CN105695598A - Molecular beacon probe, kit and method for detecting methicillin-resistant staphylococcus aureus - Google Patents
Molecular beacon probe, kit and method for detecting methicillin-resistant staphylococcus aureus Download PDFInfo
- Publication number
- CN105695598A CN105695598A CN201610177012.0A CN201610177012A CN105695598A CN 105695598 A CN105695598 A CN 105695598A CN 201610177012 A CN201610177012 A CN 201610177012A CN 105695598 A CN105695598 A CN 105695598A
- Authority
- CN
- China
- Prior art keywords
- staphylococcus aureus
- methicillin
- resistant staphylococcus
- beacon
- molecular beacon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6841—In situ hybridisation
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a molecular beacon probe, a kit and a method for detecting methicillin-resistant staphylococcus aureus and belongs to the field of molecular biology. The molecular beacon probe contains three types of probes, namely Beacon MRSA1, Beacon MRSA2 and Beacon MRSA3, wherein the base sequence of the Beacon MRSA1 is as shown in SEQ ID NO:1, the base sequence of the Beacon MRSA2 is as shown in SEQ ID NO:2, and the base sequence of the Beacon MRSA3 is as shown in SEQ ID NO:3; the 5'ends of the Beacon MRSA1, the Beacon MRSA2 and the Beacon MRSA3 are labeled with fluorescence groups, and the 3'ends of the Beacon MRSA1, the Beacon MRSA2 and the Beacon MRSA3 are labeled with quenching groups. The kit provided by the invention contains the molecular beacon probe. The molecular beacon probe contains three probes which act jointly, so that the detected fluorescence signal strength is improved, the specificity is high, and the molecular beacon probe is capable of sensitively, effectively and rapidly detecting the methicillin-resistant staphylococcus aureus. In addition, the invention also establishes a reaction system and a detection method for detecting MRSA.
Description
Technical field
The present invention relates to a kind of for the molecular beacon probe of methicillin-resistant staphylococcus aureus detection, test kit and method, belong to biology field。
Background technology
Staphylococcus aureus (Staphalococcusaureus) belongs to gram positive coccus, micrococcaceae, staphylococcus。It can cause suppurative inflammation, when antibacterial invades blood, can cause pathogenic septicemia。
After since the forties in last century, penicillin comes out, the infectious disease that staphylococcus aureus causes is subject to bigger control, but widely using along with penicillin, some staphylococcus aureus produces penicillinase, beta-lactam nucleus can be hydrolyzed, show as the drug resistance to penicillin。A kind of new semisynthetic penicillin resistant to penicillinase, i.e. methicillin (methicillin) is worked out for this scientist。Nineteen fifty-nine be applied to clinic after once efficiently controlled staphylococcus aureus produce enzyme strain infection, but 1961 subsequently have found that methicillin-resistant staphylococcus aureus (MRSA), MRSA infects so far from discovery and almost extends over the entire globe, it has also become with one of important pathogen of Nosocomial Infections in institute。
After Britain in 1961 finds MRSA, in succession report the nosocomial infection caused by MRSA in American-European and some countries of Asia。From the sixties later stage to the eighties, MRSA infection rate is greatly increased。U.S. NNIS reports that 182 hospital MRSA in 1975 account for the 2.4% of infection of staphylococcus aureus sum, within 1991, rise to 24.8%, wherein especially with teaching hospitals more than 500 beds and central hospital for many, because the chance that in these hospitals, MRSA infects is more, Resistant strain both can be brought into hospital by infected patient, it is possible to because abuse of antibiotics produces in hospital。The MRSA of Europe 1417 hospital ICU separation in 1993 reaches 60%。And the separation rate of Japan Affiliated Hospital of Kansai medical university MRSA reaches 41% in 1993。Domestic finding there is MRSA in the seventies, the recall rate of MRSA rose year by year in recent years, and Shanghai 1978 MRSA in 200 strain staphylococcus aureuses only accounts for 5%, within 1988, rises to 24%, within 1996, increased sharply to 72%。MRSA infection is multiple is born in immunodeficiency person, large-area burns, patient after major operation, long-term inpatients and gerontal patient, and MRSA very easily causes the popular of infection and breaks out。For effectively controlling the infection of MRSA, and reducing the harm that disease causes, set up accurately, quick detection method is top priority。
