐
谭招丽
靳阳
殷慧慧
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SICHUAN NEO-LIFE STEM CELL BIOTECH Inc
Original Assignee
Beijing Niulaifu Biological Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Niulaifu Biological Technology Co Ltd filed Critical Beijing Niulaifu Biological Technology Co Ltd
Priority to CN201610284241.2A priority Critical patent/CN105801709B/en
Publication of CN105801709A publication Critical patent/CN105801709A/en
Application granted granted Critical
Publication of CN105801709B publication Critical patent/CN105801709B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/255—Salmonella (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses CBLB502-Fc fusion proteins and preparation method thereof.The fusion protein includes CBLB502 albumen and immunoglobulin Fc segments, and the Fc segment is selected from the immunoglobulin or their hypotype of human or animal.The carrier for expression of eukaryon that the present invention passes through building CBLB502-Fc fusion protein, and it transfects to eukaryocyte, it obtains that activity is high, stability is good, long half time fusion protein, can be used for radiation protection, alleviates marrow and injury of gastrointestinal tract caused by repairing chemicals and the purposes such as antitumor.

Description

CBLB502-Fc fusion protein and preparation method thereof
Technical field
The present invention relates to a kind of fusion proteins, in particular to CBLB502-Fc fusion protein and preparation method thereof, belong to life Object technical field.
Background technique
Toll-like receptor (Toll-like receptors, TLRs) plays in body inherent immunity and acquired immunity Important function (Akira S, Takeda K, Kaisho T. [J] .Nature immunology, 2001,2 (8): 675-80.), Have discovered that 13 kinds of TLR in mammalian cells at present.TLRs is related by pathogen such as specific recognition bacterium, viruses Model molecule, it is logical that starting marrow sample differentiation factor (myeloid differentiation factor 88, MyD88) relies on signal Road to activate inherent immunity (C Paul C, Faqi A S. [J] .Reproductive toxicology, 2014,46 (7): 12-9.), the differentiation and maturation of inflammatory reaction, antiviral response and immunocyte is further caused, to protect body from cause of disease The invasion of body.
Toll-like receptor 5 (TLR5) is one of TLR family member, and the unique ligand being currently known is salmonella flagellum egg It is white.The trade name Entolimod of CBLB502 is researched and developed by Cleveland biomedical company from Salmonella Bacterium flagellin changes the polypeptide drug of structure, currently carries out the second stage of clinical research.After Optimal Structure Designing, CBLB502 has lacked the center globular domain that flagellin has high degree of immunogenicity, contains flagellin N-terminal and C-terminal Functional domain (Yoon S I, Kurnasov O, Natarajan V, et al. [J] .Science, 2012,335 (6070):859-64.).Therefore it has lower immunogenicity than flagellin, but the NF- κ B for remaining TLR5 dependence is lured Lead activity and anti-radiation ability (Burdelya L G, Krivokrysenko V I, Tallant T C, et al. [J] .Science,2008,320(5873):226-30.)。
CBLB502 can efficiently reduce the damage of the tissues such as radiation-induced marrow and gastrointestinal tract, and can promote it Regeneration is a kind of safe and effective antiradiation drug for being currently studied exploitation.CBLB502 is to mouse head and neck The epithelial tissue and mucosal tissue of part have good Study On The Radioprotective, but its Tissue-protective effect does not extend to tumour (Burdelya L G,Gleiberman A S,Toshkov I,et al.[J].International Journal of Radiation Oncology Biology Physics,2012,83(1):228-34.).In addition to there is protection to make radiation With the tissue of, CBLB502 for mouse kidney ischemical reperfusion injury have effectively protective effect (Fukuzawa N, Petro M, Baldwin W M, et al. [J] .The Journal of Immunology, 2011,187 (7): 3831-9.), And marrow and injury of gastrointestinal tract caused by repairing chemicals can be alleviated.In addition studies have found that, CBLB502 is for expression The tumour cell of TLR5 has direct cytotoxicity (Cai Z, Sanchez A, Shi Z, et al. [J] .Cancer Research, 2011,71 (7): 2466-75.), and antitumor action can be generated to metastatic liver cancer by activation inherent immunity.Cause This is visible with studying to deepen continuously, and the application prospect of CBLB502 is very wide.
Currently, the CBLB502 in document report be prokaryotic expression (Yoon S I, Kurnasov O, Natarajan V, Et al. [J] .Science, 2012,335 (6070): 859-64.), albumen is expressed with inclusion bodies, leads to purifying process Complicated and heat source or endotoxin are not easy to remove.
Summary of the invention
To solve the above-mentioned problems, present inventor has performed sharp studies, pass through building CBLB502 and immunoglobulin The carrier for expression of eukaryon of IgG Fc fusion, expression and purification obtains CBLB502-Fc fusion protein in mammal cell line, and Preliminary biological activity test is carried out, to overcome the shortcomings that CBLB502 is by prokaryotic expression, so as to complete the present invention.
The purpose of the present invention is to provide following aspect:
(1) CBLB502-Fc fusion protein, wherein the fusion protein includes CBLB502 albumen and immunoglobulin Fc Segment.
