CN105779612A - Lynch syndrome gene detection reagent kit and application thereof - Google Patents

Abstract

The invention provides a Lynch syndrome gene detection reagent kit and application thereof by carrying out gene mutation detection analysis on 50 blood samples of family members with the typical Hui people Lynch syndrome to search for gene mutation related to pathogenesis of family members. The sequences of PCR primers in the reagent kit include that the sequence of the upstream primer is 5'-TATTCCCCGAGCTCCTAAA-3', and the sequence of the downstream primer is 5'-TGTGGGCATGCGCTGTAC-3'. By means of the Lynch syndrome gene detection reagent kit, conventional MSI and gene mutation screening can be carried out on suspected patients with the Lynch syndrome, early diagnosis and early treatment of diseases can be promoted, and certain guiding significance is achieved on subsequence chemotherapy regimen selection and prognosis judgment.

Description

A kind of Lynch syndrome gene detecting kit and application thereof

(1) technical field

The present invention relates to detect the primer of MLH1 gene mutation, and a kind of Lynch syndrome gene detecting kit and Its application.

(2) background technology

Lynch syndrome is previously otherwise known as cancer in hereditary nonpolyposis colorectal cancer (HNPCC), loses for autosomal dominant Passing disease, sickness rate accounts for the 2%～3% of all colorectal cancers.Its clinical characters is: Familial Occurrence tumor, and primary knot is straight Intestinal cancer is common, is positioned at proximal colonic, single-shot or concurrent parenteral tumor more, and pathology differentiation is poor, mostly is poorly differentiated adenocarcinoma and mucus Adenocarcinoma, relatively early (the median age is about about 44 years old), but prognosis is good compared with Sporadic Colorectal Carcinoma for age of onset.

The main pathogenesis basis of Lynch syndrome is the mispairing repair function obstacle that MMR gene mutation causes.Disease family Found in 1895 by Warthin the earliest.By Lynch further investigation clear and definite its heredity, clinicopathological characteristics, and by its point Type, so gaining the name.Wherein I type shows as merely colorectal cancer, II type also can concurrent parenteral tumor, such as stomach, endometrium, biliary tract And pancreas tumor etc..Et al., by full-length genome search and family's linkage analysis of large information capacity, it is determined that The tumor susceptibility gene of cancer is MMR gene.Later, increasing mispairing was repaired family gene and was found, and reported the most in the world Mainly have MLH1, MSH2, MSH6, PMS1, PMS2 etc..MMR genetic flaw does not only result in the generation of tumor, because of its functional defect The change of the downstream elements caused also contributes to transfer and the invasion and attack of tumor, and this is from the one hand explaining that Lynch syndrome swells The differentiation of tumor tissue pathology is poor, but the preferable feature of patient's prognosis.

Along with the miniaturization of family of modern society, typical Lynch syndrome family reduces day by day, and what this was this disease grinds Study carefully and bring inconvenience.The research of China's Lynch syndrome is started late, and the research for ethnic groups family is less.

(3) summary of the invention

The present invention dashes forward by 1 example typical Hui ethnic group Lynch syndrome family member blood sample 50 many cases are carried out gene Become detection to analyze, find relevant gene mutation of falling ill to family member, it is provided that a kind of Lynch syndrome gene detection reagent Box and application thereof.

The technical solution used in the present invention is:

The primer of detection MLH1 gene mutation, described primer is to draw for the PCR of amplified sample MLH1 exon 1 Thing, its sequence is:

Forward primer: 5 '-TATTCCCCGAGCTCCTAAA-3 '；

Downstream primer: 5 '-TGTGGGCATGCGCTGTAC-3 '.

The invention still further relates to a kind of Lynch syndrome gene detecting kit utilizing aforementioned primer to prepare, specifically include that

(1) DNA extraction reagent；

(2) PCR amplifing reagent:

Including specific PCR amplimer and PCR reaction reagent, described specific PCR amplimer sequence is as follows:

Forward primer: 5 '-TATTCCCCGAGCTCCTAAA-3 '；

Downstream primer: 5 '-TGTGGGCATGCGCTGTAC-3 '.

