CN105801702B - A kind of expression has Pichia yeast engineering and the application of antioxidation polypeptide of the cell membrane across function - Google Patents

Abstract

The invention discloses Pichia yeast engineering and applications that a kind of expression tool cell membrane passes through the antioxidation polypeptide of function, applicant passes through technique for gene engineering, it is prepared for a strain gene engineering bacterium, which carries out preservation, classification naming: Pichia yeast engineering in China typical culture collection centerPichia pastoris FZM_{2014 TAT‑AOP}, deposit number: CCTCC NO:M 2014553.The genetic engineering bacterium, can be with a large amount secreting, expressing antioxidation polypeptide TAT-AOP under methanol induction by fermentation.The antioxidation polypeptide of preparation can efficiently remove free radical, show potent bioactivity in the animal experiment that weanling pig is model.Anti-oxidation peptide preparation method provided by the invention is easy, easy to operate, expression quantity is high, low in cost, biological activity is strong, can be widely applied to the industries such as aquaculture, aquatic products, health care product, cosmetics.

Description

A kind of expression has the Pichia yeast engineering of antioxidation polypeptide of the cell membrane across function And application

Technical field

The present invention relates to field of biotechnology, and being more particularly to one kind, there is cell membrane to pass through ability antioxidation polypeptide RKKRRQRRRVECYGPNRPQF expresses Pichia yeast engineering, also relates to a kind of anti-oxidant across ability with cell membrane The preparation method of polypeptide RKKRRQRRRVECYGPNRPQF further relates to a kind of antioxidation polypeptide that ability is passed through with cell membrane Application of the RKKRRQRRRVECYGPNRPQF in aquaculture is a kind of novel oxidation-resistant product after being further purified, is applied to The industries such as medicine, health care product, cosmetics.

Background technique

Mainly by generation, oxidative phosphorylation process for body provides energy to most biologies in mitochondria on the earth, is It is required for the activity of these biological lifes.But by-product active oxygen can be generated during this.The accumulation of active oxygen in vivo Can induced oxidation stress, bring adverse effect to body health.Oxidative stress generally speaking refers to bioactive molecule such as active oxygen (ROS) excessive generation or removing is reduced, and is balanced between anti-oxidative defense function so that activity in vivo oxygen class be caused to generate Disorder.One of the main reason for oxidative stress may be human and animal's range extremely wide syndrome.These syndrome packets All inflammation are included, such as: enteritis, enterocinesia disorder, cardiovascular disease, neurological disorders and some diseases related with metabolism.By Development intensive in aquaculture, scale, raises live pig undue concentration, individual space wretched insufficiency, and breeding environment deteriorates.It is high Temperature, anoxic, irritative gas etc. can all impact live pig immunity of organism, increase its oxygen demand, and metabolic disorder influences it Comprehensive constitution, destroys ROS and antioxidant system balance in animal body, initiated oxidation stress, cause to raise live pig feeding amount drop Low, destruction of mucosal, digestibility decline, pathogenicity rate increase, marketing period delay, meat decline etc., influence livestock products production.It is special Be not early weaning to piglet bring seriously stress, oxidative stress is exactly universals therein, can cause diarrhea and growth Inhibit, even results in death, bring huge economic loss to pig breeding industry.Weaned piglet is by oxidative stress, enterocyte Permeability will increase, and gut pH increases, lipase, amylase, trypsase, chymotrypsin, pepsin, invertase, cream The digestive enzyme activities such as carbohydrase, isomaltase and trehalase reduce, and enteron aisle villus shortens, and crypts is deepened, and drop digestive function It is low, and then reduce feed nutrient utilization rate.Simultaneously as in intestinal tissue be rich in xanthine oxidase, protection of intestinal mucosal barrier cells institute by Oxidative damage it is more significant, and gastrointestinal tract oxidative damage occurs earliest, and restores most slow, simultaneously because oxidation is chronic Under stress situation, characterization is not noticeable, this is very harmful to the intestinal health of intensive culture livestock and poultry.In oxidative stress situation Under, steady the weighing property dynamic abnormal of piglet interior free yl, it will the damage of free radical occurs, if cannot repair in time, can induce Disease causes death.The material base of Free radical homeostasis is nutriment and its metabolin, in the feed of piglet Other than the supply amount of its essential component meets nutritional need, also require its effect that can guarantee free radicals in vivo surely weighing property Dynamic remains normal, and also requires the substantial connection for being able to maintain nutriment and its metabolism and Free radical homeostasis.? In pig production, the cultivation situation of piglet directly affects the achievement of entire growing and fattening stage, how to mitigate and overcomes piglet disconnected Milk stress, it has also become improves the important topic of pig production benefit.Therefore, new nutritional intervention means are found, alleviates oxidation and answers Weanling pig growth inhibition, has important practical significance to the sustainable development of pig-breeding caused by swashing.

