CN105755121A - Detection method for clostridium perfringens of intestinal tracts of meat ducks - Google Patents

Detection method for clostridium perfringens of intestinal tracts of meat ducks Download PDF

Info

Publication number
CN105755121A
CN105755121A CN201610154754.1A CN201610154754A CN105755121A CN 105755121 A CN105755121 A CN 105755121A CN 201610154754 A CN201610154754 A CN 201610154754A CN 105755121 A CN105755121 A CN 105755121A
Authority
CN
China
Prior art keywords
perfringens
detection method
enteron aisle
dna
reaction
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610154754.1A
Other languages
Chinese (zh)
Inventor
曾秋凤
陈代文
廖航
代述均
张克英
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sichuan Agricultural University
Original Assignee
Sichuan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sichuan Agricultural University filed Critical Sichuan Agricultural University
Priority to CN201610154754.1A priority Critical patent/CN105755121A/en
Publication of CN105755121A publication Critical patent/CN105755121A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a detection method for clostridium perfringens of intestinal tracts of meat ducks. The method comprises steps as follows: DNA extraction: a feces DNA extraction kit is adopted, and total DNA of chime of ceca of ducks is extracted into a 1.5-ml EP tube according to extraction steps and stored in a refrigerator at subzero 20 DEG C; design of primers; synthesis of standard plasmids: two ends of each designed primer extend dozens of bp and then handed over to the TaKaRa bioengineering company for complete-gene synthesis, genes are cloned to plasmids, and standard products are formed; production of a standard curve; detection of samples: to-be-detected sample DNA is subjected to a fluorescent quantitative PCR (polymerase chain reaction) according to a reaction system and reaction conditions. With the adoption of the method, harmful germs, namely, the clostridium perfringens, of the intestinal tracts of the ducks can be detected quickly and accurately through detection procedures; the absolute copy number of the germs can be determined through absolute quantification of the clostridium perfringens of the intestinal tracts of the ducks, and reference is provided for treatment of diseases. The method can be used for detection of clostridium perfringens of intestinal tracts of other animals.

