CN105779578A - Method for detecting salmonellae by virtue of recombinase-mediated isothermal nucleic acid amplification technology - Google Patents
Method for detecting salmonellae by virtue of recombinase-mediated isothermal nucleic acid amplification technology Download PDFInfo
- Publication number
- CN105779578A CN105779578A CN201510532772.4A CN201510532772A CN105779578A CN 105779578 A CN105779578 A CN 105779578A CN 201510532772 A CN201510532772 A CN 201510532772A CN 105779578 A CN105779578 A CN 105779578A
- Authority
- CN
- China
- Prior art keywords
- salmonella
- detection
- nucleic acid
- amplification
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a method for detecting salmonellae by virtue of a recombinase-mediated isothermal nucleic acid amplification technology. The detection method makes use of a recombinase-mediated isothermal nucleic acid amplification system, a reaction buffer and a salmonella detection primer. The method is conducted under an isothermal condition (at 35-45 DEG C),and the amplification of salmonella specific genes is achieved within 10-60min. The detection method disclosed by the invention is high in sensitivity, good in specificity, convenient and rapid to operate and is low in requirement on quality of detection materials. The method is applicable to the rapid detection of the salmonellae.
Description
Technical field
The invention belongs to molecular Biological Detection field, be specifically related to a kind of method utilizing recombinase-mediated isothermal amplification quickly to detect Salmonella.
Background technology
Salmonellosis is also known as paratyphoid fever, it is that various animal is caused the general name of disease by Salmonella bacteria, also it is one of zoonosis important on public hygienics, it can be asymptomatic carrier state after human poultry infection, can also appear as the fatal disease of clinical symptoms, it is likely to increase the weight of the state of an illness and mortality rate, or reduces the Breeding productivity of animal.Egg, poultry and meat products are the primary vehicle of Salmonella, infect and depend primarily on the serotype of Salmonella and the health of eater.
Salmonella is a kind of Gram-negative sporeless bacterium parasitized in humans and animals intestinal, and most amphitrichous also can move, and nutritional requirement is not high, bile tolerance, and resistance to external world is relatively strong, is widespread in nature.Its serotype is many, widely distributed, is a kind of important infecting both domestic animals and human cause of disease bacterium, is the important polluter of food, water source and livestock products, can cause the diseases such as people's alimentary toxicosis, acute gastroenteritis and animal diarrhea in Enterobacter cloaca section.Salmonella is modal food-borne pathogens, is also study most active antibacterial in food transmission cause of disease bacterium.In alimentary toxicosis, by salmonellal poisoning case, account for the 40% of bacterial food poisoning.Owing to any animal is had pathogenic by most Salmonellas, the intestinal infection of people and many animals can be caused, be the main pathogenic fungi polluting the animal food such as Fowl meat, fowl egg, often cause people's alimentary toxicosis.
Salmonella, as an important indicator of food inspection, has important meaning on public health, port quarantine and animal and veterinary.Traditional Detection Methods of Salmonella is owing to detecting the shortcomings such as cycle length, loss is high, program reagent complicated, required is various, can not meet far away the testing requirement in modern times, this not only brings white elephant to testing department, but also making production division's product operating and the time lengthening stored in a warehouse, expense increases.
In recent years, development along with science and technology, particularly molecular biological development, domestic and international researcher has been set up more Detection Methods of Salmonella based on nucleic acid quick, sensitive, such as polymerase chain reaction, (PCR and several molecular methods such as real-time fluorescence PCR and nest-type PRC according to polymerase chain reaction detection Salmonella have built up, and it is well used in the detection of Salmonella, substantially reduces the time of detection.But these methods need to use complicated instrument and well-equipped laboratory, the requirement of instrument is higher and need technical professional to have operated, these factors strongly limit its application in grass-roots unit and Site Detection.
Can not meeting, due to existing Detection Methods of Salmonella, the demand that Salmonella quickly detects on the spot, therefore research one can be applied in basic unit, can the amplification method of simple and quick detection Salmonella be highly desirable to.