Currently, mainly using synthetized oxidation preventive agent for industries such as grease, feed, food and cosmetics, mainly Have ethoxyquin (EMQ), butylhydroxy anisole (BHA), dibutyl hydroxy toluene (BHT), propyl gallate (PG) with And tert-butyl hydroquinone (TBHQ) etc..These chemical antioxidants uses need strict control, because their accumulation is with carcinogenic Property and genotoxicity.It there are also a determination is exactly that body absorbability is weaker for chemical synthesis antioxidant.But since head closes effect It answers, gastrointestinal tract environment, the unfavorable factors such as natural barrier effect of mucous membrane and cell membrane allow these synthetized oxidation preventive agents to exist Grease, food, feed etc. carry out the quenching of active oxygen before and after entering animal intestinal tract, but for animal intestinal tract epithelial cell And the intracorporal active oxygen of machine is then helpless.In recent years, natural replace synthetized oxidation preventive agent be from now on feed and The development trend of food industry develops practical, safety, and health, efficiently, low-cost natural are the weights of research Point.The security requirement of food grade anti-oxidation peptide is higher, and inoxidizability is more significant compared with other internal antioxidation biology molecules, can With stabilized liposome or contain lipid product.Natural antioxidation polypeptide because molecular weight it is small, it is easy absorb, activity is strong the features such as add in feed The industries such as agent, food, medicine, cosmetics and health care product are added to show wide development prospect.More importantly anti-oxidation peptide is very It is easy to be operated, can further design the cell-penetrating peptide for turning over guide function with cell membrane and carry out amalgamation and expression, so that anti- Oxidation polypeptide proceeds to animal intestinal tract epithelial cell and functions, more effective to the protection of animal body.

Cell-penetrating peptide (cell-penetrating peptides, CPPs) is a kind of residual by being not more than 30 amino acid The micromolecule polypeptide of base composition, has very strong transmembrane transport ability, can carry 100 times bigger than its relative molecular mass outer Source property macromolecules into cells.It is nonirritant since cell-penetrating peptide has very strong transmembrane transport ability, and certain dense Spend in range and host cell nonhazardous acted on, thus CPPs as the novel drug delivery machinery of one kind by more and more Concern.Because cell-penetrating peptide has good application potential, can effectively transduce with different molecular weight and natural property Macromolecules into cells；Secondly, cell-penetrating peptide toxicity is relatively small；Again, the non-specific membrane penetration effect of cell-penetrating peptide Keep its application more extensive；Finally, cell-penetrating peptide can be applied not only to drug administration by injection, schneiderian membrance administration and mouth can be also used for Clothes administration.Wherein, TAT (49-57), amino acid sequence RKKRRQRRR are the tool transmembrane abilities for being found and confirming at first Peptide molecule is now widely used for bio-pharmaceutical.

Microalgae is very popular food, and Sheih in 2009 etc. digests microalgae (Chlorella with pepsin When the albumen waste that the substance that vulgaris) skims the cream off milk generates, a kind of potent anti-oxidation peptide VECYGPNRPQF is obtained.This is more Peptide Neng You Xiao temper goes out a variety of free radicals including hydroxy, superoxide anion, hydrogen peroxide, DPPH, ABTH.Effect is than butyl hydroxyl Base toluene, tocopherol is much better, and can significantly reduce damage of the free radical to DNA, as a kind of natural, safety, noresidue Antioxidant substitute, it is potential to be widely used in feed, food, cosmetics, medicine and other fields.For anti-oxidation peptide The research of VECYGPNRPQF has only determined its potent biology for removing free radical and anticancer also in the starting stage Efficiency, there are no corresponding application study announcements.

Summary of the invention

The object of the present invention is to provide a kind of artificial synthesized gene TAT-AOP, and sequence is SEQ ID NO.1 institute Show.The codon of the gene is optimized according to Pichia pastoris codon preference, and gene codon after optimization is more in line with The recombinant protein amount of Pichia anomala expression feature, expression is high and more active.