(2) fusion protein according to above-mentioned (1), wherein the fusion protein includes ammonia shown in SEQ ID NO.1 Base acid sequence, the nucleotide for encoding the albumen includes nucleotide sequence shown in SEQ ID NO.2.
(3) fusion protein according to above-mentioned (1) or (2), wherein the Fc segment is selected from the immune ball of human or animal Albumen or their hypotype.
(4) fusion protein according to one of above-mentioned (1) to (3), wherein the Fc segment is selected from human immunoglobulin(HIg) IgG, preferably IgG1.
(5) preparation method of the fusion protein according to one of above-mentioned (1) to (4), comprising the following steps:
1) nucleotide sequence of coding CBLB502-Fc fusion protein is obtained；
2) expression vector of CBLB502-Fc fusion protein is constructed；
3) by the expression vector transfecting appropriate host cell of building；
4) culture transfection cell, separates CBLB502-Fc fusion protein.
(6) preparation method according to above-mentioned (5), wherein the positive amplimer nucleotide sequence of CBLB502 is such as Shown in SEQ ID NO.3, reverse primer nucleotide sequence is as shown in SEQ ID NO.4.
(7) preparation method according to above-mentioned (5) or (6) is comprising the nucleotide sequence of encoding fusion protein Expression vector is eukaryotic vector or prokaryotic vector, wherein the eukaryotic vector preferred mammal cell expression vector.
(8) preparation method according to one of above-mentioned (6) to (7), wherein the host cell is eukaryocyte.
(9) preparation method according to one of above-mentioned (5) to (8), wherein the host cell is that mammal is thin Born of the same parents, preferably Chinese hamster ovary celI.
(10) fusion protein according to above-mentioned (1) repairs marrow caused by chemicals for radiation protection, alleviation And the purposes of injury of gastrointestinal tract and anti-tumor aspect.
CBLB502-Fc fusion protein provided according to the present invention and preparation method thereof, has the advantages that
(1) carrier for expression of eukaryon that the present invention is merged by building CBLB502 and IgG Fc, the albumen of expression possess accordingly Biological activity, can direct purification obtain the destination protein of higher degree, greatly simplify protein purification technique；
(2) destination protein molecular weight is increased after merging Fc segment, to reduce renal clearance, and in the immune ball of new life Under the protection of albumen Fc receptor (FcRn), the plasma half-life of fusion protein is extended；
(3) dimer or polymer that fusion protein can be stable by disulfide bond formation, can be improved protein molecular Stability；
(4) the fusion protein activity obtained in the present invention is high, in terms of there is very big application prospect.
Detailed description of the invention
Fig. 1 shows PCR amplification CBLB502 gene order electrophoretogram；
Fig. 2 shows the digestion of pcDNA3.1-CBLB502-Fc recombinant plasmid identifications；
Fig. 3 shows the expression of fusion protein in CHO-S/pcDNA3.1-CBLB502-Fc transgenic cell；
Fig. 4 shows the eluting peak of Protein A purifying CBLB502-Fc fusion protein；
Fig. 5 shows the SDS-PAGE electroresis appraisal of the CBLB502-Fc fusion protein of purifying；
Fig. 6 shows influence of the CBLB502-Fc to mouse survival rate after gamma-rays full-body exposure；
Fig. 7 shows CBLB502-Fc to the phosphorylation level of JNK.
Specific embodiment
Present invention will now be described in detail, and the features and advantages of the invention will become more with these explanations It is clear, clear.
Dedicated word " exemplary " means " being used as example, embodiment or illustrative " herein.Here as " exemplary " Illustrated any embodiment should not necessarily be construed as preferred or advantageous over other embodiments.Although each of embodiment is shown in the attached drawings In terms of kind, but unless otherwise indicated, it is not necessary to attached drawing drawn to scale.
Currently, the CBLB502 in document report is prokaryotic expression, albumen is expressed with inclusion bodies, inclusion body Renaturation has become the bottleneck for restricting bio-pharmaceuticals development, treatment process include: the broken of thallus, the washing of inclusion body, dissolution, Renaturation and purifying, the contents are multifarious and disorderly, causes purifying process sufficiently complex.
The purpose of the present invention is by building CBLB502-Fc fusion protein carrier for expression of eukaryon, transfection host cell, Purifying obtains biologically active destination protein, lowers the complexity of preparation process.CBLB502-Fc merges egg in the present invention It is white include CBLB502 albumen and immunoglobulin Fc segments, wherein Fc segment be selected from human or animal immunoglobulin or it Hypotype, preferably human immunoglobulin(HIg) IgG, more preferable IgG1.Fusion protein includes amino acid sequence shown in SEQ ID NO.1 Column, the nucleotide for encoding the albumen includes nucleotide sequence shown in SEQ ID NO.2.
Heretofore described Fc refer to immunoglobulin heavy chain constant region c-terminus or in which a part, such as immune ball Albumen Fc segment may include two or more structural domains of heavy chain CH1, CH2, CH3, CH4 and the group of immunoglobulin hinge region It closes.Known immunoglobulin has IgA, IgD, IgE, IgM and IgG (including IgG1, IgG2, IgG3, IgG4), those skilled in the art Member can select specific immunoglobulin fc region from specific immunoglobulins classification and subclass.
CBLB502 is merged with immunoglobulin Fc, choosing multiple catenation sequence, such as can choose length is about 20 Amino acid residue also may be selected CBLB502 and directly merge with the hinge area of immunoglobulin Fc, the fusion protein F c sequence of preparation Positioned at CBLB502 aminoterminal.
CBLB502 is merged with Ig Fc segment in the present invention, is mainly in view of the following: firstly, Fc segment energy Enough be specifically bound to Protein A affinity column, can direct purification obtain the destination protein of higher degree, simplify fusion protein Purification step；Secondly, fusion Fc segment can increase molecular weight of albumen, to reduce renal clearance, and in the protection of FcRn Under, Fc fusion protein can extend its plasma half-life；Again, the dimerization that Fc fusion protein can be stable by disulfide bond formation Body can be improved the stability of protein molecular；Finally, protein fusion Fc segment can be improved its table in mammalian cell It reaches.
The present invention constructs the carrier for expression of eukaryon of CBLB502 and immunoglobulin Fc segment fusion protein.Preferably one In embodiment, with restriction enzyme A vr II, BamH I double digestion pUC57-CBLB502 and pUC57-Fc, connected with T4DNA Enzyme connection is connect, pUC57-CBLB502-Fc is obtained, with restriction enzyme EcoR V, Hind III double digestion eukaryotic vector CBLB502-Fc is cloned into pcDNA3.1 carrier, constructs pcDNA3.1- by pcDNA3.1 and pUC57-CBLB502-Fc CBLB502-Fc eucaryon plasmid.With eukaryotic expression vector transfection eukaryocyte, expression obtains biologically active albumen.
It is a further object of the present invention to provide the preparation methods of CBLB502-Fc fusion protein, i.e., by being encoded The nucleotide sequence of CBLB502-Fc fusion protein constructs the expression vector of CBLB502-Fc fusion protein, by the expression of building Carrier transfecting appropriate host cell, culture transfection cell, isolated biologically active CBLB502-Fc fusion protein.
In a preferred embodiment, amplimer 502F and 502R are designed according to known CBLB502 gene order, to close At pUC57-CBLB502 plasmid be template, go out CBLB502 genetic fragment using archaeal dna polymerase PCR amplification.Wherein, The corresponding full length nucleotide sequence of CBLB502 albumen is provided in the form of pUC57-CBLB502 plasmid, PCR amplification primer 502F Nucleotide sequence with 502R is as shown in SEQ ID NO.3 and SEQ ID NO.4.
In a preferred embodiment, with restriction enzyme A vr II, BamHI double digestion target gene fragment and PUC57-Fc detects digestion products with agarose gel electrophoresis, recycles target fragment after cutting glue.PCR product and load after digestion Body is ligated and transformed into competent E.coli with DNA ligase, and the LB for selecting positive monoclonal to amicillin resistance is cultivated Base takes bacterium solution to carry out PCR verifying and send sequencing after culture.Wherein, forward primer P57YF nucleotides sequence is classified as 5 '- CGCCAGGGTTTTCCCAGTCAC-3 ', reverse primer P57YR nucleotides sequence are classified as 5 '-GCAGGACAGGGAGGACAAGTG- 3 ', PCR reaction system are as shown in table 1.Bacterium solution PCR product carries out agarose gel electrophoresis verifying.Sequencing approach uses double deoxidation Chain termination method.
1 PCR reaction system of table
Bacterium solution 1μL
P57YF 1μL
P57YR 1μL
2×Taq PCR Master Mix 10μL
ddH2O 7μL
In a preferred embodiment, (preferably with restriction enzyme EcoR V, Hind III double digestion eukaryotic vector PcDNA3.1) and pUC57-CBLB502-Fc, Escherichia coli impression will be converted on CBLB502-Fc gene fragment clone to carrier State cell is selected positive colony and is sequenced.
By Transfected Recombinant Plasmid to host cell, preferably eukaryocyte such as Chinese hamster ovary cell (Chinese hamster ovary celI), with something lost Mycin G418 is passed to pressurize screening and culturing, after cell be transferred in serum free medium cultivate.Collect cells and supernatant, dilution ELISA method detection cell protein expression levels are carried out afterwards, screen high-expression cell line.Using western blotting qualification expression, Protein A is affine column purification destination protein, SDS-PAGE identifies destination protein, with mouse radiation test and JNK activation experiment The biological activity of verifying purpose albumen.
The CBLB502-Fc fusion protein prepared in the present invention embodies in the mouse survival rate experiment to total body radiation Excellent radiation protection ability, after showing that CBLB502 is merged with Fc, radiation-resisting functional is unaffected, and the fusion protein energy JNK is enough activated, significantly improves its phosphorylation level, it is determined that the feasibility of fusion protein preparation method.In the system of fusion protein During standby, Fc segment can be specifically bound to Protein A affinity column, can direct purification obtain the purpose egg of higher degree It is white, simplify the purification step of fusion protein.
