CN105732781B - A kind of albumen for promoting Trichoderma harzianum root table to colonize and its application - Google Patents

A kind of albumen for promoting Trichoderma harzianum root table to colonize and its application Download PDF

Info

Publication number
CN105732781B
CN105732781B CN201610235081.2A CN201610235081A CN105732781B CN 105732781 B CN105732781 B CN 105732781B CN 201610235081 A CN201610235081 A CN 201610235081A CN 105732781 B CN105732781 B CN 105732781B
Authority
CN
China
Prior art keywords
albumen
hfb8
hfb4
hfb
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610235081.2A
Other languages
Chinese (zh)
Other versions
CN105732781A (en
Inventor
沈其荣
蔡枫
黄启为
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN201610235081.2A priority Critical patent/CN105732781B/en
Publication of CN105732781A publication Critical patent/CN105732781A/en
Application granted granted Critical
Publication of CN105732781B publication Critical patent/CN105732781B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C—CHEMISTRY; METALLURGY
    • C05—FERTILISERS; MANUFACTURE THEREOF
    • C05F—ORGANIC FERTILISERS NOT COVERED BY SUBCLASSES C05B, C05C, e.g. FERTILISERS FROM WASTE OR REFUSE
    • C05F11/00—Other organic fertilisers
    • C05F11/08—Organic fertilisers containing added bacterial cultures, mycelia or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Mycology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of albumen for promoting Trichoderma harzianum root table to colonize and its application, belong to microbe technical field.Present invention firstly discovers that HFB little albumens family and its participating in the function that regulation and control Trichoderma harzianum is colonized in plant roots table, research shows, the presence of the family protein the colonizing with significant positive regulating and controlling effect in root table to Trichoderma harzianum.The albuminoid is caused to express and secrete in Pichia pastoris by technologies such as yeast heterogenous expression, fusion proteins.After the purified enrichment of albumen, external source is added into water planting planting system, and special protein envelope can be formed in root table, changes parent/hydrophobicity of root table, the quick of plant biological and ecological methods to prevent plant disease, pests, and erosion Promoting bacteria Trichoderma harzianum is promoted to colonize, compared with without colonization amount increase in the control group 48 hours of albumen 110% 180%.The present invention can effectively solve function bacterium in microorganism formulation and associated biomolecule fertilizer application based on trichoderma and colonize the problem of effect is not good, Field information effect is unstable.