In test kit, DNA extraction reagent and PCR reaction reagent are this area conventional reagent, may also include DNA sequencing examination Agent, for checking order (also may not include sequencing reagent and entrust other specialized agencies to check order) to PCR primer.

May also include MLH1 gene standard substance in described test kit as comparison, its gene order is as follows:

5’-TATTCCCCGAGCTCCTAAAaacgaaccaataggaagagcggacagcgatctctaacgcgcaagcgc atatccttctaggtagcgggcagtagccgcttcagggagggacgaagagacccagcaacccacagagttgagaaatt tgactggcattcaagctgtccaatcaatagctgccgctgaagggtggggctggatggcgtaagctacagctgaagga agaacgtgagcacgaggcactgaggtgattggctgaaggcacttccgttgagcatctagacgtttccttggctcttc tggcgccaaaatgtcgttcgtggcaggggttattcggcggctggacgagacagtggtgaaccgcatcgcggcggggg aagttatccagcggccagctaatgctatcaaagagatgattgagaactggtacggagggagtcgagccgggctcact taagggctacgacttaacgggccgcgtcactcaatggcgcggacacgcctctttgcccgggcagaggcatGTACAGC GCATGCCCACA-3’.Amplification is compareed with standard substance, if (underscore part is outside first to First Exon sequence Aobvious subsequence) the 264th base sported T by G, then can determine whether that it is suffered from Lynch syndrome associated cancer risk and raises.

The invention still further relates to the application in Lynch syndrome gene screening of the described detection kit.

Concrete, described screening method is as follows:

(1) person's sample DNA to be measured is extracted；

(2) with sample DNA as template, described specific PCR amplimer and PCR reaction reagent, composition PCR reaction are added System, carries out PCR amplification；

(3) the PCR product that step (2) obtains checks order, if the 264th base of First Exon sequence is dashed forward by G Becoming T, it is higher that person the most to be measured suffers from Lynch syndrome associated cancer risk.

Concrete, described PCR reaction condition is as follows: 95 DEG C of denaturations 3min, 94 DEG C of degeneration 30s, 55～60 DEG C of annealing 35s, 72 DEG C extend 40～50s, repair for 72 DEG C and extend 5～8min, totally 35 circulations.

The MLH1 gene mutation that the present invention relates to is new mutational site, and this is Chinese Minority Nationalities Lynch syndrome base Because mutation research adds new data.The correlational study of China's Lynch syndrome is started late, although has formulated and has met China The examination standard of actual Lynch syndrome, but attention degree clinically is relatively low, and rate of missed diagnosis is higher.It is reported, MMR gene The risk that carriers of mutation suffers from colorectal cancer significantly increases, and the risk suffering from parenteral tumor is significantly higher than general population equally.Therefore, Clear and definite diagnosis, carries out conventional MSI and gene mutation for screening to the patient of doubtful Lynch syndrome, and to finding that sudden change is carried Person tightly monitors to be beneficial to early of disease examine and early controls.China's research to Lynch family gene mutation at present more disperses, Lack and link up widely and cooperate, be unfavorable for Lynch syndrome deeper into research, and easily cause the waste of resource.Therefore have Necessity sets up a stable disease research platform and unified gene mutation registration and inquiry data base as early as possible, accelerates China Lynch syndrome progress of research.

The beneficial effects are mainly as follows: the invention provides a kind of Lynch syndrome gene detecting kit, Can carry out the patient of doubtful Lynch syndrome early of conventional MSI and gene mutation for screening, beneficially disease examining and early control, to rear Continuous Chemotherapy Choice and judging prognosis have certain directive significance.

(4) accompanying drawing explanation

Fig. 1 is Hui ethnic group Lynch syndrome pedigree chart；

Fig. 2 is family specimens MMR immunoreaction scorings chemical results (× 200)；IV 1 tumor tissues MLH1 eggs White negative (A figure bottom), IV 1 normal gland tissue MLH1 protein positives (A figure top)；IV 8 tumor tissues MLH1 protein negative (B figure bottom), IV 8 normal gland tissue MLH1 protein positives (B figure top)；IV 13 tumor tissues MLH1 protein negative (C figure)；

Fig. 3 is family proband's MLH1 gene 1 exon sequencer map；Arrow indication is MLH1 gene 1 exon C.264G ＞ T sudden change；

Fig. 4 is checking sequencer map in family；A-E is colorectal cancer patients in family, and F-J is normal person in family, arrow Indication is MLH1 gene 1 exon c.264G ＞ T sudden change.