Method conventional for detection MRSA clinically at present has bacterial cultivation and PCR method。Wherein bacterial cultivation is the goldstandard of detection MRSA, but the method needs to carry out drug sensitive experiment, it usually needs within 3-5 days, just can see final testing result, and testing cost is high, the detection cycle is long；Utilize PCR method that specific nucleotide sequence copy number geometrical progression can be made at short notice to increase, there are significantly high sensitivity and specificity, but it is high that shortcoming is false positive rate, on the other hand, blood samples of patients has the composition often containing suppression PCR reaction, this can cause again false-negative appearance, and the shortcoming of these two aspects limits the clinical practice of PCR detection。At present, existing fluorescence in situ hybridization (FISH) detects the report of MRSA, but what all adopt is linear probe; the shortcoming of the method is; after having hybridized, it is necessary to remove the probe do not hybridized by strict wash conditions, and often because probe cleans not exclusively causes false positive。As can be seen here, the clinical diagnosis that MRSA infects, it is badly in need of more succinct, sensitive detection method。
Summary of the invention
It is an object of the invention to overcome above-mentioned the deficiencies in the prior art part and provide that a kind of fluorescence signal intensity is high, specificity is good, can effectively, quickly detect the molecular beacon probe of methicillin-resistant staphylococcus aureus。
Meanwhile, present invention also offers a kind of test kit for methicillin-resistant staphylococcus aureus detection and method。
For achieving the above object, the technical scheme that the present invention takes is: a kind of molecular beacon probe for methicillin-resistant staphylococcus aureus detection, it comprises three kinds of probes of BeaconMRSA1, BeaconMRSA2 and BeaconMRSA3；The base sequence of described BeaconMRSA1 is such as shown in SEQIDNO:1, and the base sequence of described BeaconMRSA2 is such as shown in SEQIDNO:2, and the base sequence of described BeaconMRSA3 is such as shown in SEQIDNO:3；Described BeaconMRSA1, BeaconMRSA2 and BeaconMRSA3 5 ' ends be all marked with fluorophor, BeaconMRSA1, BeaconMRSA2 and BeaconMRSA3 3 ' ends be all marked with quencher。
Present inventor is by contrasting the gene order of a large amount of MRSA (methicillin-resistant staphylococcus aureus) and MSSA (the non-resistant Staphylococcus aureus in methicillin) bacterial strain, pick out the distinctive gene mecA of MRSA as detection target spot, and for this target spot, on this section of target sequence according to thermodynamic characteristics and higher structure, design, three probes (BeaconMRSA1, BeaconMRSA2 and BeaconMRSA3) of synthesis。These three probe synergy, improve the fluorescence signal intensity of detection, and specificity is high, it is possible to sensitive, detect methicillin-resistant staphylococcus aureus effectively and quickly。
In the molecular beacon probe of the present invention, the stem sequence that each probe 5 ' is held is: 5 '-TTCCA-3 ', the stem sequence that 3 ' hold is: 5 '-TGGAA-3 ', the stem sequence that each probe 5 ' is held and 3 ' the stem complementary held, make probe can form neck ring structure, and higher structure will not be formed with probe itself。But stem sequence is not limited to sequence of the present invention, those skilled in the art can select, according to prior art, the stem sequence that other are suitable。