Description

A kind of albumen for promoting Trichoderma harzianum root table to colonize and its application
Technical field
The present invention relates to a kind of albumen for promoting Trichoderma harzianum root table to colonize and its application, belong to microbe technology neck Domain.
Technical background
HFB albumen is the distinctive hydrophobicity little albumen of filamentous fungi.In about aspergillus, the report of trichoderma, the egg is referred to White family member and adhesive attraction of formation, the extension of mycelia and hydrophobic material surface of fungal spore surface hydrophobicity structure etc. have Close, but have no that it participates in the report that regulation and control trichoderma colonizes plant roots table.
With the development of microbial technique, inoculating microbe and its preparation through artificial screening and domestication and improvement are raw in agricultural Extensive use in the fields such as production, environmental pollution reparation.But due to the difference of soil and crop species, the soil moisture, the change of humidity Change and the presence of indigenous microorganism significantly affects colonizing and expanding for inoculating microbe, so that the work of inoculating microbe With DeGrain, further applying for functional microorganism is seriously constrained.Trichoderma harzianum (Trichoderma harzianum) SQR-T037 is that China scientist is isolated and realized the one of Commercialization application plant of plant for having biological and ecological methods to prevent plant disease, pests, and erosion and growth-promoting function concurrently Beneficial bacterium.Due to there is substantial amounts of indigenous microorganism and SQR-T037 competition for nutrients, living space etc., SQR- under field conditions The Field information effect of T037 and its Related product do not have as under laboratory condition so substantially with stably.Therefore, significantly carry High trichoderma SQR-T037 bacterial strains make it quickly turn into the sociales in numerous rhizosphere microorganisms, are in the colonization amount of plant root The guarantee of its biological and ecological methods to prevent plant disease, pests, and erosion and growth-promoting function is played, to the significant of trichoderma and its Related product.
The content of the invention
It is an object of the invention to provide a kind of new HFB albumen and its encoding gene.Present invention finds participate in regulation and control Trichoderma harzianum colonizes the related gene (albumen) of crop root.
Another object of the present invention is to provide application of the HFB albumen in promoting Trichoderma harzianum root table to colonize.
A further object of the present invention is to provide HFB albumen answering in the microbial-bacterial fertilizer based on function trichoderma is prepared With.
The purpose of the present invention is achieved through the following technical solutions：
A kind of HFB albumen, the HFB albumen is Trichoderma harzianum HFB protein family members, including HFB4 albumen and HFB8 albumen At least one of, described HFB4 albumen has the amino acid sequence as shown in SEQ ID NO.1, described HFB8 albumen tool Just like the amino acid sequence shown in SEQ ID NO.3.
The encoding gene of above-mentioned HFB albumen, it is that the encoding gene of the HFB4 albumen has such as SEQ ID NO.2 institutes The nucleotide sequence shown；The encoding gene of the HFB8 albumen has the nucleotide sequence as shown in SEQ ID NO.4.
Recombinant expression plasmid, transgenic cell line or transgenic engineered bacteria containing above-mentioned HFB protein coding genes.
Above-mentioned recombinant expression plasmid, is by the HFB4 protein coding genes hfb4 as shown in SEQ ID NO.2 or such as SEQ HFB8 protein coding genes hfb8 shown in ID NO.4 is inserted into expression plasmid of yeast pPICZ α A EcoR I and Xba I digestions Obtained between site.
The recombinant expression plasmid is specifically to be prepared using following steps：Using trichoderma harzianum strain SQR-T037 cDNA as mould Plate separately designs primer and enters performing PCR amplification, and obtained pcr amplification product and expression plasmid of yeast pPICZ α A are used into EcoR respectively The expression plasmid of yeast pPICZ α A of expression HFB4 albumen and HFB8 albumen are respectively obtained after I and Xba I digestions connection::HFB4 and pPICZαA::HFB8；
The primer for cloning hfb4 genes is as follows：
Sense primer hfb4-F:GGCTGAAGCTGAATTCACTCAGGAGCACCAGTTCGA(SEQ ID NO.5)
Anti-sense primer hfb4-R:GAGTTTTTGTTCTAGAATCTGGGGAAGGGCATCCTG(SEQ ID NO.6)
The primer for cloning hfb8 genes is as follows：
Sense primer hfb8-F:GGCTGAAGCTGAATTCGCTGTCTGCCCTGATGGTG(SEQ ID NO.7)
Anti-sense primer hfb8-R:GAGTTTTTGTTCTAGAATGTGGGTTCCAGCGGGGTT(SEQ ID NO.8).
Above-mentioned transgenic engineered bacteria, is transformed into after above-mentioned recombinant expression plasmid is linearized with Sac I single endonuclease digestions What is obtained in competence Pichia pastoris KM71H cells can express the Yeast engineering bacteria of HFB4 albumen and HFB8 albumen respectively.
Application of the above-mentioned HFB albumen in promotion functions trichoderma root table is colonized.