(5) detailed description of the invention

Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in This:

Embodiment 1:

Inventor is found that 1 example Hui ethnic group Lynch syndrome family, family existing 6 generations, alive Colon and rectum in clinical position Cancer patient 6 people, carries out linkage analysis to this family collection of illustrative plates, for autosomal dominant inheritance, AD.Now detected by the method for DNA sequencing Family specimens microsatellite instability, understands the common MMR base of specimens by immunohistochemistry The expression of cause, and to finding to express the MMR gene direct Sequencing of defect, find pathogenic mutation site.

1 materials and methods

1.1 physical data

Proband, male, 37 years old, it is chief complaint is admitted to hospital with " times of defecation increases companion's hemafecia 3 months ".Enteroscopy is shown in away from anus The door 8～13cm left front walls of rectum have a cauliflower-like to swell thing, and border is clear, has Ya Di, it is seen that leopard's spots mucosa, size about 5 × 5mm, table Face is filthy, and matter is crisp, oozing of blood.Tube chamber is narrow and small, and scope still can pass through.Patient on August 22nd, 2005, descending " rectal cancer was trans-abdominal in general anesthesia Perineum combined resection ".Postoperative pathological diagnoses: rectum poorly differentiated adenocarcinoma, and cancerous tissue leaching and placenta percreta, two cut end have no that cancer is soaked Moisten, cancerometastasis (2/5) seen from lymph node.Non-row chemicotherapy after operation in patients, suffers from again colon cancer after 10 years.

This family existing 6 generations, total colorectal cancer patients 14 people, wherein colorectal cancer patients 12 people, rectal cancer patient 3 people, There are two example patients for rectal cancer future trouble colon cancer.In patient, 7 people die, and 7 people are still living and in good health, and mother proband is colorectal cancer patients, Outer Gongwei's rectal cancer patient.(pedigree chart is shown in Fig. 1)

1.2 method

1.2.1 peripheral blood and tumor tissues DNA extraction

According to Medical Ethics principle, inform patient and this research purpose of family members and method, after informed consent, take in this family 6 Name patient and the peripheral blood of 5 normal persons, use QIAGEN company whole blood DNA to extract test kit and extract whole blood DNA, use light splitting light Concentration and the quality of put forward DNA measured by degree instrument.Meeting the DNA of requirement of experiment in 20 DEG C of stored refrigerated, below standard sample is again Extract and preserve.

Separately take three patients of this family (IV 1, IV 8, IV 15) previously taken tumor paraffin-embedded tissue (tumor tissues of operation All meet requirement of experiment through lens-belowed identifying), hand microtome is cut into slices, and thickness is 5 μm, and each patient's tumor tissues takes 4～6 Section (abandons ground floor section), quickly puts in 1.5 microlitre centrifuge tubes, uses QIAGEN company paraffin-embedded tissue DNA to carry Take test kit and extract DNA, measure concentration and the quality of put forward DNA with spectrophotometer.Meet requirement of experiment DNA cold in 20 DEG C Hide and preserve.

1.2.2 tumor tissues microsatellite instability detects

Choose three patients (IV 1, IV 8, IV 15) tumor tissues and the carried DNA of peripheral blood to suffer from as detection sample, detection Person's tumor tissues DNA microsatellite instability (MSI).The judgement mark that detection site is recommended according to national cancer institute Standard, uses these 5 sites of BAT25, BAT26, D5S346, D2S123, D17S150 to detect.PCR primer reference literature report Road.Criterion: in 5 sites, 2 and above site instability are judged to MSI-H, and 1 site instability is judged to MSI-L, 5 sites are stable person and are judged to that microsatellite is stable (microsatellite stable, MSS).