It is another object of the present invention to provide a kind of expression tool cell membranes to pass through finishing for the antioxidation polypeptide of function Red Yeast engineering bacteria Pichia pastoris KM71H FZM_{2014 TAT-AOP}, which wears with cell membrane The antioxidation polypeptide of ability is crossed, the polypeptide sequence of expression is shown in SEQ ID NO.2, and corresponding nucleotides sequence is classified as SEQ ID N is O.1 shown.The engineering bacteria is easy high density fermentation, and not only expression quantity is high for the antioxidation polypeptide of production, but also is easy to purify, and has There is potent radicals scavenging function.The engineering bacteria has sent to China typical culture collection center on November 6th, 2014 and has protected Hiding, classification naming: Pichia pastoris KM71H FZM_{2014 TAT-AOP}, deposit number: 2014553 ground CCTCC NO:M Location: Wuhan, China Wuhan University.

Another object of the present invention is to be the provision of the preparation method of TAT-AOP polypeptide, this method is easy to operate, It is low in cost.

A further object of the invention is to be the provision of a kind of Pichia yeast engineering Pichia pastoris KM71H FZ M_{2014 TAT-AOP}Or the TAT-AOP polypeptide of its expression is especially applied to as the application in feed addictive The feed addictive of piglet after wean.

In order to achieve the above object, the present invention takes following technical measures:

A kind of Pichia yeast engineering Pichia pastoris KM71H FZM_{2014 TAT-AOP}, prepared by following steps It obtains:

A, expression cassette P_AOX1-αFactor-RKKRRQRRRVECYGPNRPQF-Zeocin^rBuilding, according to pPICZ α plasmid Expression promoter before and terminator after sequence design contain the TAT-AOP nucleotides sequence of Xho I and BshT I restriction enzyme site Column, specifically: GCCAGCATTGCTGCTAAAGAAGAAGGGGTAAGAAAAGAGA GGCTGAAGCTAGAAAAAAAAGAAGACAAAGAAGAAGAGTTGAATGTTACGGTCCAAATAGACCACAATTTTGAGTTT GTAGCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAG CTTCTCGTAAGTGCCCA.Contain Xho I and BshT I enzyme with restriction enzyme Xho I and Bs hT I double digestion core respectively The TAT-AOP sequence and pPICZ α carrier of enzyme site, agarose gel electrophoresis separates and recovers after purification, using T4 ligase by enzyme Nucleotide sequence after cutting is connected with pPICZ α carrier, obtains carrier pPIC ZA α-RKKRRQRRRVECYGPNRPQF.Using Expression cassette P is obtained after Sac I digestion_AOX1-αFactor-RKKRRQR RRVECYGPNRPQF-Zeocin ^r；

B, Pichia yeast engineering Pichia pastoris KM71H FZM_{2014 TAT-AOP}Building: use electroporation Expression cassette P after linearizing_AOX1-αFactor-RKKRRQRRRVECYGPNRPQF-Zeocin^rExpression plasmid import Pichia In pastoris KM71H, sent out using the gene aox1 on methods of homologous recombination and Pichia pastoris KM71H genome Raw homologous recombination, through being integrated with expression cassette 5 ' on antibiotic Zeocin and PCR amplification stripe size screening Preliminary Identification genome P_AOX1-αFactor-RKKRRQRRRVECYGPNRPQF-Zeocin^rPichia pastoris K M71H engineering bacteria, and carry out PCR product sequence finally determines that the engineering bacteria has sent to China typical culture collection center on November 6th, 2014 and protected Hiding, classification naming: Pichia pastoris KM71H FZM_{2014 TAT-AOP}, deposit number: the address CCTCC NO:M2014553: Wuhan, China Wuhan University.

Pichia pastoris KM71H FZM_{2014 TAT-AOP}Bacterium colony is big and thick, moistens, and surface is smooth, opaque, milky white Color, edge very rounding, is easy to provoke, and bacterium colony is homogeneous, and the color at front and back sides and edge, central part is all very uniform.It can It is well grown in solid-state and liquid YPD culture medium, when being cultivated in liquid YPD, if can when inoculum concentration is big or incubation time is long To form obvious bacterium ball.Pichia pastoris KM71H FZM_{2014 TAT-AOP}It is that one kind in methanotrophic yeast can Using methanol as the saccharomycete of sole carbon source and the energy, there is AOX strong promoter, genome conformity has to be passed through with cell membrane The nucleotide sequence of the antioxidation polypeptide TAT-AOP encoding gene of ability, can be with a large amount secreting, expressing antioxygen under methanol induction Change peptide T AT-AOP.Pichia pastoris FZM₂₀₁₃Can continuous High Density Cultivation, for produce with cell membrane pass through energy The antioxidation polypeptide TAT-AOP of power.

The preparation method of TAT-AOP polypeptide, steps are as follows:

Pichia yeast engineering Pichia pastoris KM71H FZM is chosen from recovery plate_{2014 TAT-AOP}Monoclonal in In YPD culture medium, 17h is cultivated in 30 DEG C of shakings；By a volume culture 17h Pichia pastoris KM71H FZM_{2014 TAT-AOP}, it is inoculated in ten volume fermentation mediums, carries out shake flask fermentation, culture medium sample-loading amount is 1/5.30 DEG C, 260rpm, shaking culture 4d；Period, every 8h added one time 0.15% ammonium hydroxide, added the one time 0.1% pure methanol of analysis for 24 hours, 0.4% microelement P TM1 (v/v)；Cultivate four days to obtain the final product；

The formula of the fermentation medium are as follows:

Glucose 4%w/v, 150 μ L of ammonium hydroxide, KH₂PO₄0.7%w/v, MgSO₄.7H₂O 0.03%w/v, FeSO₄.7H₂O 0.05%w/v, MnSO₄.H₂O 0.05%w/v, peptone 0.1%w/v, pH5.5.

PTM1 formula are as follows: copper sulphate 6g/L, potassium iodide 0.08g/L, manganese sulfate monohydrate 3g/L, Sodium Molybdate Dihydrate 0.2g/L, Boric acid 0.02g/L, zinc chloride 20g/L, cobalt chloride 0.5g/L, ferrous sulfate heptahydrate 65g/L, biotin 0.2g/L, sulfuric acid 5ml/ L。

A kind of Pichia yeast engineering Pichia pastoris KM71H FZM_{2014 TAT-AOP}Or the TAT-AOP of its expression As the application in feed addictive, which is realized by the following method polypeptide

A, it is directly directly added in the form of culture, carries out pig feed, ruminates the aquaculture feeds such as material and fish shrimp crab In application, be applied to the industries such as livestock and poultry breeding industry and aquatic products.Because yeast pichia pasteris take in already in traditional Chinese medicines Allusion quotation, be both at home and abroad it is generally acknowledged can hyoscine, edible barms；

B, culture supernatant is obtained by centrifugation, Direct-fed, either freeze-drying or other process (glycolyxes Deng) after be added to feed, be desirably to obtain long quality guarantee period；

C, it using production grade liquid phase or other separation methods, isolates and purifies out antioxidation polypeptide tool cell membrane and passes through energy The TAT-AOP of power is applied to the industries such as cultivation and cosmetics.

High efficient expression tool cell membrane provided by the invention passes through the antioxidation polypeptide RKKRRQRRRVECYGPNRPQF of ability Engineering bacteria Pichia pastoris KM71H FZM_{2014 TAT-AOP}And tool cell membrane passes through the expression antioxidation polypeptide of ability The preparation method of RKKRRQRRRVECYGPNRPQF under conditions of mild, can largely be prepared anti-oxidant more in economy RKKRRQRRRVECYGPNRPQF.The antioxidation polypeptide can effectively clear various free radicals, alleviate oxidative stress, and without drug Residual, has very big application potential in aquaculture, can also be applied to the industries such as cosmetics.

Compared with prior art, the present invention having the following advantages that and effect:

The antioxidation polypeptide that function is passed through with cell membrane of this technique for gene engineering production Not only expression quantity is high by RKKRRQRRRVECYGPNRPQF, antioxidation polypeptide RKKRRQRRRVECYGPNRPQF produced, also has Have and carry out the biological activity that body cell efficiently removes free radical, and is anti-oxidant compared with the production of other technique for gene engineerings Polypeptide, which is compared, has following characteristics:

1. antioxidation polypeptide produced by the invention belongs to natural polypeptides, will not equally have with Conventional antioxidants potential Toxicity.

2. the cell-penetrating peptide Tat that the present invention selects is widely used, and not substantially without cytotoxicity in pharmaceuticals industry The efficiency for influencing the removing free radical of antioxidation polypeptide VECYGPNRPQF will not equally have potential poison with Conventional antioxidants Property.

3. safe and efficient, noresidue food-grade eukaryotic expression system pichia yeast expression system is used, it can high efficient expression Anti-oxidation peptide of the safe and environment-friendly, high efficient expression from the natural algae of safety being eaten for a long time RKKRRQRRRVECYGPNRPQF, the antioxidation polypeptide have very strong anti-oxidation function, and can enter cell and effectively remove certainly By base.

4. plasmid integration is entered engineering bacteria genome, heredity is more stable, and makes building process more rapidly, accurately and letter Just.

5. there is no extra molecular modification and label addition, the product anti-oxidation peptide of expression in molecular level operating process It is identical with Natural Antioxidant Peptides RKKRRQRRRVECYGPNRPQF structure, size, genetic safety problem is not present.

6. expression quantity is relatively high, and be easy purifying because Pichia pastoris itself exocrine protein is few, expression it is anti-oxidant Polypeptide protein 18mg/L.

7. the culture medium used that ferments is less expensive, purifying is also relatively easy, so that the production cost of albumen significantly drops It is low, and ABTS culture medium can be effectively removed in vitro, free radical can also be effectively removed in vivo.

Detailed description of the invention

Fig. 1 is Pichia yeast engineering Pichia pastoris KM71H FZM_{2014 TAT-AOP}Construct overall process schematic diagram.

Elimination effect of the antioxidation polypeptide TAT-AOP and other antioxidants that Fig. 2 present invention generates to ABST free radical Contrast schematic diagram.

The result shows that antioxidation polypeptide VECYGPNRPQF addition cell-penetrating peptide TAT (49-57) has no effect on its anti-oxidant work Property, and there is the bioactivity more more efficient than ascorbic acid and BHT.

Fig. 3 daily ration adds four kinds of antioxidants of 0.03% content to ATM in Growth Performance of Weaning Piglets and enteron aisle jejunum The influence of gene expression amount.

The antioxidation polypeptide RKKRRQRRRVECYGPNRPQF that the present invention obtains compared with other antioxidants can imitate with more having into Enter intestinal tissue, alleviate weaning stress, improves Growth Performance of Weaning Piglets.

Specific embodiment

Technical solution of the present invention is if not otherwise specified the conventional scheme of this field.

Embodiment 1:

A kind of expression has the Pichia yeast engineering Pichia pastoris of antioxidation polypeptide of the cell membrane across function KM71H FZM_{2014 TAT-AOP}, building process is as follows:

Strain and carrier

Strain and vector gene type and source are shown in Table 1.

1 strain of table and vector gene type and source

Toolenzyme:

RNaseA, Proteinase K are purchased from Shanghai Sangon Biotech Company；Restriction enzyme Xho I and BshT I is purchased from Ther mo；2 × PCR master Mix is purchased from Beijing Tiangeng biotech company.

Plasmid and Yeast genome kit:

In a small amount, middle amount and large quantity extracting plasmid kit, Yeast genome kit are QIAGEN Products.

Culture medium:

LB liquid medium: yeast extract 5g；Peptone 10g；NaCl 5g；Water is added to be settled to 1L.LB solid culture Base: final concentration of 1.5% agar powder is added in LB liquid medium.

A, expression cassette P_AOX1-αFactor-RKKRRQRRRVECYGPNRPQF-Zeocin^rBuilding, first with Pichia pastoris Preferred codons engineer's TAT-AOP nucleotide sequence, specifically:AGAAAAAAAAGAAGACAAAGAAGAAGAGTTGAAT GTTACGGTCCAAATAGACCACAATTT.Contain according to the sequence design before the expression promoter of pPICZ α plasmid and after terminator There are the TAT-AOP nucleotide sequence of Xho I and BshT I restriction enzyme site, specially nucleotide sequence 2:GCCAGCATTGCTGCTA AAGAAGAAGGGGTAAGAAAAGAGAGGCTGAAGCTAGAAAAAAAAGAAGACAAAGAAGAAGAGTTGAAT GTTACGGTCCAAATAGACCACAATTTTGAGTTTGTAGCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTA CGAGAAGCTTCTCGTAAGTGCCCA.Above two sections of sequences are synthesized by Changsha Zhong Jin Biotechnology Co., Ltd. Contain the TAT-AOP nucleotide of Xho I and BshT I restriction enzyme site with restriction enzyme Xho I and BshT I double digestion respectively Sequence and pPICZ α carrier, agarose gel electrophoresis separate and recover after purification, will contain Xho I after digestion using T4 ligase It is connected with the TAT-AOP nucleotide sequence of BshT I restriction enzyme site with pPICZ α carrier.Using obtaining expression cassette after Sac I digestion P_AOX1-αFactor-RKKRRQRRRVECYGPNRPQF-Zeocin ^r；

B, Pichia yeast engineering Pichia pastoris KM71H FZM_{2014 TAT-AOP}Building: use electroporation Expression cassette P after linearizing_AOX1-αFactor-RKKRRQRRRVECYGPNRPQF-Zeocin^rExpression plasmid import Pichia In pastoris KM71H, sent out using the gene aox1 on methods of homologous recombination and Pichia pastoris KM71H genome Raw homologous recombination, through being integrated with expression cassette 5 ' on antibiotic Zeocin and PCR amplification stripe size screening Preliminary Identification genome P_AOX1-αFactor-RKKRRQRRRVECYGPNRPQF-Zeocin^rPichia pasto ris KM71H engineering bacteria, and carry out PCR product sequence finally determines.The engineering bacteria has sent to China typical culture collection center on November 6th, 2014 and has protected Hiding, classification naming: Pichia pastoris KM71H FZM_{2014 TAT-A OP}, deposit number: CCTCC NO:M2014553 Location: Wuhan, China Wuhan University.

Embodiment 2:

The preparation of TAT-AOP polypeptide and Activity determination, its step are as follows:

1) the recovery Pichia pastoris KM71H on the YPD plate containing 100 μ g/ml zeocin FZM_{2014 TAT-AOP}；

2) from monoclonal is chosen on recovery plate in containing in YPD culture medium, 17h is cultivated in 30 DEG C of shakings；

3) by a volume culture 17h Pichia pastoris KM71H FZM_{2014 TAT-AOP}, it is inoculated in the fermentation of ten volumes In culture medium, shake flask fermentation, sample-loading amount 1/5 are carried out.30 DEG C, 260rpm, shaking culture 4d；Period, every 8h was added once The ammonium hydroxide (commercially available, ammonia concn 25%) of 0.15% (v/v), adds one time 0.1% (v/v) the pure methanol of analysis for 24 hours, and 0.4% Microelement PTM1 (v/v)；According to above-mentioned cultural method, after culture four days, it is 35 that bacterial strain density, which reaches OD600,.

The formula of the fermentation medium are as follows:

Glucose 4% (w/v), (25%) 150 μ L of ammonium hydroxide, KH₂PO₄0.7% (w/v), MgSO₄.7H₂0.03% (w/ of O V), FeSO₄.7H₂O 0.05% (w/v), MnSO₄.H₂O 0.05% (w/v), peptone 0.1% (w/v), pH5.5.

PTM1 formula are as follows: copper sulphate 6g/L, potassium iodide 0.08g/L, manganese sulfate monohydrate 3g/L, Sodium Molybdate Dihydrate 0.2g/L, Boric acid 0.02g/L, zinc chloride 20g/L, cobalt chloride 0.5g/L, ferrous sulfate heptahydrate 65g/L, biotin 0.2g/L, sulfuric acid 5ml/ L。

4) 4 DEG C of centrifugation 3min of 8000rpm obtain supernatant；

5) supernatant is taken, volume 2 × SDS-PAGE sample-loading buffer is doubled, 100 DEG C of placement 7min carry out Tricine SDS-PAGE electrophoresis detection；In the visible obvious band in the position 2.2KD, and control group does not have then.

6) high-pressure liquid chromatography isolates and purifies out TAT-AOP polypeptide, and carries out mass spectrum and determine TAT-AOP polypeptide.

The yield of TAT-AOP is about 70mg/L in supernatant when fermentation ends.

7) component that freeze-drying is collected obtains the TAT-AOP polypeptide that tool cell membrane passes through ability.

The antioxidation polypeptide that the TAT-AOP polypeptide that above step isolates and purifies acquisition is maintained and directly synthesized The similar good external activity of VECYGPNRPQF is identified, method reference literature with the body function that ABTS free radical carries out (Arts,M.J.T.J.,Dallinga,J.S.,Voss,H.P.,Haenen,G.R.M.M.,Bast,A.,2004.A new approach to ass ess the total antioxidant capacity using the TEAC Assay.FoodChem.88,567-570.), as a result see Fig. 2, the results showed that antioxidation polypeptide VECYGPNRPQF adds cell-penetrating peptide TAT (49-57) has no effect on its antioxidant activity, and has the bioactivity more more efficient than ascorbic acid and BHT.