The molecular beacon probe of the present invention is extensive for the sampling range detected, including blood, body fluid, pus, urine, tissue slice, food sample and the sample from soil, air and water, and their culture etc.。These samples, after respective handling, as long as maintenance cellular morphology is complete and target nucleic acid is not destroyed, all can use the molecular beacon probe of the present invention to detect。
As the preferred implementation of molecular beacon probe for methicillin-resistant staphylococcus aureus detection of the present invention, described fluorophor is CY3, and quencher is BHQ1 or described fluorophor is FAM, and quencher is TANRA。5 ' end CY3 labellings of probe of the present invention, when 3 ' ends are with BHQ1 labelling, the excitation wavelength of fluorophor is 552nm, and detection wavelength is 570nm。Certainly, 5 ' ends of molecular beacon probe of the present invention can also with other fluorophor labellings, for instance FITC etc., its 3 ' end also other quencher labellings optional, such as BDH or TANRA etc., fluorophor or fluorescent quenching group can be added according to prior art。
It addition, present invention also offers the test kit for methicillin-resistant staphylococcus aureus detection containing above-mentioned molecular beacon probe。
As the preferred implementation of the test kit for methicillin-resistant staphylococcus aureus detection of the present invention, described test kit also includes hybridization solution and cleaning mixture。
As the preferred implementation of the test kit for methicillin-resistant staphylococcus aureus detection of the present invention, described hybridization solution contains dextran sulfate, NaCl, deionized formamide, Na2EDTA, TritonX-100 and Tris-HCl buffer solution；Described cleaning mixture contains Tris, NaCl, TritonX-100 and sodium lauryl sulphate, and the pH value of cleaning mixture is 6～10。As the more preferably embodiment of the test kit for methicillin-resistant staphylococcus aureus detection of the present invention, the concentration of described deionized formamide is 10～40% (v/v)。Further, described hybridization solution contains following components: 1～10% (w/v) dextran sulfate, 100～1000mmol/LNaCl, 10～40% (v/v) deionized formamide, 5mmol/LNa2EDTA, 0.01～1% (v/v) TritonX-100 and 5～200mMTris-HCl buffer solution, the pH value of Tris-HCl buffer solution is 7.5；Described cleaning mixture contains following components: 5～50mmol/LTris, 10～100mmol/LNaCl, 0.01～0.2% (v/v) TritonX-100 and 0.01～0.2% (v/v) sodium lauryl sulphate。
As the preferred implementation of test kit for methicillin-resistant staphylococcus aureus detection of the present invention, in described molecular beacon probe, BeaconMRSA1, BeaconMRSA2 and BeaconMRSA3 concentration be 10ng/ μ L。
Finally, present invention also offers the method adopting mentioned reagent box detection methicillin-resistant staphylococcus aureus, it comprises the following steps:
(1) pipette samples drops on slide, dries, makes the bacteria adhension in sample on slide；
(2) slide is immersed in dehydrated alcohol, soak；
(3) on sample, add hybridization solution and molecular beacon probe, be placed on fluorescence in situ hybridization instrument and hybridize；
(4) wash with cleaning mixture；
(5) drip mountant after drying, with fluorescence microscopy, sweep with object lens and counting, and observe ne ar。
The method of above-mentioned detection methicillin-resistant staphylococcus aureus is fluorescence in situ hybridization (FlourescenceinsituHybridization, FISH) method, the method is the probe that a kind of application is marked with fluorophor, by the method that the method hybridized detects cell or tissue internal specific DNA or RNA；Molecular beacon probe is the probe that one has uniqueness " hair clip " space structure, not with target sequence in conjunction with time, molecular beacon is " hair clip " structure, there are a ring sequence (loop) and a stem sequence (stem), its medium ring sequence is the base sequence complementary with target site, and stem sequence is the complementary series unrelated with target site；Fluorophor and fluorescent quenching group it is marked with respectively at the two ends of probe, when probe is in hairpin structure, fluorophor and quencher are adjacent, produce resonance energy transfer effect so that fluorophor is quenched, fluorescence signal can not be produced, and when probe and target site in conjunction with time, hairpin structure is opened, and fluorophor and quencher are separately, produce fluorescence signal, this fluorescence signal can be detected by fluorescence microscope。