Description

A kind of detection method of meat duck enteron aisle C.perfringens
Technical field
The invention belongs to the pathogenic microorganism examination technical field, particularly relate to a kind of meat duck enteron aisle and produce The detection method of gas capsular clostridium.
Background technology
C.perfringens (clostridium perfringens) is to cause duck and the overwhelming majority to move One of the main pathogenic fungi of thing necrotic enteritis, enterotoxemia and emphysematous gangrene.This bacterium is produced Raw exotoxin is major virulent factor, at least more than 15 kinds.C.perfringens is at intestines In road, quantity is few, sentences enteron aisle poised state, can't cause Animal diseases, but when raising During bad environments and feed rotten, pathogenic bacteria can include C.perfringens by raised growth, Thus affect breeding performonce fo animals, reduce productivity effect.The detection of enteron aisle C.perfringens, Be conducive to understanding ambient conditions and the safe coefficient of feed of plant.Quantitative fluorescent PCR Technology is to utilize the change of fluorescence signal to monitor each circulation in pcr amplification reaction in real time to expand The change of volume increase thing amount, is carried out quantitatively starting template by the relation of Ct value and calibration curve Analyze.Its absolute quantification analysis has great significance for the research of virus and pathogen.
What enteric microorganism detection method used at present has two kinds, and one is colony counting method, should Method is coarse, pollutes ratio big, and Detection results is bad.Another kind is real-time fluorescence quantitative PCR Method, this method detection sensitivity is high, pollutes little, but depends on and check order and the most bad, easily There is false negative.
Summary of the invention
It is an object of the invention to provide the detection method of a kind of meat duck enteron aisle C.perfringens, Aiming to solve the problem that the current method of enteric microorganism detection method exists pollution ratio big, Detection results is not Good, depend on and check order and the most bad, false-negative problem easily occurs.
The present invention is achieved in that after duck enteron aisle chyme Genome DNA extraction, uses fluorescence Quantifying PCR method, C.perfringens contained by quantitative analysis every gram of content of duck enteron aisle exhausted To copy number, the detection method of described meat duck enteron aisle C.perfringens comprises the following steps:
Step one, DNA extracts: use faeces DNA to extract kit, according to extraction step, By duck caecum chyme Genome DNA extraction in 1.5mlEP pipe, it is stored in-20 DEG C of refrigerators, stand-by；
Step 2, design of primers: according to C.perfringens 16SrRNA sequence, at NCBI Specific conservative's series of upper this bacterium of acquisition, utilizes BIOEDIT to design one couple of PCR primers, Respectively at primer CGCATAACGTTGAAAGATGG end and CCTTGGTAGGCCGTTACCC end adds fluorescent dye FAM and TAM, is expanding Increase one Single base extension probe of conserved sequence district design in district, at probe sequence TCATCATTCAACCAAAGGAGCAATCC end, adds the alkali that a design determines Base, as this Serotype-dependent sequence mark；
Step 3, the synthesis of standard plasmid: designed primer two ends are extended tens bp, Then transfer to Bao Bio-Engineering Company to carry out full genome synthesis, and gene be cloned in plasmid, Form standard items；
Step 4, the making of calibration curve；
Step 5, the detection of sample: by testing sample DNA by reaction system and reaction bar Part carries out quantitative fluorescent PCR reaction.
Further, described primer sequence and probe sequence:
C.perfringens upstream primer SEQ ID NO:1, downstream primer SEQ ID NO: 1, probe SEQ ID NO:3.
Further, the gene order SEQ ID NO:4 of the synthesis of described standard plasmid.
Further, the making of described calibration curve specifically includes:
Plasmid is pressed decimal dilution method, is diluted to 10 concentration gradients with ultra-pure water, takes 10 Aseptic 1.5mlEP pipe, number consecutively 1-10, and respectively add the ultra-pure water of 90 μ l, take product Gas capsular clostridium standard plasmid stoste 10 μ l, in No. 1 EP pipe, quickly blows and beats 20-30 time, Whirlpool 10s, 3250rpm are centrifuged 30s, repeat this step and manage to No. 10 EP, obtain 10 The standard items of individual gradient, take six gradients of 2-7 and carry out quantitative fluorescent PCR.