It is short, highly sensitive that isothermal amplification in the present invention not only detects the time, and has broken away from the constraint of instrument, it is possible to carries out in a non-laboratory environment, reaches the purpose of Site Detection.Additionally, it is not the method is easy to operate, personnel requirement is high.Therefore the method has highly application value, and is not only suitable for research work, it is also possible to carry out conventional and Emergent detection instrument as the grass-roots unit related personnel that appointed condition is relatively poor.
Summary of the invention
A kind of method that it is an object of the invention to provide isothermal amplification detection Salmonella utilizing recombinase-mediated, this detection method have main steps that the extraction first carrying out salmonella gene group, salmonella gene group DNA is joined in the isothermal nucleic acid amplification system containing special primer and probe and expand, at isothermy (35-45oC), under, within 10-60 minute, amplified production can be detected.
The concrete technical scheme of the present invention is as follows:
1. obtain salmonella gene group DNA, the primer of design detection Salmonella and probe, set up Salmonella isothermal nucleic acid amplification system, salmonella gene group DNA is joined in amplification system, add reaction buffer, under isothermy (35-45 DEG C), within 10-60 minute, namely can detect that amplified production.
2., according to the method described in above-mentioned 1, set up Salmonella isothermal nucleic acid amplification system, as follows:
3., according to the isothermal nucleic acid amplification system described in above-mentioned 1,2, its state is Powdered after lyophilization.
4., according to utilizing, described in above-mentioned 1, the method that isothermal amplification quickly detects Salmonella, wherein said reaction buffer is final concentration of 4%-7% (w/v), and molecular weight is the Aqueous Solutions of Polyethylene Glycol of 35000.
5., according to the primer sets described in above-mentioned 1,2, its primer sequence is:
Forward primer sequence: 5 '-CAGTTTATCGTTATTACCAAAGGTTCAGAA-3 ',
Reverse primer sequences: 5 '-CGGCATCCGCATCAATAATACCGGCCTTCA-3 '.
6. according to the method described in above-mentioned 1,2,3,4,5, it is achieved the Optimum Isothermal condition of amplification is 37 DEG C, Best Times is 40 minutes, and amplified production adopts agarose gel electrophoresis to detect.
7. according to the method described in above-mentioned 1,2,3,4,5, it is characterised in that add exonuclease and probe in above-mentioned system, it is achieved more quickly detection in real time；According to said method detecting Salmonella, the Optimum Isothermal condition of its amplification is 39oC, Best Times is 20 minutes.
8., according to the method described in above-mentioned 7, the exonuclease of addition is exonuclease III；
According to the probe described in above-mentioned 7, its probe sequence is: 5 '-TCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACA-3 ', and wherein, the fluorescent probe used is the probe that fluorescence/quencher is modified.
9. the method according to above-mentioned 1-8, isothermal nucleic acid amplification system volume can be any one volume in 25 μ L, 50 μ L, 100 μ L or other volume, and optimal volume is 50 μ L.
Accompanying drawing explanation
Fig. 1 is the agarose gel electrophoresis figure using the isothermal amplification of the present invention quickly to detect Salmonella, and wherein M is Marker, ATCC is Salmonella reference culture, and 9320 is Salmonella 9320 bacterial strain, and 567 is Salmonella 567 bacterial strain；
Fig. 2 is the real-time fluorescence result figure using the isothermal amplification of the present invention quickly to detect Salmonella.
Detailed description of the invention
It is described in further detail the present invention by embodiment below, but present disclosure is not limited thereto.
Embodiment one:
1, sample source and Salmonella DNA extraction
Salmonella ATCC reference culture, Salmonella 9320 bacterial strain, Salmonella 567 bacterial strain and what coli strain system was provided by Zhejiang International Travel Healthcare Center, DNA extraction equipment is KINGFISHER Full automatic instrument for extracting nucleic acid (Thermo).
2, design of primers
Design following Salmonella primer, and student on commission work biological engineering (Shanghai) limited company synthesize:
Forward primer sequence: 5 '-CAGTTTATCGTTATTACCAAAGGTTCAGAA-3 ',
Reverse primer sequences: 5 '-CGGCATCCGCATCAATAATACCGGCCTTCA-3 '.
3, preparation amplification system
200 μ L centrifuge tubes carry out isothermal nucleic acid amplification system preparation (volume is 50 μ L) by following proportioning:
The amplification system prepared above negative pressure lyophilization in freezer dryer is become powdered amplification system.
4, Salmonella DNA detection
In centrifuge tube, add final concentration of 6.5% (w/v's), molecular weight is that system is dissolved as reaction buffer and become 49 μ L by the Polyethylene Glycol of 35000 again, add the 1 μ L salmonella gene group DNA prepared, mix homogeneously, brief centrifugation, amplified reaction 40 minutes in 37 DEG C of water-baths, after having reacted, add 50 μ L phenol chloroform (1:1), vibration, centrifugal 5 minutes of 12000rpm, draw 10 μ L of supernatant liquid and be added on agarose gel, TAE buffer is used to carry out electrophoresis, amplified production is observed under ultraviolet projectoscope, positive (ATCC, 9320, 567) in molecular weight 133bp position, DNA cloning band occurs, and escherichia coli and negative product are all without amplified band, as shown in Figure 1.(note: for guaranteeing experiment accuracy, the system being not added with template is set as negative control).
Embodiment two:
1, sample source and Salmonella DNA extraction
Sample source and DNA extraction are with embodiment one.
2, primer and probe design
Design following Salmonella primer and probe, and student on commission work biological engineering (Shanghai) limited company synthesize:
Forward primer sequence: 5 '-CAGTTTATCGTTATTACCAAAGGTTCAGAA-3 ',
Reverse primer sequences: 5 '-CGGCATCCGCATCAATAATACCGGCCTTCA-3 '.
Probe sequence:
5 '-TCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACA-3 ', wherein, the fluorescent probe used is the probe that FAM fluorescence/quencher is modified.
3, preparation amplification system
200 μ L centrifuge tubes carry out isothermal nucleic acid amplification system preparation (volume is 50 μ L) by following proportioning:
The amplification system prepared above negative pressure lyophilization in freezer dryer is become powdered amplification system.
4, Salmonella DNA detection
Putting in the instrument that can detect FAM fluorescence, set reaction temperature as 39 DEG C, the response time is 20 minutes.(note: for guaranteeing experiment accuracy, the system being not added with template is set as negative control).Result shows, starts the fluorescence signal of display amplification after 6 minutes.As shown in Figure 2, figure showing, detecting signal to 13 minutes has reached high point.Repeat above example, identical amplification fluorescent signal can be obtained, reproducible.
Above example illustrates that the isothermal amplification that utilizes using the present invention can quickly detect Salmonella, and easy and simple to handle, the time used reduces significantly, it is not necessary to large-scale instrument and equipment, it is adaptable to screen on a large scale.
Detection method sensitivity provided by the present invention is high, specificity is good, easy and simple to handle, rapid and test material prescription is low, it is simple to application clinically, and the method is applicable to the quick detection to Salmonella.
The foregoing is only the preferably enforcement example of the present invention, not in order to limit the present invention, all within the spirit and principles in the present invention, any amendment of making, equivalent replacement, improvement etc., should be included within protection scope of the present invention.
Sequence table
<110>Jiangsu Qi Tian gene bio tech ltd
<120>a kind of isothermal nucleic acid amplification method detecting Salmonella
<130>
<160>3
<170>PatentInversion3.3
<210>1
<211>30
<212>DNA
<213>artificial sequence
<400>1
cagtttatcgttattaccaaaggttcagaa30
<210>2
<211>30
<212>DNA
<213>artificial sequence
<400>2
cggcatccgcatcaataataccggccttca30
<210>3
<211>49
<212>DNA
<213>artificial sequence
<400>3
tcgcggaagtcgcggcccgattttctctggatggtatgcccggtaaaca49
Claims (10)
1. the method utilizing recombinase-mediated isothermal amplification detection Salmonella, this detection method includes isothermal nucleic acid amplification system, primer sets and reaction buffer, and amplification is at isothermy 35-45oCarry out under C, in 10-60 minute, namely can detect that Salmonella.
2. the method for detection Salmonella according to claim 1, it is characterised in that described isothermal nucleic acid amplification system and each constituent content are shown below:
。
3. the method for the detection Salmonella according to claim 1,2, it is characterised in that described system status is Powdered after lyophilization.
4. the method for detection Salmonella according to claim 1, it is characterised in that described reaction buffer is final concentration of 4%-7% (w/v), and molecular weight is the Aqueous Solutions of Polyethylene Glycol of 35000.
5. the primer sets according to claim 1,2, it is characterised in that primer sequence is:
Forward primer sequence: 5 '-CAGTTTATCGTTATTACCAAAGGTTCAGAA-3 ',
Reverse primer sequences: 5 '-CGGCATCCGCATCAATAATACCGGCCTTCA-3 '.
6. the method according to claim 1-5, it is characterised in that the Optimum Isothermal condition realizing amplification is 37 DEG C, and Best Times is 40 minutes, amplified production adopts agarose gel electrophoresis to detect.
7. the method according to claim 1-5, it is characterised in that add exonuclease and probe in above-mentioned system, it is achieved more quickly detection in real time；According to said method detecting Salmonella, the Optimum Isothermal condition of its amplification is 39oC, Best Times is 20 minutes.
8. method according to claim 7, it is characterised in that the exonuclease of addition is exonuclease III.
9. probe according to claim 7, it is characterised in that probe sequence is:
5 '-TCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACA-3 ', wherein, the fluorescent probe used is the probe that fluorescence/quencher is modified.
10. the method according to claim 1-8, it is characterised in that isothermal nucleic acid amplification system volume can be any one volume in 25 μ L, 50 μ L, 100 μ L or other volume, and optimal volume is 50 μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510532772.4A CN105779578A (en) | 2015-08-27 | 2015-08-27 | Method for detecting salmonellae by virtue of recombinase-mediated isothermal nucleic acid amplification technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510532772.4A CN105779578A (en) | 2015-08-27 | 2015-08-27 | Method for detecting salmonellae by virtue of recombinase-mediated isothermal nucleic acid amplification technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105779578A true CN105779578A (en) | 2016-07-20 |
Family
ID=56390135
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510532772.4A Pending CN105779578A (en) | 2015-08-27 | 2015-08-27 | Method for detecting salmonellae by virtue of recombinase-mediated isothermal nucleic acid amplification technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105779578A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108048584A (en) * | 2017-12-08 | 2018-05-18 | 吴斌 | The brucellar probe of RAA Fluorometric assays and kit |
| CN108517325A (en) * | 2018-04-09 | 2018-09-11 | 深圳市艾伟迪生物科技有限公司 | Preparation method, expressing gene and the recombinant expression carrier of recombinase UvsY |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102816756A (en) * | 2012-09-07 | 2012-12-12 | 江苏奇天基因生物科技有限公司 | Isothermal nucleic acid amplification reaction reagent and isothermal nucleic acid amplification method |
-
2015
- 2015-08-27 CN CN201510532772.4A patent/CN105779578A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102816756A (en) * | 2012-09-07 | 2012-12-12 | 江苏奇天基因生物科技有限公司 | Isothermal nucleic acid amplification reaction reagent and isothermal nucleic acid amplification method |
Non-Patent Citations (2)
| Title |
|---|
| FABRIZIO CARLETTI: "Short Report: Rapid Detection and Quantification of Chikungunya Virus by a One-Step Reverse Transcription–Polymerase Chain Reaction Real-Time Assay", 《AM. J. TROP. MED. HYG.》 * |
| SEBASTIAN KERSTING: "Multiplex isothermal solid-phase recombinase polymerase amplification for the specific and fast DNA-based detection of three bacterial pathogens", 《MICROCHIM ACTA》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108048584A (en) * | 2017-12-08 | 2018-05-18 | 吴斌 | The brucellar probe of RAA Fluorometric assays and kit |
| CN108517325A (en) * | 2018-04-09 | 2018-09-11 | 深圳市艾伟迪生物科技有限公司 | Preparation method, expressing gene and the recombinant expression carrier of recombinase UvsY |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107022644B (en) | Multiple LAMP (loop-mediated isothermal amplification) detection primers, detection kit and detection method for six food-borne pathogenic bacteria in fruits and vegetables | |
| Liu et al. | Development of a novel multiplex PCR assay for the identification of Salmonella enterica Typhimurium and Enteritidis | |
| US11725252B2 (en) | PCR detection kit for rapidly identifying Salmonella of specific serotypes | |
| Eyigor et al. | Rapid detection of Salmonella from poultry by real-time polymerase chain reaction with fluorescent hybridization probes | |
| Wang et al. | The novel multiple inner primers-loop-mediated isothermal amplification (MIP-LAMP) for rapid detection and differentiation of Listeria monocytogenes | |
| Kuo et al. | Rapid and sensitive detection of Mycoplasma synoviae by an insulated isothermal polymerase chain reaction-based assay on a field-deployable device | |
| Dean et al. | Deletion in the gene BruAb2_0168 of Brucella abortus strains: diagnostic challenges | |
| CN104263838A (en) | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for Listeria monocytogenes | |
| Zhi et al. | Development of recombinase-aided amplification (RAA)-Exo-probe and RAA-CRISPR/Cas12a assays for Rapid Detection of Campylobacter jejuni in Food samples | |
| CN106282375A (en) | The LAMP primer group of a kind of Salmonella typhimurium and test kit and using method | |
| Gumaa et al. | Specific detection and differentiation between Brucella melitensis and Brucella abortus by a duplex recombinase polymerase amplification assay | |
| Dijkman et al. | Development, validation and field evaluation of a quantitative real-time PCR able to differentiate between field Mycoplasma synoviae and the MS-H-live vaccine strain | |
| CN104988246A (en) | Eriocheir sinensis white spot syndrome virus specificity PCR detection kit and method | |
| CN104263839A (en) | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for brucella | |
| CN102925548A (en) | Actinobacillus pleuropneumoniae LAMP kit and application method thereof | |
| Liu et al. | Multiplex PCR assay based on the citE2 gene and intergenic sequence for the rapid detection of Salmonella Pullorum in chickens | |
| Kipper et al. | Salmonella serotype assignment by sequencing analysis of intergenic regions of ribosomal RNA operons | |
| CN105779578A (en) | Method for detecting salmonellae by virtue of recombinase-mediated isothermal nucleic acid amplification technology | |
| Okamura et al. | Rapid, sensitive, and specific detection of the O4 group of Salmonella enterica by loop-mediated isothermal amplification | |
| CN104278098A (en) | Kit and method for fast detecting enterohemorrhagic escherichia coli 0157:H7 | |
| CN103911433A (en) | Loop-mediated isothermal amplification (LAMP) detection primer group of aeromonas hydrophila, and kit | |
| CN103789430B (en) | Kit for rapid detection of eperythrozoon, leptospira and toxoplasma in blood and application of kit | |
| CN106119383A (en) | Meninges deteriorated blood Elizabethan's collarium mediated constant temperature gene amplification fast detecting kit and detection method | |
| CN106244690B (en) | A kind of multiple PCR detection kit of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin | |
| AU2019100071A4 (en) | Pcr detection kit for rapidly identifying salmonella of specific serotypes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160720 |