Embodiment 3:

TAT-AOP polypeptide is preparing the application in feed additive for weaning piglet, and application process is as follows:

According to NRC standard, creep feed is designed.The TAT-AOP egg of 0.03% (w/w) after purification is added in creep feed respectively White, ascorbic acid (Vc), 2,6- di-tert-butyl-4-methy phenols (BHT) feed weanling pig, every group 6 repetition, and control group does not add Add any antioxidant, observes the expression quantity of ATM in its growth performance and intestinal tissue (for evaluating tissue active oxygen accumulation State, accumulation is higher, and the expression quantity of ATM gene is higher), show the antioxidation polypeptide that the present invention obtains RKKRRQRRRVECYGPNRPQF can be efficiently entering intestinal tissue, alleviate weaning stress, improve Growth Performance of Weaning Piglets (result It is shown in Table 2 and Fig. 3).

Influence of the anti-oxidant reagent of table 2 to Growth Performance of Weaning Piglets

Project	Control group	Ascorbic acid	BHT	RKKRRQRRRVECYGPNRPQF
					Initial weight, kg	8.02	8.03	8.04	8.02
Average daily gain, g	555.3c	615.5b	622.8b	635.2a
					Feedstuff-meat ratio	1.69a	1.60b	1.59b	1.54c

Shoulder note same letter of going together in table indicates that difference is not significant (P>0.05), adjacent letters expression significant difference (P< 0.05), alternate^aLetter indicates that difference is extremely significant (P < 0.01).

SEQUENCE LISTING

<110>the Institute of Subtropical Agriculture, The Chinese Academy of Sciences

<120>a kind of expression tool cell membrane passes through Pichia yeast engineering and the application of the antioxidation polypeptide of function

<130>a kind of expression tool cell membrane passes through Pichia yeast engineering and the application of the antioxidation polypeptide of function

<160> 2

<170> PatentIn version 3.1

<210> 1

<211> 60

<212> DNA

<213>artificial sequence

<400> 1

agaaaaaaaa gaagacaaag aagaagagtt gaatgttacg gtccaaatag accacaattt 60

<210> 2

<211> 20

<212> PRT

<213>artificial sequence

<400> 2

Arg Lys Lys Arg Arg Gln Arg Arg Arg Val Glu Cys Tyr Gly Pro Asn

1 5 10 15

Arg Pro Gln Phe

20

Claims (7)

1. a kind of artificial synthesized peptide T AT-AOP, the peptide T AT-AOP are shown in SEQ ID NO.2.

2. encoding the gene of polypeptide described in claim 1.

3. gene according to claim 2, the polynucleotides of the gene are shown in SEQ ID NO.1.

4. a kind of genetic engineering bacterium, it is characterised in that: Pichia yeast engineering Pichia pastoris KM71H FZM_{2014 TAT-AOP}, deposit number: CCTCC NO:M 2014553.

5. the method for preparing polypeptide shown in SEQ ID NO.2 using genetic engineering bacterium described in claim 4, comprising:

Pichia yeast engineering Pichia pastoris KM71H FZM is chosen from recovery plate_{2014 TAT-AOP}Monoclonal is in YPD In culture medium, 17h is cultivated in 30 DEG C of shakings；By a volume culture 17h Pichia pastoris KM71H FZM_{2014 TAT-AOP}, connect Kind carries out shake flask fermentation in ten volume fermentation mediums, and culture medium sample-loading amount is 1/5；30 DEG C, 260rpm, shaking culture 4d；Period, every 8h added one time 0.15% ammonium hydroxide, added the one time 0.1% pure methanol of analysis, 0.4% microelement PTM1 for 24 hours (v/v)；Cultivate four days to obtain the final product；

The formula of the fermentation medium are as follows:

Glucose 4%w/v, 150 μ L of ammonium hydroxide, KH₂PO₄0.7%w/v, MgSO₄.7H₂O 0.03%w/v, FeSO₄.7H₂O 0.05%w/v, MnSO₄.H₂O 0.05%w/v, peptone 0.1%w/v, pH5.5.

6. genetic engineering bacterium as claimed in claim 4 or polypeptide described in claim 1 are preparing the application in feed addictive.

7. application according to claim 6, it is characterised in that: the feed is weanling pig feed.