Further, described reaction system, upstream primer 0.3 μ l；Downstream primer 0.3 μ l；Probe 0.2μl；RNase-Free ddH2O 3.2μl；2×SuperReal PreMix 5.0μl；DNA mould Plate 1.0 μ l.
Further, described reaction condition:
The denaturation stage, 1 circulation, temperature 95 DEG C, time 15min, content denaturation, Do not gather fluorescence signal；
The PCR stage of reaction, 40 circulations, temperature 95 DEG C, time 3s, content sex change, no Gather fluorescence signal；
The PCR stage of reaction, temperature 55 DEG C, time 30s, content annealing/extend, gather glimmering Optical signal.
The detection method of the meat duck enteron aisle C.perfringens that the present invention provides uses fluorescence Quantitative PCR TapMan method, has specific height, reproducible, sensitivity high； The present invention concentration by each reagent of optimizing reaction system, primer concentration controls at 300nM, visits Pin concentration controls at 200nM, makes expanding effect reach optimal；Hand is diluted by quick continuous print Method, reduces the problems such as dilution sample contamination, thus ensures to dilute the accuracy of gradient；Logical Crossing detection program can be quick, the harmful bacteria C.perfringens of duck enteron aisle detected accurately； By the absolute quantitation to duck enteron aisle C.perfringens, it may be determined that the absolute copy number of this bacterium, Treatment to disease provides reference.The present invention may be used for other animal intestinal C.perfringens Detection.
Accompanying drawing explanation
Fig. 1 is the detection method of the meat duck enteron aisle C.perfringens that the embodiment of the present invention provides Flow chart.
Fig. 2 is that C.perfringens absolute quantitation PCR of setting up that the embodiment of the present invention provides is marked Directrix curve schematic diagram.
Fig. 3 is the amplification curve that the present invention sets up standard items used by C.perfringens.
Fig. 4 is the testing result schematic diagram of the embodiment that the embodiment of the present invention provides.
Detailed description of the invention
In order to make the purpose of the present invention, technical scheme and advantage clearer, below in conjunction with Embodiment, is further elaborated to the present invention.Should be appreciated that tool described herein Body embodiment only in order to explain the present invention, is not intended to limit the present invention.
Below in conjunction with the accompanying drawings the application principle of the present invention is explained in detail.
As it is shown in figure 1, the detection method of the meat duck enteron aisle C.perfringens of the embodiment of the present invention Comprise the following steps:
S101:DNA extracts: use faeces DNA to extract kit, according to extraction step, By duck caecum chyme Genome DNA extraction in 1.5mlEP pipe, it is stored in-20 DEG C of refrigerators, stand-by；
S102: design of primers: according to C.perfringens 16SrRNA sequence, at NCBI Specific conservative's series of upper this bacterium of acquisition, utilizes BIOEDIT to design one couple of PCR primers, Fluorescent dye FAM and TAM is added respectively at primer 5` end and 3` end.In amplification region One Single base extension probe of conserved sequence district design, at probe 3` end, adds a design really Fixed base, as this Serotype-dependent sequence mark, transfers to Invitrogen Corp. to synthesize； Primer sequence and probe are shown in Table 1；C.perfringens upstream primer SEQ ID NO:1, under Trip primer SEQ ID NO:1, probe SEQ ID NO:3.
The synthesis of S103: standard plasmid: designed primer two ends are extended tens bp, so After transfer to Bao Bio-Engineering Company to carry out full genome synthesis, and gene is cloned in plasmid, shape Become standard items；Gene order SEQ ID NO:4, is shown in Table 2；
The making of S104: calibration curve: plasmid is pressed decimal dilution method, is diluted to ultra-pure water 10 concentration gradients, take 10 aseptic 1.5mlEP pipes, number consecutively 1-10, and respectively add Enter the ultra-pure water of 90 μ l, take C.perfringens standard plasmid stoste 10 μ l and manage in No. 1 EP In, quickly piping and druming 20-30 time, whirlpool 10s, 3250rpm are centrifuged 30s, repeat this step To No. 10 EP pipes, obtain the standard items of 10 gradients, take six gradients of 2-7 and carry out fluorescence Quantitative PCR.Test device therefor is Bio-Rad 96 hole quantitative real time PCR Instrument；PCR is anti- Answering system to be shown in Table 3, reaction condition is shown in Table 4；
The detection of S105: sample: testing sample DNA is pressed reaction system and the table of table 3 The reaction condition of 4 carries out quantitative fluorescent PCR reaction.
Table 1
Table 2
Table 3
Reagent Volume
Upstream primer 0.3μl
Downstream primer 0.3μl
Probe 0.2μl
RNase-Free ddH2O 3.2μl
2×SuperReal PreMix 5.0μl
DNA profiling 1.0μl
Total 10μl
Table 4
The present invention is successfully established C.perfringens absolute quantitation PCR calibration curve, sees Fig. 2, The present invention can be quick by detection program, the harmful bacteria aerogenesis pod of duck enteron aisle detected accurately Film clostridium.The present invention is by the absolute quantitation to duck enteron aisle C.perfringens, it may be determined that should The absolute copy number of bacterium, the treatment to disease provides reference.The present invention may be used for other animals The detection of enteron aisle C.perfringens.C.perfringens belongs to real-time fluorescence quantitative PCR standard Curve, repeats pipe Ct value the poorest about 0.5, and between continuous 10 times of gradient concentrations, Ct value is only Difference is about 3.33, and with the logarithm of original template amount as abscissa, Ct value is ordinate, paints Make Bacillus perfringens belong to quantitative fluorescent PCR calibration curve equation: Y=-3.391X+42.828 (Y represents Ct value, and X represents the logarithm of original template amount), its In preferable linear relationship between initial template concentration and Ct, coefficient correlation is 0.990, tiltedly Rate is-3.391, and PCR amplification efficiency is 97.2%.
Below in conjunction with specific embodiment, the application principle of the present invention is further described.
The side of the high-sensitivity detection duck enteron aisle C.perfringens that embodiment of the present invention provides Method, 6 parts of duck caecum chyme about 200mg to be detected, comprise the following steps:
(1) Tian Gen company faeces DNA is used to extract kit, according to extraction step, by 6 Part duck caecum chyme Genome DNA extraction, in 1.5mlEP pipe, is stored in-20 DEG C of refrigerators, stand-by.
(2) according to C.perfringens 16SrRNA sequence, NCBI obtains this bacterium Specific conservative's series, utilizes BIOEDIT to design one couple of PCR primers, respectively at primer CGCATAACGTTGAAAGATGG end and CCTTGGTAGGCCGTTACCC End adds fluorescent dye FAM and TAM.A list is designed in the conserved sequence district of amplification region Base extension probes, at probe sequence TCATCATTCAACCAAAGGAGCAATCC End, adds the base that a design determines, as this Serotype-dependent sequence mark, transfers to Invitrogen Corp. synthesizes.Primer sequence and probe are shown in Table 1.
(3) designed primer two ends are respectively extended 37bp, then transfer to precious bioengineering public Department carries out full genome synthesis, and is cloned in plasmid by gene, forms standard items.Gene order It is shown in Table 2.
(4) making of calibration curve: plasmid is pressed decimal dilution method, is diluted to ultra-pure water 10 concentration gradients.Take 10 aseptic 1.5mlEP pipes, number consecutively 1-10, and respectively add Enter the ultra-pure water of 90 μ l.Take C.perfringens standard plasmid stoste 10 μ l to manage in No. 1 EP In, quickly piping and druming 20-30 time, whirlpool 10s, 3250rpm are centrifuged 30s, repeat this step To No. 10 EP pipes, obtain the standard items of 10 gradients.Take six gradients of 2-7 and carry out fluorescence Quantitative PCR.Test device therefor is Bio-Rad 96 hole quantitative real time PCR Instrument, and PCR is anti- Answering system to be shown in Table 3, reaction condition is shown in Table 4, and calibration curve is shown in Fig. 2, and its amplification curve is shown in Fig. 3.
(5) detection of sample: 6 parts of testing sample DNA are joined by the reaction system of table 3 The reaction condition of system and table 4 carries out quantitative fluorescent PCR reaction.
(6) testing result is shown in Fig. 4.
Analysis result is shown in Table 5
The foregoing is only presently preferred embodiments of the present invention, not in order to limit the present invention, All any amendment, equivalent and improvement etc. made within the spirit and principles in the present invention, Should be included within the scope of the present invention.

Claims (7)

1. the detection method of a meat duck enteron aisle C.perfringens, it is characterised in that described The detection method of meat duck enteron aisle C.perfringens comprises the following steps:
Step one, DNA extracts: use faeces DNA to extract kit, according to extraction step, By duck caecum chyme Genome DNA extraction in 1.5mlEP pipe, it is stored in-20 DEG C of refrigerators, stand-by；
Step 2, design of primers: according to C.perfringens 16SrRNA sequence, at NCBI Specific conservative's series of upper this bacterium of acquisition, utilizes BIOEDIT to design one couple of PCR primers, Respectively at two primer sequence CGCATAACGTTGAAAGATGG and The end of CCTTGGTAGGCCGTTACCC and end add fluorescent dye FAM and TAM, designs a Single base extension probe, at probe sequence in the conserved sequence district of amplification region TCATCATTCAACCAAAGGAGCAATCC end, adds the alkali that a design determines Base, as this Serotype-dependent sequence mark；
Step 3, the synthesis of standard plasmid: designed primer two ends are extended tens bp, Then transfer to Bao Bio-Engineering Company to carry out full genome synthesis, and gene be cloned in plasmid, Form standard items；
Step 4, the making of calibration curve；
Step 5, the detection of sample: by testing sample DNA by reaction system and reaction bar Part carries out quantitative fluorescent PCR reaction.
2. the detection method of meat duck enteron aisle C.perfringens as claimed in claim 1, its It is characterised by, described primer sequence and probe sequence:
C.perfringens upstream primer SEQ ID NO:1, downstream primer SEQ ID NO: 1, probe SEQ ID NO:3.
3. the detection method of meat duck enteron aisle C.perfringens as claimed in claim 1, its It is characterised by, the gene order SEQ ID NO:4 of the synthesis of described standard plasmid.
4. the detection method of meat duck enteron aisle C.perfringens as claimed in claim 1, its Being characterised by, the making of described calibration curve specifically includes:
Plasmid is pressed decimal dilution method, is diluted to 10 concentration gradients with ultra-pure water, takes 10 Aseptic 1.5mlEP pipe, number consecutively 1-10, and respectively add the ultra-pure water of 90 μ l, take product Gas capsular clostridium standard plasmid stoste 10 μ l, in No. 1 EP pipe, quickly blows and beats 20-30 time, Whirlpool 10s, 3250rpm are centrifuged 30s, repeat this step and manage to No. 10 EP, obtain 10 The standard items of individual gradient, take six gradients of 2-7 and carry out quantitative fluorescent PCR.
5. the detection method of meat duck enteron aisle C.perfringens as claimed in claim 1, its It is characterised by, described reaction system, upstream primer 0.3 μ l；Downstream primer 0.3 μ l；Probe 0.2 μ l； RNase-Free ddH2O 3.2μl；2×SuperReal PreMix 5.0μl；DNA profiling 1.0 μ l.
6. the detection method of meat duck enteron aisle C.perfringens as claimed in claim 1, its It is characterised by, described reaction condition:
The denaturation stage, 1 circulation, temperature 95 DEG C, time 15min, content denaturation, Do not gather fluorescence signal；
The PCR stage of reaction, 40 circulations, temperature 95 DEG C, time 3s, content sex change, no Gather fluorescence signal；
The PCR stage of reaction, temperature 55 DEG C, time 30s, content annealing/extend, gather glimmering Optical signal.
7. the detection method of meat duck enteron aisle C.perfringens as claimed in claim 1, its It is characterised by, described calibration curve equation: Y=-3.391X+42.828, Y represent Ct value, X Represent the logarithm of original template amount.
CN201610154754.1A 2016-03-17 2016-03-17 Detection method for clostridium perfringens of intestinal tracts of meat ducks Pending CN105755121A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610154754.1A CN105755121A (en) 2016-03-17 2016-03-17 Detection method for clostridium perfringens of intestinal tracts of meat ducks

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610154754.1A CN105755121A (en) 2016-03-17 2016-03-17 Detection method for clostridium perfringens of intestinal tracts of meat ducks

Publications (1)

Publication Number Publication Date
CN105755121A true CN105755121A (en) 2016-07-13

Family

ID=56333446

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610154754.1A Pending CN105755121A (en) 2016-03-17 2016-03-17 Detection method for clostridium perfringens of intestinal tracts of meat ducks

Country Status (1)

Country Link
CN (1) CN105755121A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107151704A (en) * 2017-06-23 2017-09-12 广东省农业科学院动物科学研究所 A kind of quantitative detecting method of Intestine of Broiler microorganism
CN109136396A (en) * 2018-09-19 2019-01-04 华南农业大学 A kind of specific detection primer and detection kit of clostridium welchii disease
CN113702640A (en) * 2021-06-16 2021-11-26 宁夏大学 Indirect ELISA method for clostridium perfringens beta 1 toxin antibody

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101613746A (en) * 2009-08-05 2009-12-30 广州军区广州总医院 The fast quantitative measurement method for detecting of clostridium perfringens and detection kit

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101613746A (en) * 2009-08-05 2009-12-30 广州军区广州总医院 The fast quantitative measurement method for detecting of clostridium perfringens and detection kit

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SHU-BIAO WU, ET AL.: "Real-Time PCR Assay for Clostridium perfringens in Broiler Chickens in a Challenge Model of Necrotic Enteritis", 《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107151704A (en) * 2017-06-23 2017-09-12 广东省农业科学院动物科学研究所 A kind of quantitative detecting method of Intestine of Broiler microorganism
CN109136396A (en) * 2018-09-19 2019-01-04 华南农业大学 A kind of specific detection primer and detection kit of clostridium welchii disease
CN113702640A (en) * 2021-06-16 2021-11-26 宁夏大学 Indirect ELISA method for clostridium perfringens beta 1 toxin antibody

Similar Documents

Publication Publication Date Title
CN113502352B (en) EMA-ddPCR primer and probe for detecting infectious ASFV and application
CN106957927A (en) African swine fever fluorescence PCR detection reagent, African swine fever fluorescence PCR detection reagent kit and its application
CN105624330A (en) Taqman-MGB fluorescent quantitative PCR kit and method for detecting 12 common viruses and bacteria of pig at same time
CN108950069A (en) Ox lumpy skin disease virus street strain TaqMan-MGB real-time fluorescence quantitative PCR detection primer, kit and detection method
CN107686864A (en) Porcine epidemic diarrhea virus TaqMan fluorescent quantitation RT PCR kits and its detection method
CN106636472B (en) Complete set of reagent and method for detecting avian influenza virus and chicken parvovirus
CN105755121A (en) Detection method for clostridium perfringens of intestinal tracts of meat ducks
CN105861641A (en) Primer, kit and method for detecting CHO cell DNA residues
CN108866244A (en) Detect RPA primer and probe, kit and its method of prawn irido virus
CN105779625B (en) It is a kind of to detect that Streptococcus suis is universal and streptococcus suis 2-type double fluorescent quantitative PCR primer, kit and method simultaneously
CN106435039A (en) Primers, probe, kit and method for detecting PRRS (porcine reproductive and respiratory syndrome) NADC-30 strain
CN105039585A (en) Primer used in RT-PCR detection of chicken infectious bronchitis virus, kit comprising the primer and detection method thereof
CN108504778A (en) Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application
CN105483214A (en) Mycobacterium tuberculosis detection kit and application thereof
CN105624329A (en) Real-time fluorescence nucleic acid isothermal amplification detection kit for human herpesvirus 1
CN106916907A (en) The fluorescence PCR method and kit of a kind of specific detection herpes simplex virus I, II type nucleic acid
CN105907890A (en) Primers, probe and method for rapidly distinguishing HP-PRRS (High pathogenic porcine reproductive and respiratory syndrome) vaccine strain GDr180 from HP-PRRS wild strain
CN103952498A (en) Porcine circovirus II SYBR Green fluorescence PCR (Polymerase Chain Reaction) diagnostic kit and application thereof
CN105002284A (en) Haemophilus paragallinarum fluorogenic quantitative PCR detection method
CN106282322A (en) A kind of Laboratory Animal Resource quality quick monitoring method
CN116024387A (en) Quadruple fluorescence PCR detection kit for porcine viral diarrhea pathogen and application thereof
CN109762931A (en) Primer, probe and the method for transmissible gastro-enteritis virus fluorescence quantitative RT-RCR detection
CN116121413A (en) Real-time fluorescent nucleic acid isothermal amplification detection kit for group B streptococcus and special primer and probe thereof
CN109468411A (en) A kind of real-time fluorescence quantitative RT-PCR detection method of H5 subtype avian influenza virus
CN109722492A (en) A method of detection H5 and H7N9 subtype highly pathogenic avian influenza virus and H9 subtype avian influenza virus

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20160713