CN105738342A - SERS method for in-situ-synthesizing nano-silver by serving aptamer as support - Google Patents

Abstract

The invention discloses an SERS method for in-situ-synthesizing nano-silver by serving an aptamer as a support, which achieves SERS signal specificity enhancing of target bacteria by serving the aptamer as the support to in-situ-synthesize nano-silver shells on the surfaces of pathogenic bacteria and aims at specifically enhancing SERS signals of a target bacterial strain, simplifying a data analysis procedure and intuitively distinguishing the bacterial strain to be detected through a Raman spectrum. Pathogenic bacteria are quickly detected based on the SERS technology and the aptamer, staphylococcus aureus and Listeria monocytogenes can be quantitatively detected within one hour. A low-signal-noise stable spectrogram can be collected within short integral time (2 s is 1/10-1/5 of normal integral time). The aptamer is directly applied to the SERS technology in a label-free mode for the first time, the bacteria are intuitively distinguished based on the spectrogram without a Raman marker for the first time, and a basis is provided for wide application of the SERS technology in the field of bacterial detection.

Description

A kind of with aptamers for support fabricated in situ nanometer silver SERS Method

Technical field

The present invention relates to a kind of SERS method being support fabricated in situ nanometer silver with aptamers, be to reach, at pathogen surface in situ synthesizing nano-silver shell, the method that object bacteria SERS signal specificity strengthens for support with aptamers, belong to field of detection of food safety.

Background technology

As far back as 1989, Holt et al. collected photosynthetic bacteria cell wall SERS spectra, thus the pull-up prelude of SERS detection microorganism.SERS technology was ripe all the more in the detection of antibacterial in recent years, but owing to the combination of antibacterial with nanoparticle is difficult to regulation and control, the SERS spectrogram poor repeatability obtained.Further, the SERS spectrogram difference of pathogen is the faintest, and some is difficult to directly distinguish according to SERS collection of illustrative plates, needs to classify with chemometrics method, adds the difficulty of Site Detection.For this series of problems, we search out a kind of oligonucleotide sequence can with specificity and high-affinity and do support, at one layer of nano silver shell of bacterium surface fabricated in situ, reach specificity and obtain the purpose of SERS signal.This oligonucleotide sequence is specific recognition bacterium surface site combining after folding, owing to it is rugosity, making the absorption little nanoparticle on its surface reunite is a big nanoparticle, and this nanoparticle surface agglomerated into is coarse, hot spot-effect becomes apparent from, and reinforced effects is more preferable.And owing to binding site is fixed, make hotspot's distribution fix, obtain the SERS signal of high duplication, homogeneity.Further, the method can only reach the effect that SERS strengthens to aimed strain, can intuitively identify detected antibacterial by spectrogram, eliminate loaded down with trivial details data analysis step.

Summary of the invention

The invention discloses a kind of SERS method being support fabricated in situ nanometer silver with aptamers, it is to reach, at pathogen surface in situ synthesizing nano-silver shell, the method that object bacteria SERS signal specificity strengthens for support with aptamers, purpose is intended to specificity and strengthens the SERS signal of aimed strain, simplify DAP, intuitively picked out detected bacterial strain by Raman spectrogram.

Disclosed by the invention a kind of with aptamers for support fabricated in situ nanometer silver SERS Method, by the following technical solutions:

After aptamers is specific binding with pathogen, immerses in silver nitrate solution, be subsequently adding sodium borohydride and quickly silver ion reduction become nano silver shell, reach SERS signal specificity reinforced effects.See Fig. 1.

A kind of with aptamers for support fabricated in situ nanometer silver described in the present invention SERS Method, comprises the following steps:

1) in LB culture medium 200rpm, under the conditions of 37 DEG C concussion cultivate freezing pathogen 11 hours；Take 1ml10⁷Cfu/ml antibacterial MilliQ H₂O washes twice；Then antibacterial is stored in 4 DEG C of refrigerators stand-by；

2) using 95 DEG C of degeneration of thermal cycler two minutes, within every 40 seconds, drop 2 DEG C and be gradually cooled to 37 DEG C, it is standby that the aptamers folded is stored in 4 DEG C of refrigerators；

3) the aptamers capture aptamers that folds of pathogen: 300nM hatches 20min with specified pathogen bacterium and no specific pathogen bacterium respectively, and with buffer solution 2 times to remove unconjugated aptamers, 4 DEG C save backup；

4) pathogen of aptamers capture in step 3) is hatched 5min with 10mM silver nitrate, add 10mM sodium borohydride solution, centrifugal, abandon supernatant, 1ml MilliQ H2O is resuspended, and 4 DEG C save backup；

5) sample in step 4) is carried out Raman scanning.

Having the active effect that of invention quickly detects pathogenic bacterium based on SERS technology and aptamers, can detect staphylococcus aureus and Listeria monocytogenes in 1h quantification.And accomplish also to collect low noise and stable spectrogram within the short time of integration (2s is the 1/10-1/5 of normal integration time).First by label-free for the aptamers SERS technology that directly applies to, first in the case of there is no Raman labels thing, rely on spectrogram intuitively to distinguish antibacterial, extensively apply in Bacteria Detection field provide the foundation for realizing SERS technology.

Accompanying drawing explanation

Fig. 1 is principle of the invention figure；

Fig. 2 is experimental example 1 staphylococcus aureus aptamers in-situ reducing nanometer silver SERS figure；

Fig. 3 is experimental example 2 Listeria monocytogenes aptamers in-situ reducing nanometer silver SERS figure；

Fig. 4 is that staphylococcus aureus aptamers in-situ reducing nanometer silver SERS mixes staphylococcus aureus SERS comparison diagram with conventional nano silver；

Fig. 5 is staphylococcus aureus aptamers in-situ reducing nanometer silver SERS detection by quantitative figure (10⁵Cfu/ml-10cfu/ml).

Detailed description of the invention

Illustrated further the description present invention by following example, and limit the present invention never in any form, on the premise of without departing substantially from the technical solution of the present invention, within any change that those of ordinary skill in the art made for the present invention easily realize or change fall within scope of the presently claimed invention.

Embodiment 1

1) in LB culture medium, staphylococcus aureus and Listeria monocytogenes (condition: 200rpm, 37 DEG C cultivate 11 hours) are cultivated in concussion respectively.Taking 1ml concentration respectively is 10⁷Cfu/ml staphylococcus aureus and Listeria monocytogenes MilliQ H₂O washes twice.Then the antibacterial washed is stored in 4 DEG C of refrigerators and is used for using further；

2) in biology company limited of storehouse U.S. synthesis staphylococcus aureus aptamers (TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGC TACAAC), use 95 DEG C of degeneration of thermal cycler two minutes, within every 40 seconds, dropping 2 DEG C and be gradually cooled to 37 DEG C, it is standby that the aptamers folded is stored in 4 DEG C of refrigerators；

3) the staphylococcus aureus aptamers that 300nM folds hatches 20min with staphylococcus aureus and Listeria monocytogenes respectively, with phosphate buffer wash 2 times to remove unconjugated aptamers, 4 DEG C save backup；

4) staphylococcus aureus and the Listeria monocytogenes of aptamers capture in step 3) are hatched 5min respectively with silver nitrate (10mM), add sodium borohydride (10mM) solution, centrifugal, abandon supernatant, 1ml MilliQ H₂O is resuspended, and 4 DEG C save backup；

5) sample in (4) is carried out Raman scanning.

Embodiment 2

1) in LB culture medium, staphylococcus aureus and Listeria monocytogenes (condition: 200rpm, 37 DEG C cultivate 11 hours) are cultivated in concussion respectively.Taking 1ml concentration respectively is 10⁷Cfu/ml staphylococcus aureus and Listeria monocytogenes MilliQ H₂O washes twice.Then the antibacterial washed is stored in 4 DEG C of refrigerators and is used for using further；

2) in biology company limited of storehouse U.S. synthesis Listeria monocytogenes aptamers (TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG), use 95 DEG C of degeneration of thermal cycler two minutes, within every 40 seconds, dropping 2 DEG C and be gradually cooled to 37 DEG C, it is standby that the aptamers folded is stored in 4 DEG C of refrigerators；

3) the Listeria monocytogenes aptamers that 300nM folds hatches 20min with staphylococcus aureus and Listeria monocytogenes respectively, with phosphate buffer wash 2 times to remove unconjugated aptamers, 4 DEG C save backup；

4) Listeria monocytogenes and the staphylococcus aureus of aptamers capture in step 3) are hatched 5min respectively with silver nitrate (10mM), add sodium borohydride (10mM) solution, centrifugal, abandon supernatant, 1ml MilliQ H₂O is resuspended, and 4 DEG C save backup；

5) sample in step 4) is carried out Raman scanning.

Test example 1

Using the sample of embodiment 1 preparation, staphylococcus aureus SERS signal obtains high intensity and strengthens, and the Listeria monocytogenes SERS signal processed with condition strengthens faint, it is not necessary to complicated data process just can directly pick out staphylococcus aureus.See Fig. 2.

Test example 2

Using the sample of embodiment 2 preparation, Listeria monocytogenes SERS signal obtains high intensity and strengthens, and the staphylococcus aureus SERS signal processed with condition strengthens faint, it is not necessary to complicated data process just can directly pick out Listeria monocytogenes.See Fig. 3.

Seeing Fig. 4. in staphylococcus aureus SERS spectrogram, at 735cm-1, spectral strength uses aptamers in-situ reducing nanometer silver to strengthen method and to be significantly larger than common nanometer silver mixing enhancing method.

See Fig. 5. when aptamers concentration is saturated, staphylococcus aureus aptamers in-situ reducing nanometer silver strengthens method spectral strength and staphylococcus aureus concentration linear correlation (R2=0.97897) at 735cm-1.

Claims (1)

1., with aptamers for a SERS method for support fabricated in situ nanometer silver, comprise the following steps:

1) in LB culture medium 200rpm, under the conditions of 37 DEG C concussion cultivate freezing pathogen 11 hours；Take 1ml10⁷Cfu/ml antibacterial MilliQ H2O washes twice；Then antibacterial is stored in 4 DEG C of refrigerators stand-by；

2) using 95 DEG C of degeneration of thermal cycler two minutes, within every 40 seconds, drop 2 DEG C and be gradually cooled to 37 DEG C, it is standby that the aptamers folded is stored in 4 DEG C of refrigerators；

3) the aptamers capture aptamers that folds of pathogen: 300nM hatches 20min with specified pathogen bacterium and no specific pathogen bacterium respectively, and with buffer solution 2 times to remove unconjugated aptamers, 4 DEG C save backup；

4) pathogen of aptamers capture in step 3) is hatched 5min with 10mM silver nitrate, add 10mM sodium borohydride solution, centrifugal, abandon supernatant, 1ml MilliQ H2O is resuspended, and 4 DEG C save backup；

5) sample in step 4) is carried out Raman scanning.