As the preferred implementation of the method for detection methicillin-resistant staphylococcus aureus of the present invention, in described step (3), the temperature being placed on fluorescence in situ hybridization instrument to carry out hybridizing is 42～58 DEG C。
The invention have the benefit that the present invention using distinctive for MRSA (methicillin-resistant staphylococcus aureus) gene mecA as detection target spot, for this shot design, synthetic molecules beacon probe。The molecular beacon probe of the present invention comprises three probes, these three probe synergy, improves the fluorescence signal intensity of detection, and specificity is high, it is possible to sensitive, detect methicillin-resistant staphylococcus aureus effectively and quickly。
The present invention has also set up reaction system and the detection method of detection MRSA, overcomes the problems of MRSA Present clinical detection, provides new detection method for MRSA diagnosis, prevention and the control infected。
Detailed description of the invention
For the object, technical solutions and advantages of the present invention are better described, below in conjunction with specific embodiment, the invention will be further described。
Embodiment 1: molecular beacon probe
For the molecular beacon probe of methicillin-resistant staphylococcus aureus detection described in the present embodiment, it comprises three kinds of probes of BeaconMRSA1, BeaconMRSA2 and BeaconMRSA3；The base sequence of described BeaconMRSA1 is: 5 '-CY3-TTCCACCAATACAGGAACAGCATATTGGAA-BHQ1-3 '；The base sequence of described BeaconMRSA2 is:
5 '-CY3-TTCCATAATTCACCTGTTTGAGGGTTGGAA-BHQ1-3 '；The base sequence of described BeaconMRSA3 is: 5 '-CY3-TTCCAGTAACCACCCCAAGATTTATTGGAA-BHQ1-3 '。
Above-mentioned BeaconMRSA1, BeaconMRSA2 and BeaconMRSA3 5 ' end be all marked with fluorophor CY3, BeaconMRSA1, BeaconMRSA2 and BeaconMRSA3 3 ' end be all marked with quencher BHQ1, the excitation wavelength of fluorophor is 552nm, and detection wavelength is 570nm。
Embodiment 2: test kit
For the test kit of methicillin-resistant staphylococcus aureus detection described in the present embodiment, it comprises molecular beacon probe, hybridization solution and cleaning mixture described in embodiment 1；
Wherein, BeaconMRSA1, BeaconMRSA2 and BeaconMRSA3 concentration be 10ng/ μ L；Described hybridization solution contains following components: 1～10% (w/v) dextran sulfate, 100～1000mmol/LNaCl, 10～40% (v/v) deionized formamide, 5mmol/LNa2EDTA, 0.01～1% (v/v) TritonX-100 and 5～200mMTris-HCl buffer solution, the pH value of Tris-HCl buffer solution is 7.5；Described cleaning mixture contains following components: 5～50mmol/LTris, 10～100mmol/LNaCl, 0.01～0.2% (v/v) TritonX-100 and 0.01～0.2% (v/v) sodium lauryl sulphate。
Embodiment 3: fluorescence in situ hybridization (FISH) method detection methicillin-resistant staphylococcus aureus
The present embodiment utilizes the test kit described in embodiment 2, adopts fluorescence in situ hybridization detection methicillin-resistant staphylococcus aureus, specifically comprising the following steps that of detection
(1) drawing 10 μ L sample and drop on slide, 50 DEG C of temperatures above are dried, and make in sample bacteria adhension on slide；
(2) slide is immersed in dehydrated alcohol, soak 5 minutes；
(3) on sample, add 20 μ L hybridization solutions and molecular beacon probe BeaconMRSA1, BeaconMRSA2, BeaconMRSA3 each 1 μ L (concentration and probe concentration is 10ng/ μ L), be placed in fluorescence in situ hybridization instrument and hybridize 10 minutes in 42～58 DEG C；
(4) wash 1 minute in 42-58 DEG C with cleaning mixture；
(5) drip mountant after drying, with fluorescence microscopy, with the pan of 20 × object lens and counting, observe ne ar with 40 or 100 × object lens。
Under fluorescence microscope, methicillin-resistant staphylococcus aureus (MRSA) sends out red fluorescence。
Above-mentioned detection method, the decision method of its result is:
MRSA feminine gender (-): 50 different visuals field of Continuous Observation, do not find methicillin-resistant staphylococcus aureus。
MRSA positive (report bacterial population): the visual field, 1-9 bar/50。
MRSA positive (1+): the visual field, 10-99 bar/50。
MRSA positive (2+): the every visual field of 1-9 bar。
MRSA positive (3+): the every visual field of 10-99 bar。
MRSA positive (4+): > 100 every visuals field。
Adopt above-mentioned fluorescence in situ hybridization (FISH) method that 200 parts of clinical samples detect the result of (testing result of 200 parts of clinical samples is divided into A～H8 kind situation) as shown in table 1。
Comparative example 1: culture method detection methicillin-resistant staphylococcus aureus
Sample is rule methicillin resistant Baird-Parker flat board, cultivate 24～48 hours in 37 DEG C。Staphylococcus aureus is golden yellow or white colony on blood plate, protruding greatly, and smooth surface around has haemolysis circle。Methicillin-resistant staphylococcus aureus bacterium colony on Baird-Parker flat board is circular, diameter 2～3mm, color ash or black, around has a turbidity zone。
The result that 200 parts of clinical samples are detected (testing result of 200 parts of clinical samples is divided into A～H8 kind situation) by culture method is as shown in table 1。
Comparative example 2:PCR method detection methicillin-resistant staphylococcus aureus
The method adopting PCR method detection methicillin-resistant staphylococcus aureus is as follows: extract the DNA of bacteria in sample by bacterial genomes DNA extraction kit (HYQ), MRSA detection kit (fluorescence quantitative PCR method, Thymopetidum Injection thing), carry out fluorescence quantitative PCR detection。With sterilized water for negative control, CT value than negative control little more than 10 be considered as the positive。
The result that 200 parts of clinical samples are detected (testing result of 200 parts of clinical samples is divided into A～H8 kind situation) by PCR method is as shown in table 1。
The result of methicillin-resistant staphylococcus aureus in table 1 culture method, PCR method, FISH method 200 parts of clinical samples of detection
| Culture method | PCR method | Molecular beacon FISH | Sample number | |
| A | + | + | + | 82 |
| B | + | - | + | 12 |
| C | + | + | - | 1 |
| D | + | - | - | 0 |
| E | - | + | + | 8 |
| F | - | + | - | 17 |
| G | - | - | + | 6 |
| H | - | - | - | 74 |
In table 1, "+" representing that testing result is positive, "-" represents that testing result is negative。
From table 1: with culture method for standard, the positive rate of PCR method is the positive rate of (82+1)/(82+12+1+0) × 100%=87.3%, FISH method is (82+12)/(82+12+1+0) × 100%=98.8%；The false positive rate of PCR method is (8+17)/(8+17+6+74) × 100%=23.8%, and the false positive rate of molecular beacon FISH is (8+6)/(8+17+6+74) × 100%=13.3%。
In summary: the method for the invention (FISH method) detects MRSA, and positive rate has reached the 98.8% of culture method, its positive rate is higher than PCR method；The false positive rate of FISH method detection simultaneously is 13.3%, lower than PCR method。It addition, the method for the invention (FISH method) detects MRSA, and though positive detection rate and false positive rate all with culture method very close to, and its operation on more simple and efficient than culture method, substantially increase detection efficiency。
Finally be should be noted that; above example is only in order to illustrate technical scheme but not limiting the scope of the invention; although the present invention being explained in detail with reference to preferred embodiment; it will be understood by those within the art that; technical scheme can be modified or equivalent replacement, without deviating from the spirit and scope of technical solution of the present invention。
<110>Suzhou Da Maidi biomedicine Science and Technology Ltd.
<120>for the molecular beacon probe of methicillin-resistant staphylococcus aureus detection, test kit and method
<160>3
<170>PatentInversion3.3
<210>1
<211>30
<212>DNA
<213>artificial sequence
<400>1
ttccaccaatacaggaacagcatattggaa30
<210>2
<211>30
<212>DNA
<213>artificial sequence
<400>2
ttccataattcacctgtttgagggttggaa30
<210>3
<211>30
<212>DNA
<213>artificial sequence
<400>3
ttccagtaaccaccccaagatttattggaa30
Claims (10)
1. the molecular beacon probe for methicillin-resistant staphylococcus aureus detection, it is characterised in that: described molecular beacon probe comprises three kinds of probes of BeaconMRSA1, BeaconMRSA2 and BeaconMRSA3；The base sequence of described BeaconMRSA1 is such as shown in SEQIDNO:1, and the base sequence of described BeaconMRSA2 is such as shown in SEQIDNO:2, and the base sequence of described BeaconMRSA3 is such as shown in SEQIDNO:3；Described BeaconMRSA1, BeaconMRSA2 and BeaconMRSA3 5 ' ends be all marked with fluorophor, BeaconMRSA1, BeaconMRSA2 and BeaconMRSA3 3 ' ends be all marked with quencher。
2. the molecular beacon probe for methicillin-resistant staphylococcus aureus detection as claimed in claim 1, it is characterised in that: described fluorophor is CY3, and quencher is BHQ1 or described fluorophor is FAM, and quencher is TANRA。
3. the test kit for methicillin-resistant staphylococcus aureus detection containing, for example molecular beacon probe described in claim 1 or 2。
4. the test kit for methicillin-resistant staphylococcus aureus detection as claimed in claim 3, it is characterised in that: described test kit also includes hybridization solution and cleaning mixture。
5. the test kit for methicillin-resistant staphylococcus aureus detection as claimed in claim 4, it is characterised in that: described hybridization solution contains dextran sulfate, NaCl, deionized formamide, Na2EDTA, TritonX-100 and Tris-HCl buffer solution；Described cleaning mixture contains Tris, NaCl, TritonX-100 and sodium lauryl sulphate, and the pH value of cleaning mixture is 6～10。
6. the test kit for methicillin-resistant staphylococcus aureus detection as claimed in claim 5, it is characterised in that: the concentration of described deionized formamide is 10～40% (v/v)。
7. the test kit for methicillin-resistant staphylococcus aureus detection as claimed in claim 6, it is characterized in that: described hybridization solution contains following components: 1～10% (w/v) dextran sulfate, 100～1000mmol/LNaCl, 10～40% (v/v) deionized formamide, 5mmol/LNa2EDTA, 0.01～1% (v/v) TritonX-100 and 5～200mMTris-HCl buffer solution, the pH value of Tris-HCl buffer solution is 7.5；Described cleaning mixture contains following components: 5～50mmol/LTris, 10～100mmol/LNaCl, 0.01～0.2% (v/v) TritonX-100 and 0.01～0.2% (v/v) sodium lauryl sulphate。
8. as described in any one of claim 3～7 for methicillin-resistant staphylococcus aureus detection test kit, it is characterised in that: in described molecular beacon probe, BeaconMRSA1, BeaconMRSA2 and BeaconMRSA3 concentration be 10ng/ μ L。
9. the method adopting test kit as claimed in claim 4 detection methicillin-resistant staphylococcus aureus, it is characterised in that: comprise the following steps:
(1) pipette samples drops on slide, dries, makes the bacteria adhension in sample on slide；
(2) slide is immersed in dehydrated alcohol, soak；
(3) on sample, add hybridization solution and molecular beacon probe, be placed on fluorescence in situ hybridization instrument and hybridize；
(4) wash with cleaning mixture；
(5) drip mountant after drying, with fluorescence microscopy, sweep with object lens and counting, and observe ne ar。
10. the as claimed in claim 9 method detecting methicillin-resistant staphylococcus aureus, it is characterised in that: in described step (3), the temperature being placed on fluorescence in situ hybridization instrument to carry out hybridizing is 42～58 DEG C。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610177012.0A CN105695598A (en) | 2016-03-25 | 2016-03-25 | Molecular beacon probe, kit and method for detecting methicillin-resistant staphylococcus aureus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610177012.0A CN105695598A (en) | 2016-03-25 | 2016-03-25 | Molecular beacon probe, kit and method for detecting methicillin-resistant staphylococcus aureus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105695598A true CN105695598A (en) | 2016-06-22 |
Family
ID=56231598
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610177012.0A Pending CN105695598A (en) | 2016-03-25 | 2016-03-25 | Molecular beacon probe, kit and method for detecting methicillin-resistant staphylococcus aureus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105695598A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107190063A (en) * | 2017-06-06 | 2017-09-22 | 江南大学 | A kind of method of pathogenic bacteria in isothermal rapid amplifying detection food |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102304571A (en) * | 2011-08-18 | 2012-01-04 | 新疆生产建设兵团医院 | Method for rapidly detecting staphylococcus aureus by utilizing molecular beacon |
| CN102399877A (en) * | 2011-11-09 | 2012-04-04 | 泰普生物科学（中国）有限公司 | Staphylococcus aureus methicillin resistant strain PCR (Polymerase Chain Reaction) detection kit |
| US20140295417A1 (en) * | 2011-03-18 | 2014-10-02 | Miacom | Identification of antibiotic resistance |
-
2016
- 2016-03-25 CN CN201610177012.0A patent/CN105695598A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140295417A1 (en) * | 2011-03-18 | 2014-10-02 | Miacom | Identification of antibiotic resistance |
| CN102304571A (en) * | 2011-08-18 | 2012-01-04 | 新疆生产建设兵团医院 | Method for rapidly detecting staphylococcus aureus by utilizing molecular beacon |
| CN102399877A (en) * | 2011-11-09 | 2012-04-04 | 泰普生物科学（中国）有限公司 | Staphylococcus aureus methicillin resistant strain PCR (Polymerase Chain Reaction) detection kit |
Non-Patent Citations (1)
| Title |
|---|
| 申建维: "多重分子信标环介导等温扩增快速检测耐甲氧西林金黄色葡萄球菌", 《中华医院感染学杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107190063A (en) * | 2017-06-06 | 2017-09-22 | 江南大学 | A kind of method of pathogenic bacteria in isothermal rapid amplifying detection food |
| CN107190063B (en) * | 2017-06-06 | 2020-11-06 | 江南大学 | Method for detecting pathogenic bacteria in food by isothermal rapid amplification |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102260737B (en) | Primers and application thereof in quick detection of nosema bombycis | |
| CN109055381B (en) | ssDNA nucleic acid aptamer for vibrio anguillarum specific recognition and screening and application | |
| CN103642936A (en) | Primer probe composition and kit for specific detection of 55 type adenovirus nucleic acid | |
| CN104017889B (en) | Molecular beacon probe for rapid detection of Mycobacterium tuberculosis and method for detecting Mycobacterium tuberculosis | |
| CN101113473A (en) | Method for detecting food-derived pathogenic vibrio bacteria by composite fluorescence PCR technique | |
| CN109097365B (en) | Aptamer for vibrio vulnificus recognition, screening method and application | |
| CN103555842B (en) | Animal chlamydia TaqMan-MGB probe multiplex real-time fluorescent quantitative PCR (polymerase chain reaction) detection primers, kit and method | |
| CN110982881A (en) | Molecular beacon probe and kit for detecting helicobacter pylori and detection method thereof | |
| CN102676664A (en) | Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method | |
| CN101113471A (en) | Method for detecting food-derived pathogenic enterobacteria by composite fluorescence PCR technique | |
| CN104032023B (en) | A kind of molecular beacon probe of rapid detection non-tuberculous mycobacteria and detection method | |
| CN104388558B (en) | The molecular beacon probe of a kind of quick detection streptococcus agalactiae and detection method | |
| CN102304571A (en) | Method for rapidly detecting staphylococcus aureus by utilizing molecular beacon | |
| CN105695598A (en) | Molecular beacon probe, kit and method for detecting methicillin-resistant staphylococcus aureus | |
| CN104694638A (en) | Probe, kit and method for detecting salmonella | |
| CN107058589A (en) | A kind of molecular beacon probe, kit and the method for quick detection urinary tract infections bacterium | |
| CN103667538B (en) | Gene chip, kit and method for detecting three viruses for immunosuppression disease of chickens | |
| CN104651512A (en) | Probe, kit and method for detecting bacteria in foods | |
| CN104313174A (en) | Molecular beacon probe for rapidly detecting streptococcus pneumoniae and detection method | |
| CN104651510A (en) | Probe, kit and method for detecting bacterial contamination in water body | |
| CN115992143A (en) | High-flux drug screening method for resisting nervous necrosis virus | |
| CN104372069A (en) | Specific probe capable of rapidly detecting pseudocohnilembus persalinus, detection method and applications thereof | |
| CN110964841A (en) | Molecular beacon probe and kit for detecting septicemia and detection method thereof | |
| CN104388557A (en) | Molecular beacon probe and detection method for rapidly detecting pyogenic streptococcus | |
| CN102363812A (en) | Visual loop-mediated isothermal amplification (LAMP) detection reagent and detection method for perkinsus olseni |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160622 |