Those skilled in the art's research is found that HFB albumen participates in adjusting function trichoderma and colonizes answering for aspect in plant roots table With.The specifically application of the positive adjusting function of HFB albumen；The positive adjusting function is outer after HFB albumen is expressed in yeast Source is added into crop-planting system, the colonization amount of quick increase function Trichoderma.
Described crop is tomato or cucumber；Described function trichoderma is Trichoderma harzianum.
Application of the above-mentioned HFB albumen in the microbial-bacterial fertilizer based on function trichoderma is prepared.
The present inventor to trichoderma harzianum strain SQR-T037 by (being one plant of commercial applications and having the bacterium of patent protection Strain, preserving number is CGMCC NO.3308) genome analysis and annotation, find HFB protein families, wherein comprising HFB4 and There is notable fluctuation in two Class II members of HFB8, its expression quantity when SQR-T037 and tomato seedling are co-cultured.We pass through Gene cloning and the method for heterogenous expression cause HFB4 and the HFB8 a large amount in Pichia pastoris (Pichia pastoris) to express； And by fusion protein technology respectively with UV types green fluorescent protein (GFPuv) and pink colour fluorescin (mRFP) mark HFB4 with HFB8, obtains traceable HFB fusion proteins.As a result find, the HFB with fluorescence labeling can promptly be attached to plant roots It is surface, forms to self assembly special protein envelope, changes the hydrophily on root system of plant surface.The present invention to it is resulting not HFB albumen with fluorescence labeling uses TALON metal Affinity purifying resins, and has carried out colonizing test, it was demonstrated that pass through External source addition HFB albumen can promote Trichoderma harzianum quickly and efficiently to colonize in plant roots table.
Pichi strain used in the present invention is KM71H, and plasmid is pPICZ α A, and it methanol evoked is opened comprising one Mover AOX1, a α-Factor signal peptide, a bleomycin selection markers and 6 × His label.We use plasmid EcoR I and Xba I double digestions, then with Infusion homologous recombinations enzyme will clone obtained trichoderma SQR-T037 HFB4 and HFB8 genes (being free of introne) are inserted respectively into plasmid pPICZ α A, and are incorporated into yeast KM71H by electroporated mode In genome, high efficient expression HFB4 and HFB8 Yeast engineering bacteria are obtained, KM71H-HFB4 and KM71H-HFB8 is respectively designated as.
Described HFB protein production modes are as follows：
1) a small amount of thalline of engineering bacteria KM71H-HFB4 and KM71H-HFB8 is inoculated into containing 100 μ gml respectively-1It is rich next mould In the BMG fluid nutrient mediums of element (200ml), lower 28 DEG C of dark condition, 250rpm are cultivated 24 hours, and 8000rpm centrifugations are gone for 5 minutes Except culture medium, a large amount of thalline are obtained；BMG Liquid Culture based formulas is as follows：100mM kaliumphosphate buffers (pH 6.0), 1.34% Yeast nitrogen (yeast nitrogen containing 1.34g in YNB, w/v, g/ml, i.e., every 100ml culture mediums), 4 × 10–5%Biotin (w/v, g/ Ml), 1% glycerine (w/v, g/ml).
2) by the thalline renewed vaccination of acquisition into the BMM fluid nutrient mediums containing 0.5% (v/v) methanol, OD is originated600= 30, lower 28 DEG C of dark condition, 250rpm cultures, the methanol of addition in every 24 hours (add according to 0.5% amount of culture volume Plus), 8000rpm is centrifuged 5 minutes and is removed thalline after 72 hours, obtains HFB4 and HFB8 protein fermentation liquors；BMM culture medium prescriptions are such as Under：100mM kaliumphosphate buffers (pH 6.0), 1.34% yeast nitrogen (YNB, w/v), 4 × 10–5%Biotin (w/v), 0.5% (v/v) methanol.
3) take a small amount of protein solution to be used for SDS-PAGE protein electrophoresises and Western Blot checkings, confirm errorless rear use TALON metal Affinity purifying resins, finally with Vivaspin protein concentrations ultra-filtration centrifuge tube displacement solvent, will be purified Protein dissolution afterwards (pH6.6) in 100mM potassium phosphate solution, BCA methods determine protein content in 0.1-0.4mgml-1, -20 DEG C of preservations are stand-by.
Beneficial effects of the present invention：
Present invention firstly discovers that HFB4 albumen and HFB8 albumen in HFB little albumens families and its participating in regulation and control and breathing out thatch wood The mould function of being colonized in plant roots table, research shows, the presence of the family protein the colonizing with aobvious in root table to Trichoderma harzianum The positive regulating and controlling effect write.By technologies such as yeast heterogenous expression, fusion proteins the albuminoid is expressed simultaneously in Pichia pastoris Secretion.After the purified enrichment of albumen, external source is added into water planting planting system, and special protein envelope can be formed in root table, is changed Become parent/hydrophobicity of root table, promote the quick of plant biological and ecological methods to prevent plant disease, pests, and erosion Promoting bacteria Trichoderma harzianum to colonize, compared with the control group 48 without albumen Colonization amount increase 110%-180% in hour.The present invention can effectively solve the microorganism formulation and associated biomolecule based on trichoderma Function bacterium colonizes the problem of effect is not good, Field information effect is unstable in fertilizer application.