Embodiment
In embodiment, agents useful for same source is as follows:
SPF grades C57BL/6 female mice 24,6 week old are purchased from Military Medical Science Institute's Experimental Animal Center, animal matter Measure quality certification number: SCXK- (army) 2012-0004；A549 cell is the preservation of this laboratory；The corresponding overall length core of CBLB502 albumen Nucleotide sequence is synthesized by Jin Sirui company, is provided in the form of pUC57-CBLB502 plasmid；PUC57-Fc plasmid is by this laboratory Building saves；PcDNA3.1 plasmid is purchased from U.S. Invitrogen company；KOD FX archaeal dna polymerase, dNTP, 2 × PCR buffering Liquid is purchased from TOYOBO company, Japan；Primer 502F, 502R, P57YF and P57YR are synthesized by the design of Invitrogen company, the U.S.； Agarose is purchased from U.S. Amresco company；DNA plastic recovery kit, DNA marker III are purchased from Beijing Tiangeng biochemical technology Company；T4DNA ligase and restriction enzyme A vr II, BamH I, EcoR V, HindIII are purchased from U.S. NEB company； DNA sample-loading buffer, 2 × Taq Master Mix, TNF-α are purchased from offshore protein Science and Technology Ltd.； Lipofectamine2000 lipofectamine is purchased from U.S. Invitrogen company；Geneticin G418 is purchased from Germany Merck company；CD FortiCHO culture medium is purchased from U.S. Gibco company；Proteinase inhibitor (PI), pvdf membrane Purchased from Roche company, Switzerland；Protein phosphatase inhibitor (PPI) has purchased from Beijing Bo Maide biotechnology Limit company；Goat anti-Human IgG/HRP, goat antirabbit HRP, goat anti-mouse HRP, Anti-GAPDH antibody are public purchased from Zhong Shan Golden Bridge Department；Diatomite is purchased from Beijing Central Plains company；ProteinA filler, DEAE-Sepharose column packing, Q-Sepharose HP column Filler is purchased from U.S. GE company；PierceTMBCA protein detection kit, PageRulerTMPlus pre-dyed albumen Marker purchase From Thermo company, the U.S.；Enlight chemical illuminating reagent is purchased from Beijing Ying Geen biotechnology company；Coomassie brilliant blue G250 Rapid dyeing reagent is purchased from Beijing Suo Laibao scientific & technical corporation；Anti-Phospho-JNK, Anti-JNK are public purchased from Britain Abcam Department.
The amplification of 1 CBLB502 gene of embodiment
According to CBLB502 gene order design primer 502F and 502R, using carrier pUC57-CBLB502 as template, utilize Archaeal dna polymerase PCR amplification obtains target gene fragment.Wherein, the base sequence (5 ' -3 ') of 502F is GATATCCCTAGGCCACCATGGAA, restriction enzyme site are Avr II, EcoR V；The base sequence (5 ' -3 ') of 502R is GGATCCCAGCAGGCTCAGGACG, restriction enzyme site are BamH I.
PCR reaction system (50 μ L) includes: 40ng template DNA sample, 1.5 μ L forward primer group 502F (0.3 μM), 1.5 μ L reverse primer group 502R (0.3 μM), 25 μ L 2 × PCR buffers, 10 μ L dNTP (2mM), 1 μ L KOD FX archaeal dna polymerase (1U), ddH2O is supplemented to 50 μ L.
PCR reaction condition includes: 94 DEG C of initial denaturations 2min, 98 DEG C of denaturation 10s, 65 DEG C of annealing 30s, 68 DEG C of extension 1min, 30 recycle, then 68 DEG C of extension 7min.PCR amplification products therefrom is subjected to 1.0% agarose gel electrophoresis analysis, is used in combination DNA plastic recovery kit purifies the amplified fragments of 1000bp, in the same size with expection, as shown in Figure 1, M indicates DNA marker, 1 indicates pUC57-CBLB502 pcr amplification product.
The building and identification of 2 pUC57-CBLB502-Fc plasmid of embodiment
Restriction enzyme A vr II, BamH I double digestion target gene fragment and pUC57-Fc, it is solidifying with 1.0% agarose Gel electrophoresis detects digestion products, uses DNA plastic recovery kit to recycle target fragment after cutting glue.With after the connection of T4DNA ligase turns Change competent E.coli, selects positive monoclonal, verified and be sequenced with primer P57YF, P57YR.The base sequence of the P57YF Arranging (5 ' -3 ') is CGCCAGGGTTTTCCCAGTCAC, and the base sequence (5 ' -3 ') of P57YR is GCAGGACAGGGAGGACAAGTG。
Positive bacterium colony identification method are as follows: select the LB culture medium of positive monoclonal to amicillin resistance, 37 DEG C of constant temperature Shaking table shakes bacterium 6h, and bacterium solution is taken to carry out PCR verifying.PCR reaction system (20 μ L): 1 μ L bacterium solution, 1 μ L P57YF, 1 μ L P57YR, 10 μ 2 × Taq of L MasterMix, 7 μ L ddH2O.
PCR reaction condition includes: 94 DEG C of initial denaturation 90s, 94 DEG C of denaturation 20s, 57 DEG C of annealing 20s, 72 DEG C of extension 90s, and 30 A circulation, then 72 DEG C of extension 5min.
PCR product carries out 1.0% agarose gel electrophoresis verifying.The correct bacteria liquid sample of verifying is taken to send to Invitrogen Company is sequenced, and sequencing approach is dideoxy chain termination.
The building and identification of 3 pcDNA3.1-CBLB502-Fc plasmid of embodiment
With restriction enzyme EcoR V, Hind III double digestion pcDNA3.1 and pUC57-CBLB502-Fc, by digestion The CBLB502-Fc gene fragment clone obtained afterwards converts competent escherichia coli cell, selects positive monoclonal, use to carrier Digestion verification simultaneously send sequencing, and the plasmid of building is named as pcDNA3.1-CBLB502-Fc.It is visible about at 1800bp CBLB502-Fc specific band, as shown in Fig. 2, consistent with expected results.The recombinant plasmid of acquisition is sequenced, sequencing result is just Really, pcDNA3.1-CBLB502-Fc plasmid construction success.
The screening and verifying of 4 pcDNA3.1-CBLB502-Fc plasmid transfection CHO-S cell of embodiment and positive colony
Using Lipofectamine2000 lipofectamine box, referring to specification by pcDNA3.1-CBLB502-Fc Plasmid transfection CHO-S cell, while negative control group (the CHO-S cell of the liposome reagent of equivalent is only added) is set.Transfection After 48h, pressurizeed screening and culturing 2 weeks with 800 μ g/mL Geneticin G418, the complete cell death of negative control group.It uses instead and contains The culture medium of 400 μ g/mL Geneticin G418 continues culture 2 weeks.After 2 weeks, when cell culture is at bulk, it is digested with pancreatin And cell count is carried out, 100 μ L cell diluents are added in diluting cells density to 8/mL, the every hole of 96 orifice plates, continue culture 2 weeks Afterwards, the culture medium for forming cell clone is changed into CD FortiCHO serum free medium.Collect cells and supernatant afterwards for 24 hours, it is dilute ELISA method detection cell protein expression levels are carried out after releasing, and select overexpression cell line.It finally screens to obtain 2 Expression of Plant Height thin Born of the same parents' strain (OD405> 1.2), as shown in table 2.
The ELISA testing result of 2 cells and supernatant of table
Number OD405 Number OD405
1D4 0.864 4D2 0.642
1F6 1.079 4E10 1.273
1G12 0.522 4F5 1.471
2B1 0.163 4G7 0.144
2E7 0.533 4G12 0.464
3A6 0.339 4H2 0.631
3A11 1.105 4H4 0.667
3C7 0.952 5B9 0.583
3D1 1.084 5E11 0.714
3G5 0.813 5G6 0.526
3G11 0.581 5G8 0.234
4B9 0.178
Take the cells and supernatant that number is 4F5, and the cells and supernatant to transfect pcDNA3.1 empty carrier is as yin Property control, carry out immune-blotting method verifying (Western Blot).After 10%SDS-PAGE protein electrophoresis, gel is removed, With low temperature wet process transferring film 100V constant voltage 90min, protein is transferred on pvdf membrane, the PBST solution of 5% skimmed milk power Room temperature shaker closes 1h, and PBST is washed film 3 times, is incubated at room temperature 1h with Goat anti-Human IgG/HRP (1:5000 dilution), PBST washes film 3 Secondary, chemical illuminating reagent develops, and UVP gel imaging system carries out imaging and takes pictures.Developing result shows, overexpression cell line Culture supernatant generates specific band in 70kDa or so, consistent with expected molecular size range, as shown in Figure 3, wherein 1 indicates PcDNA3.1 empty carrier transfects the culture supernatant of cell, and 2 indicate the culture supernatant of high expressing cell.
The purifying of 5 CBLB502-Fc fusion protein of embodiment and SDS-PAGE identification
The cell strain shaking flask filtered out is expanded and is cultivated, culture supernatant is collected, culture supernatant is mixed with diatomite, is adsorbed Cell fragment and other impurities, with 0.22 μm of membrane filtration removal diatomite and cell fragment.With the combination buffering of 5 times of column volumes Liquid (22.5mmol/L Na2HPO4, 2.5mmol/L NaH2PO4, 0.5mol/L NaCl, pH7.6) processing Protein A it is affine Column, then processed culture supernatant is subjected to loading.After loading, with equilibration buffer (17.5mmol/L Na2HPO4, 2.5mmol/L NaH2PO4, 0.3mol/L NaCl, pH7.4) and foreign protein is rinsed to baseline, then use eluent (0.5mol/L L-Arginine-HCl, 0.9%NaCl, 0.5%Tween-80, pH3.0) elution albumen, eluting peak is as shown in figure 4, highest is purple Outer light absorption value is 1840mAu, adjusts pH to 7.0 with saturation arginine, is stored in 4 DEG C.
Deproteinated concentration is washed with the measurement of BCA protein detection kit.Take sample that 6 × sample-loading buffer, 95 DEG C of changes are added Property 5min, with 10%SDS-PAGE carry out proteins gel electrophoresis, dyed using Coomassie brilliant blue G250 rapid dyeing reagent, Gel imager is taken pictures.The result shows that in 55kDa to the purpose band of one disperse of appearance between 100kDa, as shown in figure 5, Wherein, M indicates albumen marker；1 indicates the CBLB502-Fc fusion protein of purifying.Purify obtained CBLB502-Fc fusion egg White molecular weight is greater than theoretical molecular weight 59kDa, and such case is mainly since there is multiple glycosylation modified positions by CBLB502 Point, after carrying out eukaryotic expression, the sugar chain of modification increases its molecular weight.
The radiation resistance of 6 mouse radiation experiments of embodiment verifying CBLB502-Fc
24 C57BL/6 female mices are randomly divided into physiological saline group (Control), CBLB502 group and CBLB502-Fc Group, every group 8.The 30min before irradiation, physiological saline group, CBLB502 group and CBLB502-Fc group intraperitoneal injection, respectively Injecting normal saline, CBLB502 albumen 0.2mg/kg, CBLB502-Fc fusion protein 0.4mg/kg, administered volume are 100 μ L. Mouse uses Institute of Radiation Medicine, Military Medical Science Institute60Mono- subtotal body irradiation of Co gamma-rays 8.0Gy, exposure dose Rate is 188.88cGy/min.After irradiation, the observation of 30 days survival conditions by a definite date is carried out to mouse.
CBLB502-Fc is to 8.0Gy60The influence of mouse survival rate is as shown in Figure 6 after Co gamma-rays full-body exposure, wherein Physiological saline group mouse is shining rear 10d all death, and survival rate is all survivals of 0, CBLB502 group mouse after 30d, deposits after 30d Motility rate is 100%, CBLB502-Fc group mouse each dead 1 in 22d and 23d, and survival rate is 75% after 30d.Experimental result is aobvious Show, CBLB502 group and CBLB502-Fc group survival rate are significantly increased (P < 0.05) compared with physiological saline group, and CBLB502-Fc There was no significant difference between group and CBLB502 group (P > 0.05), illustrates still there is anti-spoke after CBLB502 is merged with IgG Fc The effect penetrated has no effect on its biological activity.
CBLB502 albumen used is the CBLB502 albumen after procaryotic cell expression and purification process, system in the present embodiment Preparation Method includes the following steps:
The strain of CBLB502 is thawed, takes 10mL to be coated on the LB plate of amicillin resistance, under the conditions of 30 DEG C It cultivates 48h and generates single colonie.In the LB culture medium of the single bacterium colony access 50mL amicillin resistance of picking, in 30 DEG C of conditions Under, 200rpm shaking table culture 16h, as primary seed solution.First order seed is connected to 200mL ammonia benzyl mould by 1% inoculum concentration In the YT culture medium of plain resistance, under the conditions of 30 DEG C, 200rpm shaking table culture 10h, as secondary seed solution.By secondary seed Liquid is inoculated in fermentor and is cultivated, and adjusts fermentor controller parameter: pH 7, temperature is 30 DEG C, revolving speed 600rpm, molten Oxygen is 30%-50%, and parameter state is Auto.
It is centrifuged immediately after fermentation, collects sediment, weigh weight of precipitate.10mL distillation is added by every gram of sediment Water is resuspended, and sets in ice bath and is sufficiently stirred, 600W ice-bath ultrasonic 30min.By ultrasonication and centrifugation obtains crude forgives Body ddH2O is sufficiently washed, and after abundant whirlpool concussion, in 4 DEG C, 10000rpm is centrifuged 15min, abandons supernatant, and repeated washing is primary. Inclusion body precipitating, abundant whirlpool shake are washed with the cleaning solution (pH6.8) of Tris-HCl containing 20mmol/L and 0.25mol/L urea Resuspension precipitating is swung, 4 DEG C, 10000rpm is centrifuged 5min, thoroughly discards supernatant, and repeated washing is primary.With Tris- containing 20mmol/L The eluent (pH6.8) of HCl and 6mol/L urea dissolves inclusion body, uses ddH2Urea concentration is slowly diluted to 2mol/L, room by O Warm stirring and dissolving 2-3h, in 4 DEG C, 10000rpm is centrifuged 15min.DEAE- will be carried out after solubilization of inclusion bodies liquid membrane filtration Sepharose column carries out albumen preliminary purification, reuses Q-Sepharose HP column and carries out consummateization.
Activation of 7 CBLB502-Fc of embodiment to JNK
Will by A549 cell that 4 bottles of stand densities of Nature enemy be about 80% respectively using not drug containing, contain 20ng/ The free serum culture of the TNF-α of mL, 10 μ g/mL CBLB502 (prokaryotic expression), 20 μ g/mL CBLB502-Fc (eukaryotic expression) Base stimulates 20min, and after reusing a time cell of sterile PBS cleaning, it is thin that RIPA of the 1mL containing PI and PPI is added in every bottle of cell bottle Cell pyrolysis liquid is transferred in clean EP pipe using cell scraper by cellular lysate liquid by cell scraper to cell bottle bottom on ice, 30min is stood on ice after whirlpool concussion, then 12000rpm low-temperature centrifugation 15min, draw supernatant and be transferred in clean EP pipe.Through After BCA method measures protein concentration, progress Western Blot detection, incubation primary antibody (Anti-Phospho-JNK, Anti-JNK, Anti-GAPDH antibody), secondary antibody (goat anti-mouse HRP label, goat antirabbit HRP label, 1: 5000 dilution) incubation at room temperature 1h, After washing film, developed using chemical illuminating reagent, UVP gel imaging system carries out imaging and takes pictures.
Experimental result shows, A549 cell is after TNF-α, CBLB502 and CBLB502-Fc stimulation, the phosphorus of JNK Acidification level significantly improves as shown in Figure 7 compared to negative control.Illustrate that CBLB502-Fc being capable of the effective stimulus activation downstream TLR5 Signal path, JNK can be activated, significantly improve its phosphorylation level, may participate in immune equal physiological activities, CBLB502 and IgG CBLB502 biological activity is had no effect on after Fc fusion.
It is described the invention in detail above in conjunction with detailed description and exemplary example, but these explanations are simultaneously It is not considered as limiting the invention.It will be appreciated by those skilled in the art that without departing from the spirit and scope of the invention, Can be with various equivalent substitutions, modifications or improvements are made to the technical scheme of the invention and its embodiments, these each fall within the present invention In the range of.Scope of protection of the present invention is subject to the appended claims.

Claims (9)

1.CBLB502-Fc fusion protein, including CBLB502 albumen and immunoglobulin Fc segments；The Fc segment is exempted from selected from people Epidemic disease globulin IgG；
The preparation method of the fusion protein, comprising the following steps:
1) nucleotide sequence of coding CBLB502-Fc fusion protein is obtained；
2) expression vector of CBLB502-Fc fusion protein is constructed；
3) by the expression vector transfecting appropriate host cell of building；
4) culture transfection cell, separates CBLB502-Fc fusion protein；
The expression vector of nucleotide sequence comprising encoding fusion protein is mammalian cell expression vector pcDNA3.1- CBLB502-Fc eucaryon plasmid；The expression vector is by the way that the CBLB502-Fc in pUC57-CBLB502-Fc to be cloned into It constructs and obtains in pcDNA3.1 carrier；
The host cell is mammalian cell；
The preparation method of the fusion protein further includes the purifying of CBLB502-Fc fusion protein:
Culture supernatant is mixed, adherent cell fragment and other impurities with diatomite, removes diatomite with 0.22 μm of membrane filtration With cell fragment；Handle Protein A affinity column with the combination buffer of 5 times of column volumes, then by processed culture supernatant into Row loading；After loading, with Equilibration buffer wash foreign protein to baseline, elution albumen is then used；
The fusion protein is amino acid sequence shown in SEQ ID NO.1.
2. fusion protein according to claim 1, which is characterized in that the Fc segment is selected from human immunoglobulin(HIg) IgG1.
3. the preparation method of fusion protein according to claim 1 or 2, comprising the following steps:
1) nucleotide sequence of coding CBLB502-Fc fusion protein is obtained；
2) expression vector of CBLB502-Fc fusion protein is constructed；
3) by the expression vector transfecting appropriate host cell of building；
4) culture transfection cell, separates CBLB502-Fc fusion protein.
4. preparation method according to claim 3, which is characterized in that the positive amplimer nucleotide sequence of CBLB502 As shown in SEQ ID NO.3, reverse primer nucleotide sequence is as shown in SEQ ID NO.4.
5. preparation method according to claim 3, which is characterized in that the table of the nucleotide sequence comprising encoding fusion protein It is eukaryotic vector up to carrier, wherein the eukaryotic vector is mammalian cell expression vector.
6. preparation method according to claim 3, which is characterized in that the host cell is eukaryocyte.
7. preparation method according to claim 6, which is characterized in that the host cell is mammalian cell.
8. preparation method according to claim 7, which is characterized in that the host cell is Chinese hamster ovary celI.
9. fusion protein according to claim 1 is used to prepare radiation protection, alleviates marrow caused by repairing chemicals And the purposes in terms of injury of gastrointestinal tract and anti-tumor drug.
CN201610284241.2A 2016-04-29 2016-04-29 CBLB502-Fc fusion protein and preparation method thereof Active CN105801709B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610284241.2A CN105801709B (en) 2016-04-29 2016-04-29 CBLB502-Fc fusion protein and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610284241.2A CN105801709B (en) 2016-04-29 2016-04-29 CBLB502-Fc fusion protein and preparation method thereof

Publications (2)

Publication Number Publication Date
CN105801709A CN105801709A (en) 2016-07-27
CN105801709B true CN105801709B (en) 2019-10-08

Family

ID=56458020

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610284241.2A Active CN105801709B (en) 2016-04-29 2016-04-29 CBLB502-Fc fusion protein and preparation method thereof

Country Status (1)

Country Link
CN (1) CN105801709B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1760209A (en) * 2004-10-15 2006-04-19 上海海欣生物技术有限公司 Interfusion protein of human interleukin 15 and Fe
CN102348723A (en) * 2008-12-05 2012-02-08 安吉奥开米公司 Peptide therapeutic conjugates and uses thereof
CN104136614A (en) * 2009-10-06 2014-11-05 帕纳塞拉实验室股份有限公司 Use of toll-like receptor and agonist for treating cancer

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1760209A (en) * 2004-10-15 2006-04-19 上海海欣生物技术有限公司 Interfusion protein of human interleukin 15 and Fe
CN100334112C (en) * 2004-10-15 2007-08-29 上海海欣生物技术有限公司 Interfusion protein of human interleukin 15 and Fe
CN102348723A (en) * 2008-12-05 2012-02-08 安吉奥开米公司 Peptide therapeutic conjugates and uses thereof
CN104136614A (en) * 2009-10-06 2014-11-05 帕纳塞拉实验室股份有限公司 Use of toll-like receptor and agonist for treating cancer

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
（TLR5激动剂 CBLB502蛋白原核表达及辐射防护作用验证;王治东;《第七届中国核学会"三核"论坛中国放射医学教育五十年暨中国毒理学会放射毒理委员会第八次全国会议论文集》;20100701;第252页 *

Also Published As

Publication number Publication date
CN105801709A (en) 2016-07-27

Similar Documents

Publication Publication Date Title
ES2228052T3 (en) SEPARATION OF DEMONOMERS OF ANTIBODIES OF THEIR MULTIMERS USING ION EXCHANGE CHROMATOGRAPHY.
CN102770533B (en) Therapeutic nucleic acids enzymatic compositions and method
US20090220455A1 (en) Pharmaceutical compositions comprising elp fusion proteins
CN107969128A (en) Immune modulator with adjustable affinity
CN103539862A (en) Long-acting recombinant follicle-stimulating hormone and application thereof
CN107523545A (en) A kind of lethal cell of high efficiency stable expression antibody and application thereof
CN106188281B (en) The preparation and application of anti-norovirus GII.4 type source of mouse monoclonal antibody
JPH07501698A (en) Bivalent specific heterodimer
CN103554268B (en) Long-acting recombinant follicle-stimulating hormone and application thereof
CN105622753B (en) A kind of PD-1 monoclonal antibody and its application
CN103509121A (en) FSH (follicle-stimulating hormone) fusion protein, and preparation method and application thereof
CN106519041A (en) Establishing method of pig immunoglobulin Fc fragment-swine classical fever E2 fusion protein in CHO cell strain, as well as preparation method and application of fusion protein
CN107523548A (en) A kind of T cell of high efficiency stable expression antibody and application thereof
CN105073977B (en) Recombinant yeast transformant and method for preparing immunoglobulin Fc fragment using the same
CN103897064A (en) Long-acting recombinant human chorionic gonadotrophin-Fc fusion protein
CN106188282B (en) The preparation and application of anti-norovirus GI.1 type source of mouse monoclonal antibody
CA2261562A1 (en) Fusion polypeptides comprising an ige-binding domain and a hsa component, and their diagnostic and therapeutic uses
CN103554269A (en) Recombinant porcine follicle-stimulating hormone-Fc fusion protein (pFSH-Fc)
CN105801709B (en) CBLB502-Fc fusion protein and preparation method thereof
CN103193887A (en) Recombinant porcine IL2-Fc (interteukin-2-Fc) fusion protein as well as encoding gene and expressing method of fusion protein
CN103360497A (en) Novel antitumor fusion protein vaccine, and preparation method and application thereof
CN105963681B (en) Application of the heat shock protein gp96 in systemic lupus erythematosus
CN109867725A (en) PD-1-Fc fusion protein and its preparation method and application
CN113667004A (en) Interleukin 2 mutant
CN107082815A (en) A kind of FSH HSA fusion proteins and preparation method thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C41 Transfer of patent application or patent right or utility model
TA01 Transfer of patent application right

Effective date of registration: 20161027

Address after: 100070, No. 3, building 1, Zhonghe Road, Fengtai science and Technology Park, Beijing

Applicant after: Beijing Niulaifu Biological Technology Co.,Ltd.

Address before: 610036 No. 15, Kimcheon Road, Chengdu, Sichuan, Jinniu District

Applicant before: SICHUAN NEO-LIFE STEM CELL BIOTECH Inc.

GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20230912

Address after: 610036 No. 15, Kimcheon Road, Chengdu, Sichuan, Jinniu District

Patentee after: SICHUAN NEO-LIFE STEM CELL BIOTECH Inc.

Address before: Building 3, No.1 Zhonghe Road, Fengtai Science and Technology Park, Beijing, 100070

Patentee before: Beijing Niulaifu Biological Technology Co.,Ltd.

TR01 Transfer of patent right