1.2.3 mismatch repair protein (MMR) Immunohistochemical detection

MLH1, MSH2 and MSH6 protein expression level in detection specimens, three kinds of antibody are purchased from new company advanced in years. Method uses immunohistochemistry Envision two step method, takes 3 patients (IV 1, IV 8, IV 15) tumor paraffin-embedded tissue, with Away from incisxal edge colon (more than tumor 5cm) the conduct comparison of tumor, contrast tumor cell and normal tissue cell mispairing Repair the differential expression of albumen.

1.2.4 mismatching repair gene mutation detection

MLH1 gene expression defect in specimens is found through mismatch repair protein detection, therefore to MLH1 gene 19 Exon checks order.

Choosing family proband's whole blood DNA is sample, and design primer is shown in Table 1, and primer is by Shanghai Sheng Gong biotechnology company Synthesis.

Table 1:MLH1 exon amplification list of primers

Using Sheng Gong bio-engineering corporation PCR reaction kit to expand MLH1 gene extron subregion, amplification is anti- Answer system 50 μ l, comprise: each 1 μ l of template DNA 1 μ l, forward and reverse primer, DNTP 10mM 1 μ l, Taq Buffer 5 μ l, 25mM MgCl 25 μ l, Taq enzyme (5U/ μ l) 0.5 μ l, water 35.5 μ l.

Amplification reaction condition: 95 DEG C of denaturations 3min, 94 DEG C of degeneration 30s, 55～60 DEG C annealing 35s, 72 DEG C extend 40～ 50s, repairs for 72 DEG C and extends 5～8min, totally 35 circulations.

Product uses agarose gel electrophoresis detection, the order-checking of product Song Shenggong biotechnology company.Order-checking knot Fruit contrast uses SeqMan software.

1.2.5 checking in the family of mutational site

According to sequencing result find to have in MLH1 gene 1 exon region two heterozygosis missense mutations c.264G ＞ T, C.265G ＞ T, 5 patients and 5 normal individual peripheral blood MLH1 gene 1 exon sudden changes, amplified reaction in detection family Test kit uses Sheng Gong bio-engineering corporation PCR reaction kit, and primer uses previous step order-checking 1 exon primer used, Reaction system and condition are the same.Product uses detected through gel electrophoresis, the order-checking of product Song Shenggong biotechnology company.Survey Sequence Comparative result uses SeqMan software.

2 results

2.1 pedigree analysis

This family proband, in morbidity in 37 years old, suffers from rectum poorly differentiated adenocarcinoma, and cancerous tissue leaching and placenta percreta, in postoperative rectal cancer Within 10 years, suffer from colon cancer.Collecting and analyze other patient medical record data of family, colon cancer site of pathological change is respectively positioned on right hemicolon, and pathology is examined Breaking as tubular adenocarcinoma or mucinous adenocarcinoma, Carcinoma cell differentiation degree is the most relatively low, without cancer in situ, invades and scope is from placenta percreta to holostrome. These features are consistent with the Lynch syndrome pathological characters of report.

This family has 14 example colorectal cancer patients, alive 6 example patients.Twice three patients of existence 1 grade each other in family The phenomenon of relatives, patient's Colon and rectum mucosa does not all find multiple adenomatous polyps.In family, all there is morbidity in continuous 3 generations.Have bright Really in the patient of diagnosis of age, there are 7 non-patient's diagnosis of age less than 50 years old, the most minimum 32 years old.Through analyzing, this family meets Amsterdam standard, it is standard most stringent in numerous Lynch syndrome clinical criteria.

2.2 tumor tissues microsatellite instability testing results

Through the direct Sequencing analysis to five microsatellite locus, patient IV 1, IV 8, IV 15 tumor tissues DNA all shows For MSI-H.

2.3 mismatch repair proteins (MMR) SABC testing result

Immunohistochemistry is cut into slices through Microscopic observation, and result shows: patient IV 1, IV 8, IV 15 tumor tissues MLH1 albumen Being feminine gender, MSH2 and MSH6 protein expression is the positive (Fig. 2).

2.4 mismatching repair gene mutation screening results

Family proband's 19 exons of peripheral blood MLH1 gene are carried out order-checking and finds have 2 to dash forward on 1 exon Displacement point, is respectively c.264G ＞ T, c.265G ＞ T (see Fig. 3), and remaining exon does not finds sudden change.At NCBI snp database In do not look into SNP known to above-mentioned site.Aminoacid sequence is translated in NCBI Protein Blast data according to mutant nucleotide sequence Storehouse carries out specificity contrast with common several animal amino acids, find these animals at this site amino sequence with wild Type is consistent, thus it is speculated that the possible conserved sequence of this place, site sequence, through analyzing, c.264G ＞ T sports samesense mutation not to amino Acid sequence produces impact, and c.265G ＞ T may result in MLH1 gene translation aminoacid sequence and become carrying from glutamic acid at the 22nd Front terminator sequence is translated.Using Polyphen to carry out protein function prediction, result is harmful.Speculate c.265G ＞ T sudden change due to Terminate amino acid sequence translation in advance so that protein function is lost.

The result in 2.5 sudden change familys

Choose another 5 patients of this family and 5 be not suffering from patient's peripheral blood DNA sample, for find Sudden change region to MLH1 Gene 1 exon checks order, and all patients all find identical mutation in same position, and in normal individual, 4 people do not find to dash forward Become 1 people and find identical mutation (see Fig. 4).

Conclusion: MLH1 gene First Exon missense mutation site c.265G ＞ T and this family hereditary nonpolyposis The generation of colorectal cancer disease is relevant.

Claims (6)

1. detecting the primer of MLH1 gene mutation, described primer is to draw for the PCR of amplified sample MLH1 exon 1 Thing, its sequence is:

Forward primer: 5 '-TATTCCCCGAGCTCCTAAA-3 '；

Downstream primer: 5 '-TGTGGGCATGCGCTGTAC-3 '.

2. a Lynch syndrome gene detecting kit, specifically includes that

(1) DNA extraction reagent；

(2) PCR amplifing reagent:

Including specific PCR amplimer and PCR reaction reagent, described specific PCR amplimer sequence is as follows:

Forward primer: 5 '-TATTCCCCGAGCTCCTAAA-3 '；

Downstream primer: 5 '-TGTGGGCATGCGCTGTAC-3 '.

3. detection kit as claimed in claim 2, it is characterised in that described test kit also includes MLH1 gene standard substance, its Sequence is as follows: 5 '-TATTCCCCGAGCTCCTAAAaacgaaccaataggaagagcggacagcgatctctaac gcgcaagcg catatccttctaggtagcgggcagtagccgcttcagggagggacgaagagacccagcaacccacagagttgagaaat ttgactggcattcaagctgtccaatcaatagctgccgctgaagggtggggctggatggcgtaagctacagctgaagg aagaacgtgagcacgaggcactgaggtgattggctgaaggcacttccgttgagcatctagacgtttccttggctctt ctggcgccaaaatgtcgttcgtggcaggggttattcggcggctggacgagacagtggtgaaccgcatcgcggcgggg gaagttatccagcggccagctaatgctatcaaagagatgattgagaactggtacggagggagtcgagccgggctcac ttaagggctacgacttaacgggccgcgtcactcaatggcgcggacacgcctctttgcccgggcagaggcatGTACAG CGCATGCCCACA-3’。

4. the application in Lynch syndrome gene screening of the detection kit described in claim 2.

Apply the most as claimed in claim 4, it is characterised in that described screening method is as follows:

(1) person's sample DNA to be measured is extracted；

(2) with sample DNA as template, add described specific PCR amplimer and PCR reaction reagent, form PCR reactant System, carries out PCR amplification；

(3) the PCR product that step (2) obtains checks order, if the 264th base of First Exon sequence is sported by G T, it is higher that person the most to be measured suffers from Lynch syndrome associated cancer risk.

Apply the most as claimed in claim 5, it is characterised in that described PCR reaction condition is as follows: 95 DEG C of denaturations 3min, 94 DEG C Degeneration 30s, 55～60 DEG C of annealing 35s, 72 DEG C extend 40～50s, repair for 72 DEG C and extend 5～8min, totally 35 circulations.