Brief description of the drawings
The HFB protein electrophoresises figure (left side) and Western Blot traces (right side) of Fig. 1 Yeast engineering bacterias expression
The Tomato Root System of HFB albumen attachment is fluorescently labeled under Fig. 2 multichannel ChemiDoc Imager
Wherein, HFB4s of the CK for addition without fluorescence labeling is compareed；HFB4::GFPuv is addition HFB4::GFPuv fluorescence The processing of albumen；mRFP::HFB8 and HFB8::MRFP is respectively addition mRFP::HFB8 or HFB8::The place of mRFP fluorescins Reason
Fig. 3 external sources addition HFB albumen remarkably promotes Trichoderma harzianum and colonizes tomato root table
Wherein, CK is the control without HFB albumen；HFB4 is the processing of addition HFB4 albumen；HFB8 is addition HFB8 The processing of albumen
Fig. 4 external sources addition HFB albumen remarkably promotes Trichoderma harzianum and colonizes cucumber root table
Wherein, CK is the control without HFB albumen；HFB4 is the processing of addition HFB4 albumen；HFB8 is addition HFB8 The processing of albumen
Embodiment
The present invention is expanded on further with reference to specific implementation case.The case study on implementation enumerated is only used for illustrating this hair Bright implementation, is not used in the use scope of the limitation present invention.All unreceipted specific implementation conditions, be according to this area Normal condition known to technical staff is carried out.
1. express the structure of the Yeast engineering bacteria of HFB albumen
1) hfb4 and hfb8 genes are cloned using round pcr respectively from trichoderma SQR-T037 cDNA storehouses and (is free of signal Peptide-coding region)；
The primer for cloning hfb4 genes is as follows：
Sense primer hfb4-F:GGCTGAAGCTGAATTCACTCAGGAGCACCAGTTCGA(SEQ ID NO.5)
Anti-sense primer hfb4-R:GAGTTTTTGTTCTAGAATCTGGGGAAGGGCATCCTG(SEQ ID NO.6)
The primer for cloning hfb8 genes is as follows：
Sense primer hfb8-F:GGCTGAAGCTGAATTCGCTGTCTGCCCTGATGGTG(SEQ ID NO.7)
Anti-sense primer hfb8-R:GAGTTTTTGTTCTAGAATGTGGGTTCCAGCGGGGTT(SEQ ID NO.8).
PCR reaction systems are as follows：
PCR response procedures are as follows：
2) by expression plasmid of yeast pPICZ α A with after EcoR I and Xba I double digestions with clone obtained hfb4 and Hfb8 genes carry out enzyme company respectively, obtain the expression plasmid of yeast pPICZ α A containing hfb4 and hfb8 respectively::HFB4 and pPICZ α A::HFB8, and sequence verification, clone obtained hfb4 gene orders as shown in SEQ ID NO.2, hfb8 gene orders such as SEQ Shown in ID NO.4；
3) by the correct pPICZ α A of sequence verification::HFB4 and pPICZ α A::HFB8 plasmids distinguish line with Sac I single endonuclease digestions Property, then it is electroporated enter competence Pichia pastoris KM71H cells in, acquisition can express HFB4 and HFB8 yeast work respectively Journey bacterium KM71H-HFB4 and KM71H-HFB8；
4) 8 positive transformants are selected at random respectively, the experiment of Yeastern Blot blot hybridizations is carried out, filters out trace Substantially, the high transformant of HFB expression quantity；
5) Yeast engineering bacteria of the high expression quantity filtered out is seeded to after BMG culture mediums and inoculates to BMM culture mediums Row aerobic fermentation, obtains HFB albumen, then carries out SDS-PAGE protein electrophoresises and Western Blot traces checking egg respectively again White correctness (Fig. 1).
2. express HFB4::GFPuv and HFB8::The structure of mRFP Yeast engineering bacteria is followed the trail of with albumen
1) by the pPICZ α A built::HFB4 and pPICZ α A::HFB8 plasmids are linearized respectively with Xba I single endonuclease digestions, Then fluorescin gfpuv and mrfp genetic fragment is integrated into plasmid respectively with Infunsion homologous recombinations enzyme, hfb bases Because with being connected between fluorescence protein gene using soft linker GGGGS × 3, obtaining and containing hfb4 respectively::gfpuv、mrfp:: Hfb8 (N-terminal) and hfb8::Mrfp (C-terminal) expression plasmid of yeast pPICZ α A::HFB4::GFPuv、 pPICZαA::mRFP::HFB8 and pPICZ α A::HFB8::MRFP, and sequence verification；
A) Xba I endonuclease reaction systems and method：Plasmid (200ng μ l-1) 10 μ l, 10x Tango Buffer (Thermo ScientificTM) 5 μ l, Xba I restriction enzymes (10UL-1,Thermo ScientificTM) 2.5 μ l, Add water to 50 μ l.37 DEG C of water-bath digestions 3 hours.
B) clone's (being introduced comprising linker) of fluorescin gfpuv and mrfp genetic fragments：
The reaction system and program of clone ibid, template DNA respectively from purchase commercialization plasmid pGFPuv and MCherry, the primer is as follows：
Clone gfpuv fragments
Sense primer gfpuv-F：As shown in SEQ ID NO.9
Anti-sense primer gfpuv-R：As shown in SEQ ID NO.10
Clone mrfp fragments (being used to merge the N-terminal in HFB8 albumen)：
Sense primer mrfp-F:As shown in SEQ ID NO.11
Anti-sense primer mrfp-R：As shown in SEQ ID NO.12
Clone mrfp fragments (being used to merge the C-terminal in HFB8 albumen)：
Sense primer mrfp-F '：As shown in SEQ ID NO.13
Anti-sense primer mrfp-R '：As shown in SEQ ID NO.14.
C) fluorescin gfpuv and mrfp genetic fragments are integrated into plasmid:
Reaction system is：Linearization plasmid (60ng μ l-1) 1 μ l, Insert Fragment (gfpuv or mrfp, 60ng μ l-1)1 μl
5x Infusion HD Enzyme Premix1 μ l, add water to 5 μ l, after 50 DEG C of water-baths 15 minutes It is placed in 1 minute on ice, terminates reaction, pPICZ α A is obtained respectively::HFB4::GFPuv,pPICZαA::mRFP::HFB8 and pPICZαA::HFB8::MRFP recombinant plasmids.
2) the correct plasmid of sequence verification is linearized respectively with Pme I single endonuclease digestions, then it is electroporated enter competence finish In red yeast KM71H cells, acquisition can express HFB4 respectively::GFPuv、mRFP::HFB8 and HFB8::MRFP fusion proteins Yeast engineering bacteria；
3) 8 positive transformants are selected at random respectively, the experiment of Yeastern Blot blot hybridizations is carried out, filters out trace Substantially, the high transformant of expressing quantity；
4) Yeast engineering bacteria of the high expression quantity filtered out is subjected to aerobic fermentation, obtains HFB4::GFPuv、mRFP:: HFB8 and HFB8::MRFP fusion proteins, then carry out SDS-PAGE protein electrophoresises and the checking of Western Blot traces respectively again The correctness of albumen；
5) by after the fusion protein purification with fluorescence labeling with 0.6mgml-1Amount be added to water planting tomato seedling root system, 10 Tomato seedling is placed in progress multichannel fluoroscopic examination under ChemiDoc Imager after minute, control (CK) is without fluorescence labeling HFB4 processing (Fig. 2).As a result show：HFB albumen can quickly be attached to root system surface.
3.HFB albumen promotion trichoderma colonizes the compliance test result of tomato root table
1) the tomato seedling culture of 15 days seedling ages is added respectively in 1/8Yamazaki nutrient solutions (40ml, pH 6.5) HFB4 and HFB8 protein solutions (final concentration of 0.25 μM), control only addition albumen solvent potassium phosphate solution (CK), then connect respectively Plant Trichoderma harzianum SQR-T037 spore suspensions (final concentration of 105CFU·ml-1), it is placed in 48 hours (light of culture in illumination box According to：Dark=12：12,25 DEG C, 80rpm)；
2) the trichoderma colonization amount of sampling detection Tomato Root System：Tomato Root System is placed in after being scanned in root scanner and cut, Total serum IgE is extracted after liquid nitrogen flash freezer, the trichoderma colonization amount of root table is then quantitatively detected with reverse transcription RT-qPCR, as a result with trichoderma Copy number meter of the tef1 genes on every gram of root, i.e. tef1copiesg-1root。
3) result is shown：External source addition HFB4 albumen (0.25 μM) can improve trichoderma determining in tomato root table in 48 hours The amount of growing 138%, external source addition HFB8 albumen (0.25 μM) can improve colonization amount of the trichoderma in tomato root table in 48 hours 179%, it is seen then that HFB albumen promotes trichoderma quickly to colonize the effect of root table significantly (Fig. 3 and table 1).
The different disposal of table 1 colonizes the influence of tomato root table to Trichoderma harzianum
Note：Between numerical value difference not significantly (p is represented comprising same letter<0.05), similarly hereinafter.
4.HFB albumen promotion trichoderma colonizes the compliance test result of cucumber root table
1) the tomato seedling culture of 15 days seedling ages is added respectively in 1/4Yamazaki nutrient solutions (40ml, pH 6.5) HFB4 and HFB8 protein solutions (final concentration of 1 μM), control only addition albumen solvent potassium phosphate solution (CK), then inoculation is breathed out respectively Thatch trichoderma SQR-T037 spore suspensions (final concentration of 105CFU·ml-1), it is placed in culture (illumination in 48 hours in illumination box： Dark=12：12,25 DEG C, 80rpm)；
2) the trichoderma colonization amount of sampling detection cucumber root：Cucumber root is placed in after being scanned in root scanner and cut, Total serum IgE is extracted after liquid nitrogen flash freezer, the trichoderma colonization amount of root table is then quantitatively detected with reverse transcription RT-qPCR, as a result with trichoderma Copy number meter of the tef1 genes on every gram of root, i.e. tef1copiesg-1root。
3) result is shown：External source addition HFB4 albumen (1 μM) can improve colonization amount of the trichoderma in cucumber root table in 48 hours 114%, external source addition HFB8 albumen (1 μM) can improve trichoderma in the colonization amount 153% of cucumber root table, HFB albumen in 48 hours Trichoderma is promoted quickly to colonize the effect of root table significantly (Fig. 4 and table 2).
The different disposal of table 2 colonizes the influence of cucumber root table to Trichoderma harzianum

Claims (12)

1. a kind of HFB albumen, it is characterised in that the HFB albumen includes at least one of HFB4 albumen and HFB8 albumen, described HFB4 albumen be amino acid sequence as shown in SEQ ID NO.1, described HFB8 albumen is as shown in SEQ ID NO.3 Amino acid sequence.
2. the encoding gene of HFB albumen described in claim 1, it is characterised in that the encoding gene of the HFB4 albumen is such as SEQ Nucleotide sequence shown in ID NO.2；The encoding gene of the HFB8 albumen is the nucleotides sequence as shown in SEQ ID NO.4 Row.
3. the recombinant expression plasmid containing HFB protein coding genes described in claim 2.
4. the transgenic cell line containing HFB protein coding genes described in claim 2.
5. the transgenic engineered bacteria containing HFB protein coding genes described in claim 2.
6. recombinant expression plasmid according to claim 3, it is characterised in that the recombinant expression plasmid is by such as SEQ ID HFB4 protein coding genes shown in NO.2hfb4Or the HFB8 protein coding genes as shown in SEQ ID NO.4hfb8It is inserted into Obtained between expression plasmid of yeast pPICZ α A EcoR I and Xba I restriction enzyme sites.
7. recombinant expression plasmid according to claim 6, it is characterised in that prepared using following steps：With trichoderma harzianum Strain SQR-T037 cDNA separately designs primer for template and enters performing PCR amplification, by obtained pcr amplification product and Yeast expression matter Grain pPICZ α A respectively obtain the yeast table of expression HFB4 albumen and HFB8 albumen after being connected respectively with EcoR I and Xba I digestions Up to plasmid pPICZ α A::HFB4 and pPICZ α A::HFB8；
The primer for cloning hfb4 genes is as follows：
Sense primer hfb4-F: GGCTGAAGCTGAATTCACTCAGGAGCACCAGTTCGA（SEQ ID NO.5）
Anti-sense primer hfb4-R: GAGTTTTTGTTCTAGAATCTGGGGAAGGGCATCCTG（SEQ ID NO.6）
The primer for cloning hfb8 genes is as follows：
Sense primer hfb8-F: GGCTGAAGCTGAATTCGCTGTCTGCCCTGATGGTG（SEQ ID NO.7）
Anti-sense primer hfb8-R: GAGTTTTTGTTCTAGAATGTGGGTTCCAGCGGGGTT（SEQ ID NO.8）.
8. transgenic engineered bacteria according to claim 5, it is characterised in that the transgenic engineered bacteria be by claim 6 or Recombinant expression plasmid described in 7 is transformed into what is obtained in competence Pichia pastoris KM71H cells after being linearized with Sac I single endonuclease digestions The Yeast engineering bacteria of HFB4 albumen and HFB8 albumen can be expressed respectively.
9. application of the HFB albumen in promoting Trichoderma harzianum root table to colonize described in claim 1.
10. application according to claim 9, it is characterised in that be added into for external source after HFB albumen is expressed in yeast In crop-planting system, the colonization amount of quick increase trichoderma harzianum.
11. application according to claim 10, it is characterised in that described crop is tomato or cucumber.
12. application of the HFB albumen in the microbial-bacterial fertilizer based on Trichoderma harzianum is prepared described in claim 1.
CN201610235081.2A 2016-04-15 2016-04-15 A kind of albumen for promoting Trichoderma harzianum root table to colonize and its application Active CN105732781B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610235081.2A CN105732781B (en) 2016-04-15 2016-04-15 A kind of albumen for promoting Trichoderma harzianum root table to colonize and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610235081.2A CN105732781B (en) 2016-04-15 2016-04-15 A kind of albumen for promoting Trichoderma harzianum root table to colonize and its application

Publications (2)

Publication Number Publication Date
CN105732781A CN105732781A (en) 2016-07-06
CN105732781B true CN105732781B (en) 2017-09-12

Family

ID=56254512

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610235081.2A Active CN105732781B (en) 2016-04-15 2016-04-15 A kind of albumen for promoting Trichoderma harzianum root table to colonize and its application

Country Status (1)

Country Link
CN (1) CN105732781B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108586589A (en) * 2018-01-16 2018-09-28 南京农业大学 A kind of preparation method and applications of the Swollenin albumen from Guizhou trichoderma
CN111574601B (en) * 2020-06-02 2022-04-19 中国农业科学院植物保护研究所 Trichoderma hydrophobic protein Thfb6, strain thereof, plant ISR elicitor and elicitation method

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105037513B (en) * 2015-08-27 2019-02-22 上海交通大学 A kind of Trichoderma hydrophobin and its encoding gene, application

Also Published As

Publication number Publication date
CN105732781A (en) 2016-07-06

Similar Documents

Publication Publication Date Title
CN107435047B (en) Low-phosphorus-resistant key gene GmPHR25 in plant phosphorus signal network and application thereof
CN105838619B (en) Two pairs can successfully infect wild rice stem plant and make wild rice smut and its Inoculation Method of its pregnant hay
CN105838615B (en) A kind of wild rice smut haploid strains UET2 and its application
CN105838616B (en) A kind of wild rice smut haploid strains UET1 and its application
CN105830760B (en) A kind of wild rice smut Inoculation Method successfully making the pregnant hay of wild rice stem plant
CN102304540B (en) Expression equipment for expressing exogenous protein by secretion in trichoderma reesei and application of expression equipment
CN110511272A (en) A kind of corn ZmbHLH55 transcription factor and its application
CN110343157A (en) Cotton verticillium wilt related gene GhBONI and its coding albumen and application
CN110079465A (en) It gives a report the aspergillus oryzae transformation system construction method of gene using phleomycin as selection markers/GFP
CN105732781B (en) A kind of albumen for promoting Trichoderma harzianum root table to colonize and its application
CN103397099B (en) Method for detecting quantity of pseudomonas fluorescent in rhizospheric soil during growth period of transgenic wheat by virtue of fluorescent quantitative PCR (Polymerase Chain Reaction)
CN108384797B (en) A kind of no trace trichoderma fungal gene edit methods
CN107574171A (en) A kind of corn salt resistance main effect QTL and its related gene, molecular labeling and application
CN104744577B (en) Beauveria bassiana antibacterial protein Bbafp and its expression vector, genetically modified plants containing its gene preparation method and application
CN107858372A (en) A kind of agriculture bacillus mediated cotton transient transformation methods
CN105504033B (en) Rice cell cycle protein OsCYCP4；1 application and the method for improving rice tolerant to low-phosphorus stress
CN101413006A (en) Drought-induced rice flower specific promoter and use thereof
CN114107327B (en) Trichoderma viride high-temperature stress response key enzyme gene TvHSP70, recombinant expression vector, engineering bacteria and application thereof
CN111996128B (en) Flammulina velutipes suitable for industrial cultivation and molecular identification method thereof
CN107893081A (en) Gene order, expression vector and the production method of a kind of people source keratin cell growth factor 2
CN114480447A (en) Application of kenaf thioredoxin analog protein gene HcTrx and recombinant vector thereof in VIGS silencing system
CN110791503B (en) Low-phosphorus inducible promoter and application thereof
CN104031850B (en) The engineering bacteria of a kind of Cordyceps militaris (L.) Link. Rhf1 gene inactivation and the application of Cordyceps militaris (L.) Link. Rhf1 gene
CN105838618B (en) A kind of wild rice smut haploid strains UEMT2 and its application
CN102660469A (en) Constructing method for pichia genetic engineering strain for expressing plant resistance-inducing factors

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant