CN105695632A - Real-time fluorogenic quantitative PCR primer and detection method for reproductive failure disease DNA viruses of pigs - Google Patents

Real-time fluorogenic quantitative PCR primer and detection method for reproductive failure disease DNA viruses of pigs Download PDF

Info

Publication number
CN105695632A
CN105695632A CN201610175246.1A CN201610175246A CN105695632A CN 105695632 A CN105695632 A CN 105695632A CN 201610175246 A CN201610175246 A CN 201610175246A CN 105695632 A CN105695632 A CN 105695632A
Authority
CN
China
Prior art keywords
pcv2
prv
ppv
real
pcr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610175246.1A
Other languages
Chinese (zh)
Inventor
赵丽
李存法
连瑞丽
李艳玲
卢婷婷
刘永录
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Henan University of Animal Husbandry and Economy
Original Assignee
Henan University of Animal Husbandry and Economy
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henan University of Animal Husbandry and Economy filed Critical Henan University of Animal Husbandry and Economy
Priority to CN201610175246.1A priority Critical patent/CN105695632A/en
Publication of CN105695632A publication Critical patent/CN105695632A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a real-time fluorogenic quantitative PCR primer for reproductive failure disease DNA viruses of pigs. The real-time fluorogenic quantitative PCR primer comprises the following sequences: PCV2-Sense: 5-TGAAGAAGTGGTTGTTA TTG-3; PCV2-Antisense: 5-AAAACCATTACGAAGTGATA-3; PRV-sense: 5-CATGCGACCCTTTCTGCTGC-3; PRV-Antisense: 5-CCCA GACCTCGGCCGAGGGA-3; PPV-Sense: 5-CTGGGGGGTTGGTGT GTCT-3; PPV-Antisense: 5-TCTTGTACCATTTGTCCTTC-3. The invention also provides a method for detecting reproductive failure disease DNA viruses of pigs by utilizing the real-time fluorogenic quantitative PCR primer. The primer and the method provided by the invention are specific, rapid and sensitive, and are capable of detecting DNA viruses such as PCV2, PPV and PRV at the same time.

Description

The real-time fluorescence quantitative PCR primer of pig breeding dysfunction disease DNA viruses and detection method thereof
Technical field
The invention belongs to Molecular Virology field, be specifically related to real-time fluorescence quantitative PCR primer and the detection method thereof of a kind of pig breeding dysfunction disease DNA viruses。
Background technology
China is to raise pigs the first big country in the world, and pig breeding dysfunction disease is always up the common disease on pig farm, causes serious economic loss to pig farm and pig farmer。Owing to this disease cause of disease is complicated; it is generally the mixed infection of many cause of diseases; more difficult control clinically; therapeutic effect is often undesirable; swinery poor growth or stagnation, invalid pig and dead pig is caused to increase, the uniformity reduction that feed efficiency, the speed of growth and swinery are overall, treatment cost increases; have impact on the breeding of swinery and improvement, threaten the development of pig industry especially large scale of pig farm industry。Pig breeding dysfunction disease is mainly the mixed infection of one or more viruses of PRRSV, PCV2, CSFV, PPV, PRV etc., hence sets up detection method fast and effectively and is highly desirable to。
Wherein, PPV, PRV, PCV2 virus is DNA viruses, and current diagnostic method is the real-time fluorescence quantitative PCR that developed recently gets up。Real-time fluorescence quantitative PCR have fluorescent dye and fluorescent probe point, fluorescent probe specificity better but cost increase, and require during conventional fluorescent dye SYBRGreen I gene-amplification that concentration is low and make amplified signal relatively weak, the dyestuff redistribution problem caused by low concentration cannot be solved, and the DNA of low melting point is likely to be due to dyestuff redistribution problem and cannot detect so that it is therefore detection reliability reduces。
Summary of the invention
For the problems referred to above, the present invention provides multiple EvaGreen real-time fluorescence quantitative PCR primer and the detection method thereof of a kind of pig breeding dysfunction disease DNA viruses, and the method is special, quick, sensitive, can detect the DNA viruses such as PCV2, PPV and PRV simultaneously。
For solving problem above, the present invention is achieved through the following technical solutions:
A kind of real-time fluorescence quantitative PCR primer of pig breeding dysfunction disease DNA viruses, including following sequence:
PCV2-Sense:5-TGAAGAAGTGGTTGTTATTG-3,
PCV2-Antisense:5-AAAACCATTACGAAGTGATA-3；
PRV-sense:5-CATGCGACCCTTTCTGCTGC-3,
PRV-Antisense:5-CCCAGACCTCGGCCGAGGGA-3；
PPV-Sense:5-CTGGGGGGTTGGTGTGTCT-3,
PPV-Antisense:5-TCTTGTACCATTTGTCCTTC-3。
The real-time fluorescence quantitative PCR detection method of a kind of pig breeding dysfunction disease DNA viruses, comprises the following steps:
(1) with reference to viral DNA Miniprep Kit description, from PCV2, PPV and the PRV virus liquid infecting PK-15 cell, viral DNA is extracted respectively；
(2) 0.5 μ L gained viral DNA is taken, add 10 × PCRbuffer5 μ L, 2.5mmo1/LdNTP mixture 4 μ L, upstream and downstream primer (50pmol/ μ L) each l μ L, sterilizing distilled water 38 μ L, 5U/ μ LTaqDNA polymerase 0.5 μ L, mix the amplification of laggard performing PCR；Amplification program is: 94 DEG C of denaturation 3min, 94 DEG C of 20s, 54 DEG C of 30s, 72 DEG C of 30s, totally 30 circulations, and 72 DEG C extend 1min；PCR reaction takes 5 μ LPCR product 3% agarose gel (containing 0.5 μ g/mLEB) electrophoresis detection purpose bands after terminating, recovery purpose fragment (PCV2, PRV and PPV purpose band respectively 350,140,190bp)；
(3) the purpose fragment reclaimed is connected with pGEM-TEasy carrier, construction recombination plasmid；By recombinant plasmid transformed E.coliJM109 competent cell, (with plasmid extraction kit) extracts recombiant plasmid, and recombiant plasmid is carried out PCR qualification, it is thus achieved that positive recombiant plasmid；
(4) measure positive recombiant plasmid respectively with ultraviolet spectrophotometer at 260nm and the 280nm absorbance located, and calculate DNA concentration and the purity of recombiant plasmid；Recombiant plasmid is carried out 10 times of gradient dilutions, with 10,102、103、104、105、106、107、108、109Copy/μ L is as standard positive template；
(5) PCV2, PPV, PRV standard positive template is carried out respectively quantitative fluorescent PCR reaction, Criterion curve, such that it is able to the linear relationship curve representation formula drawn between copy number x and Ct value；
(6) extract testing sample genomic DNA, carry out quantitative fluorescent PCR reaction, the Ct value of each for gained purpose fragment is substituted into standard curve, the copy number of each viral DNA in testing sample can be obtained。
The system of described quantitative fluorescent PCR reaction is: each 1 μ L, 10 × PCRbuffer5 μ L, the 25mmo1/LMg of above-mentioned 6 primers2+4 μ L, 2.5mmo1/LdNTP5 μ L, 10 × EvaGreen5 μ L, TaqDNAPolymerase2U, add ddH2O is 50 μ L to reaction system cumulative volume；Response procedures is 95 DEG C of 5min；95 DEG C of 15s, 60 DEG C of 1min, 40 circulations。
The positive beneficial effect of the present invention:
(1) each dilution solution temperature of standard substance DNA is close, does not occur non-specific amplification and obvious primer dimer in course of reaction, thus illustrating that the design of primers of this test is reasonable, specificity is good, and reaction system and reaction condition obtain good optimization。
(2) present invention in the conserved region of comprehensive consideration target viral DNA sequence, whether formed on the basis of the many factors such as secondary structure, G+C content, base random distribution, length, and through necessary modification and substantial amounts of verification experimental verification, final design has also filtered out detection primer and the EvaGreen fluorescent dye system of specificity and high sensitivity, the fluorescence quantitative PCR detection system set up, there is high specificity, highly sensitive, and have good accuracy and repeatability。In 60 parts of clinical samples, it is positive that Standard PCR detects 32 parts of samples, and it is positive that quantitative fluorescent PCR detects 40 parts of samples, many detections 8 parts, recall rate improves 13.3%, it was shown that the real time fluorescence quantifying PCR method of foundation can be used in the early diagnosis of PCV2, PPV and PRV。
(3) the novel fluorescence dyestuff EvaGreen that the present invention adopts is minimum to PCR interference, high concentration can be used and make amplified signal be better than SYBRGreenI, proliferation time shorter than SYBRGreenI, and the fluorescent dye of high concentration can eliminate the defect of " dyestuff redistribution ", having higher sensitivity and stability, therefore EvaGreen is more suitable for multiple real time fluorescence PCR。
Detailed description of the invention
In order to make the purpose of the present invention, technical scheme and advantage clearly understand, below in conjunction with specific embodiment, the present invention is described in more detail。Should be appreciated that specific embodiment described herein is only in order to explain the present invention, is not intended to limit the present invention。
In following example, agents useful for same and material source are as follows:
PGEM-TEasy plasmid vector, T4DNA ligase are all purchased from Promega Products。EXTaqDNA polymerase is precious biological engineering (Dalian) company limited product。Viral DNA Miniprep Kit is V-gene Products；EvaGreen is Biotium Products；PTC200PCR instrument, Bio2Rad real-time fluorescence quantitative PCR instrument。
Pig parvoviral (7909) standard strain, pig gyrate virus II type (PCV2) standard strain, porcine pseudorabies virus (PRV) standard strain, porcine reproductive respiratory syndrome virus (PRRSV), swine fever virus (CSFV) and PK-15 cell strain are all purchased from China Veterinary Drugs Supervisory Inst.。Engineering bacteria JM109 competent cell is precious biological engineering (Dalian) company limited product。
Embodiment 1
The multiple real time fluorescence quantifying PCR detection method of a kind of PCV2, PRV, PPV virus, comprises the following steps:
First, according to the high conservative region sequence of PCV2, PRV, PPV viral DNA, take into account between primer compatible, design 3 to special primer, design expanding fragment length respectively 350,140,190bp:
PCV2-Sense:5-TGAAGAAGTGGTTGTTATTG-3,
PCV2-Antisense:5-AAAACCATTACGAAGTGATA-3；
PRV-sense:5-CATGCGACCCTTTCTGCTGC-3,
PRV-Antisense:5-CCCAGACCTCGGCCGAGGGA-3；
PPV-Sense:5-CTGGGGGGTTGGTGTGTCT-3,
PPV-Antisense:5-TCTTGTACCATTTGTCCTTC-3；
(1) with reference to viral DNA Miniprep Kit description, from PCV2, PPV and the PRV virus liquid infecting PK-15 cell, viral DNA is extracted respectively；
(2) 0.5 μ L gained viral DNA is taken respectively, add 10 × PCRbuffer5 μ L, 2.5mmo1/LdNTP mixture 4 μ L, upstream and downstream primer (50pmol/ μ L) each l μ L, sterilizing distilled water 38 μ L, 5U/ μ LTaqDNA polymerase 0.5 μ L, carry out regular-PCR amplification after mixing；Amplification program is: 94 DEG C of denaturation 3min, 94 DEG C of 20s, 54 DEG C of 30s, 72 DEG C of 30s, totally 30 circulations, and 72 DEG C extend 1min；PCR reaction takes 5 μ LPCR product 3% agarose gel (containing 0.5 μ g/mLEB) electrophoresis detection purpose bands after terminating, recovery purpose fragment (PCV2, PRV and PPV purpose band respectively 350,140,190bp)；
(3) the purpose fragment reclaimed is connected with pGEM-TEasy carrier, construction recombination plasmid；By recombinant plasmid transformed E.coliJM109 competent cell, (with plasmid extraction kit) extracts recombiant plasmid, and recombiant plasmid is carried out PCR qualification, it is thus achieved that positive recombiant plasmid；
(4) measure positive recombiant plasmid respectively with ultraviolet spectrophotometer at 260nm and the 280nm absorbance located, and calculate DNA concentration and the purity of recombiant plasmid；Recombiant plasmid is carried out 10 times of gradient dilutions, with 10,102、103、104、105、106、107、108、109Copy/μ L is as standard positive template, real-time fluorescence PCR reaction is carried out for template respectively with the positive recombiant plasmid of PCV2, PPV, PRV, through melting curve analysis after having expanded, amplified production all can form specific lysis peak value, wherein PCV2 dissolves peak value is 77 DEG C, it is 79.1 DEG C that PPV dissolves peak value, and it is 89.1 DEG C that PRV dissolves peak value；
(5) PCV2, PPV, PRV standard positive template is carried out respectively quantitative fluorescent PCR reaction, Criterion curve, such that it is able to the linear relationship curve representation formula drawn between copy number x and Ct value；
Reaction system is: each 1 μ L(of upstream and downstream primer is about 100ng), 10 × PCRbuffer5 μ L, 25mmo1/LMg2+4 μ L, 2.5mmo1/LdNTP5 μ L, 10 × EvaGreen5 μ L, TaqDNAPolymerase2U, add ddH2O is 50 μ L to reaction system cumulative volume, and response procedures is 95 DEG C of 5min；95 DEG C of 15s, 60 DEG C of 1min, 40 circulations, there is good linear relationship between system auto Analysis display Ct value and the logarithm of standard positive template concentration。
The correlation coefficient (R2) of the standard curve of PCV2 is 0.9999, and slope is-2.79, and intercept is 36.89, such that it is able to the linear relationship curve representation formula drawn between copy number x and Ct value: Ct=-2.79 × lgx+36.89；The correlation coefficient (R2) of the standard curve of PPV is 0.9999, and slope is-2.83, and intercept is 31.89, such that it is able to the linear relationship curve representation formula drawn between copy number x and Ct value: Ct=-2.83 × lgx+31.89；The correlation coefficient (R2) of the standard curve of PRV is 0.9997, and slope is-3.01, and intercept is 38.24, such that it is able to the linear relationship curve representation formula drawn between copy number x and Ct value: Ct=-3.01 × lgx+38.24。
Wherein, PCV2 standard concentration is 106Having good linear relation in～50copies/ μ L, amplification efficiency is 0.964(R2 > 0.99)；PPV standard concentration is 106Having good linear relation in～50copies/ μ L, amplification efficiency is 0.986(R2 > 0.99)；PRV standard concentration is 106Having good linear relation in～50copies/ μ L, amplification efficiency is 0.982(R2 > 0.99)；
It is simultaneously introduced 3 kinds of viral template in a PCR pipe and carries out EvaGreen multiple real time fluorescence PCR, 3 obvious peaks are obtained after amplification, melting, and repeated test, finally stablize the Tm value of 3 kinds of virus amplification products, wherein the Tm value of PCV2 is 77.4 ± 0.25 ° of C, PPV is 79.6 ± 0.31 ° of C, PRV is 89.4 ± 0.28 ° of C。
(6) extract testing sample genomic DNA, carry out quantitative fluorescent PCR reaction, the Ct value of each for gained purpose fragment is substituted into standard curve, the copy number of each viral DNA in testing sample can be obtained。
Susceptiveness is tested:
PCV2 is sensitivity determination and corresponding amplification curve under EvaGreen multiple real time fluorescence PCR system, and PCV2 is in concentration 10 in display6When～100copies/ μ L is template, melting curve all produces obvious purpose peak, and 50copies/ μ LddH2O does not produce purpose peak when being template, it was shown that the sensitivity of PCV2 recombiant plasmid is up to 100copies/ μ L。PPV is sensitivity determination and corresponding amplification curve under EvaGreen multiple real time fluorescence PCR system, and PPV is in concentration 10 in display6When～200copies/ μ L is template, melting curve all produces obvious purpose peak, and 150copies/ μ L and ddH2O does not produce purpose peak when being template, it was shown that the sensitivity of PPV recombiant plasmid is up to 200copies/ μ L。PRV is sensitivity determination and corresponding amplification curve under EvaGreen multiple real time fluorescence PCR system, and PRV is in concentration 10 in display6When～250copies/ μ L is template, melting curve all produces obvious purpose peak, and 200copies/ μ L and ddH2O does not produce purpose peak when being template, it was shown that the sensitivity of PRV recombiant plasmid is up to 250copies/ μ L。
Specific test:
PCV2, PPV, PRRSV, CSFV, JEV, PRV and ddH is added under multiple reaction system2O is template, has special purpose peak to produce at corresponding purpose fragment Tm value place PCV2, PPV and PRV, and PRRSV, CSFV, JEV and ddH2The matched group of O does not have purpose peak to produce, it was shown that the EvaGreen multiple real time fluorescence PCR reaction system specificity of structure is better。
Stablize and replica test:
By every kind of virus melting curve Tm value after multiple EvaGreen real-time fluorescence PCR is carried out statistical analysis, 3 repeatability in the fragment Tm value of each virales batch, the wherein corresponding Tm value coefficient of variation respectively 0.192%, 0.26% and 0.23% of PCV2, PPV and PRV；Replica test between 3 times batches, PCV2, PPV and PRV the corresponding Tm value coefficient of variation respectively 0.27%, 0.36% and 0.32%, in batch, interassay coefficient of variation is respectively less than 5%, shows that EvaGreen multiple real time fluorescence PCR system stability is better。
By three kinds of viruses respectively in EvaGreen substance real-time fluorescence PCR (105、104And 103Copies/ μ L) 3 concentration C t value repeatability detections。Wherein PCV2 repeats the coefficient of variation (Coefficientofvariation, CV) respectively 1.20%, 2.12% and 2.36% between criticizing, CV respectively 1.01%, 1.92% and 1.35% in repeating in crowd；PPV repeat between criticizing in CV respectively 0.98%, 1.97% and 2.03%, CV respectively 0.67%, 1.71% and 1.76% in repeating in crowd；PRV repeat between criticizing in CV respectively 0.95%, 1.99% and 1.36%, CV respectively 0.71%, 1.32% and 1.61% in repeating in crowd。3 Concentraton gradient of the three boar viruses coefficient of variation in two kinds of repeated trials is respectively less than 5%, it was shown that repeatability is good。Three boar viruses are 104During copies/ μ L standard substance, EvaGreen substance fluorescent PCR criticizes interior 3 replica test melting curves all near respective solution temperature, is shown under same concentration melting curve and has repeatability in better batch。
Clinical sample detects
Each for detection sample gene group DNA 1 μ L(is about 100ng) add in EvaGreen multiple real time fluorescence PCR reaction system, all the other consist of: 10 × PCRbuffer5 μ L, 25mmo1/LMg2+4 μ L, 2.5mmo1/LdNTP5 μ L, 10 × EvaGreen5 μ L, TaqDNAPolymerase2U, add ddH2O is 50 μ L to reaction system cumulative volume。Reaction condition is: 95 DEG C of 5min；95 DEG C of 15s, 60 DEG C of 1min, 40 circulations: melting curve program is 95 DEG C of 15s, 60 DEG C of 1min, 95 DEG C of 15s；Start to collect fluorescence signal from 60 DEG C。Corresponding amplified production Tm value can be obtained by making melting curve。
SEQUENCELISTING
<110>Henan animal husbandry institute of economics
<120>the real-time fluorescence quantitative PCR primer of pig breeding dysfunction disease DNA viruses and detection method thereof
<130>/
<160>6
<170>PatentInversion3.5
<210>1
<211>20
<212>DNA
<213>artificial sequence
<400>1
tgaagaagtggttgttattg20
<210>2
<211>20
<212>DNA
<213>artificial sequence
<400>2
aaaaccattacgaagtgata20
<210>3
<211>20
<212>DNA
<213>artificial sequence
<400>3
catgcgaccctttctgctgc20
<210>4
<211>20
<212>DNA
<213>artificial sequence
<400>4
cccagacctcggccgaggga20
<210>5
<211>19
<212>DNA
<213>artificial sequence
<400>5
ctggggggttggtgtgtct19
<210>6
<211>20
<212>DNA
<213>artificial sequence
<400>6
tcttgtaccatttgtccttc20

Claims (5)

1. a real-time fluorescence quantitative PCR primer for pig breeding dysfunction disease DNA viruses, including following sequence:
PCV2-Sense:5-TGAAGAAGTGGTTGTTATTG-3,
PCV2-Antisense:5-AAAACCATTACGAAGTGATA-3；
PRV-sense:5-CATGCGACCCTTTCTGCTGC-3,
PRV-Antisense:5-CCCAGACCTCGGCCGAGGGA-3；
PPV-Sense:5-CTGGGGGGTTGGTGTGTCT-3,
PPV-Antisense:5-TCTTGTACCATTTGTCCTTC-3。
2. a real-time fluorescence quantitative PCR detection method for pig breeding dysfunction disease DNA viruses, comprises the following steps:
(1) with reference to viral DNA Miniprep Kit description, from PCV2, PPV and the PRV virus liquid infecting PK-15 cell, viral DNA is extracted respectively；
(2) 0.5 μ L gained viral DNA is taken, add 10 × PCRbuffer5 μ L, the dNTP mixture 4 μ L of 2.5mmo1/L, each l μ L of upstream and downstream primer of 50pmol/ μ L, sterilizing distilled water 38 μ L, 5U/ μ L Taq DNA polymerase 0.5 μ L, mix laggard performing PCR amplification；Amplification program is: 94 DEG C of denaturation 3min, 94 DEG C of 20s, 54 DEG C of 30s, 72 DEG C of 30s, totally 30 circulations, and 72 DEG C extend 1min；PCR reaction takes 5 μ LPCR products, 3% agarose gel electrophoresis testing goal band after terminating, recovery purpose fragment, PCV2, PRV and PPV purpose band respectively 350,140,190bp；
(3) the purpose fragment reclaimed is connected with pGEM-TEasy carrier, construction recombination plasmid；By recombinant plasmid transformed E.coliJM109 competent cell, extract recombiant plasmid, recombiant plasmid is carried out PCR qualification, it is thus achieved that positive recombiant plasmid；
(4) measure positive recombiant plasmid respectively with ultraviolet spectrophotometer at 260nm and the 280nm absorbance located, and calculate DNA concentration and the purity of recombiant plasmid；Recombiant plasmid is carried out 10 times of gradient dilutions, with 10,102、103、104、105、106、107、108、109Copy/μ L is as standard positive template；
(5) PCV2, PPV, PRV standard positive template is carried out respectively quantitative fluorescent PCR reaction, Criterion curve, such that it is able to the linear relationship curve representation formula drawn between copy number x and Ct value；
(6) extract testing sample genomic DNA, carry out quantitative fluorescent PCR reaction, the Ct value of each for gained purpose fragment is substituted into standard curve, the copy number of each viral DNA in testing sample can be obtained。
3. real-time fluorescence quantitative PCR detection method according to claim 2, it is characterised in that: described agarose gel contains 0.5 μ g/mLEB。
4. real-time fluorescence quantitative PCR detection method according to claim 2, it is characterised in that: the reaction system of described quantitative fluorescent PCR is: each 1 μ L, 10 × PCRbuffer5 μ L, the 25mmo1/LMg of primer described in claim 12+4 μ L, 2.5mmo1/LdNTP5 μ L, 10 × EvaGreen5 μ L, TaqDNAPolymerase2U, add ddH2O is 50 μ L to reaction system cumulative volume。
5. real-time fluorescence quantitative PCR detection method according to claim 2, it is characterised in that: the response procedures of described quantitative fluorescent PCR is 95 DEG C of 5min；95 DEG C of 15s, 60 DEG C of 1min, 40 circulations。
CN201610175246.1A 2016-03-25 2016-03-25 Real-time fluorogenic quantitative PCR primer and detection method for reproductive failure disease DNA viruses of pigs Pending CN105695632A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610175246.1A CN105695632A (en) 2016-03-25 2016-03-25 Real-time fluorogenic quantitative PCR primer and detection method for reproductive failure disease DNA viruses of pigs

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610175246.1A CN105695632A (en) 2016-03-25 2016-03-25 Real-time fluorogenic quantitative PCR primer and detection method for reproductive failure disease DNA viruses of pigs

Publications (1)

Publication Number Publication Date
CN105695632A true CN105695632A (en) 2016-06-22

Family

ID=56231785

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610175246.1A Pending CN105695632A (en) 2016-03-25 2016-03-25 Real-time fluorogenic quantitative PCR primer and detection method for reproductive failure disease DNA viruses of pigs

Country Status (1)

Country Link
CN (1) CN105695632A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108753936A (en) * 2018-06-21 2018-11-06 河南牧业经济学院 A kind of synchronous detection five kinds of breeding difficulty venereal disease viral disease multiplex PCR systems of pig and detection method

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101260442A (en) * 2007-03-09 2008-09-10 中国农业科学院哈尔滨兽医研究所 Multiple real time fluorescence quantifying PCR method for detecting porcine circovirus, porcine parvovirus, porcine pseudorabies virus and classical swine fever virus
CN104561368A (en) * 2014-09-30 2015-04-29 浙江理工大学 Multiple real-time fluorescent quantative PCR rapid diagnosis kit for six porcine viruses

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101260442A (en) * 2007-03-09 2008-09-10 中国农业科学院哈尔滨兽医研究所 Multiple real time fluorescence quantifying PCR method for detecting porcine circovirus, porcine parvovirus, porcine pseudorabies virus and classical swine fever virus
CN104561368A (en) * 2014-09-30 2015-04-29 浙江理工大学 Multiple real-time fluorescent quantative PCR rapid diagnosis kit for six porcine viruses

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
PINBIN RAO等: "Development of an EvaGreen-based multiplex real-time PCR assay with melting curve analysis for simultaneous detection anddifferentiation of six viral pathogens of porcine reproductive andrespiratory disorder", 《JOURNAL OF VIROLOGICAL METHODS》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108753936A (en) * 2018-06-21 2018-11-06 河南牧业经济学院 A kind of synchronous detection five kinds of breeding difficulty venereal disease viral disease multiplex PCR systems of pig and detection method

Similar Documents

Publication Publication Date Title
CN106947838B (en) African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method
CN103320537B (en) Method for detecting PEDV (porcine epidemic diarrhea virus) and TGEV (transmissible gastroenteritis virus) by double RT-PCR (reverse transcription-polymerase chain reaction), and oligonucleotide primer pair
CN107190104B (en) Five-porcine diarrhea virus multiplex real-time fluorescent quantitative PCR rapid diagnosis kit and application
CN104263858B (en) The bifluorescence quantitative RT-PCR detecting kit of chicken Mycoplasma synoviae and Avianreovirus and primer sets thereof
CN104894118A (en) Primer, probe and kit for detecting bovine viral diarrhea virus
CN104745731A (en) Triple fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for African swine fever viruses, swine fever viruses and respiratory syndrome viruses and preparation method and application thereof
CN105925728A (en) Seneca valley virus real-time fluorescence quantification PCR detection primer and kit
CN103160615B (en) Multiple PCR primer used for simultaneously detecting infectious Bovine Rhinotracheitis virus and akabane virus as well as its design method
CN108060269A (en) DPO primer sets and its application for the detection of Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus
CN105018646A (en) Primer, probe and kit for detecting bovine ephemeral fever virus
CN107488749A (en) A kind of LAMP primer and detection method for detecting the type of pig circular ring virus 3
CN108624720A (en) The primed probe group and kit of RAA Fluorometric assay Rift Valley fever virus
CN103725794B (en) Detect fluorescent quantitation RT PCR primers, probe and its method for PRRSV
CN106435033A (en) Dual real-time fluorescence RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting and identifying wild strain and vaccine strain of CSFV (classical swine fever virus) in swine umbilical cord blood and application of dual real-time fluorescence RT-PCR kit
CN106435031A (en) PCR detection kit for specific detection of fowl adenovirus group I and detection method thereof
Li et al. Rapid detection of porcine deltacoronavirus and porcine epidemic diarrhea virus using the duplex recombinase polymerase amplification method
CN105112558B (en) The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I
CN104388594A (en) Taqman Real-time PCR kit for detecting porcine pseudorabies virus
CN104774953A (en) Fluorescent PCR (polymerase chain reaction) detection reagent for African swine fever virus (ASFV) CP530R gene, and preparation method and application thereof
CN107699635A (en) Porcine epidemic diarrhea virus fluorescence RPA detection methods
CN109652597A (en) It is a kind of for detect dog, cat, ermine parvovirus general RPA primer, RPA probe, kit and nucleic acid detection method
CN103993089B (en) A kind of multiple fluorescence quantitative PCR detection kit and detection method thereof of vancomycin-resistant enterococcus
CN108060272A (en) A kind of quick differentiation pig Delta coronavirus and the multiple PCR detection primer group and kit of pig ridge virus
CN108531647A (en) A kind of zika virus one-step method fluorescence rt-PCR detection methods and kit
CN105695632A (en) Real-time fluorogenic quantitative PCR primer and detection method for reproductive failure disease DNA viruses of pigs

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination