CN105695392B - A kind of cultural method that liver cell vitro differentiation phenotype and function can be improved - Google Patents
A kind of cultural method that liver cell vitro differentiation phenotype and function can be improved Download PDFInfo
- Publication number
- CN105695392B CN105695392B CN201510937399.0A CN201510937399A CN105695392B CN 105695392 B CN105695392 B CN 105695392B CN 201510937399 A CN201510937399 A CN 201510937399A CN 105695392 B CN105695392 B CN 105695392B
- Authority
- CN
- China
- Prior art keywords
- cell
- liver
- liver cell
- holder
- culture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/067—Hepatocytes
- C12N5/0671—Three-dimensional culture, tissue culture or organ culture; Encapsulated cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2533/00—Supports or coatings for cell culture, characterised by material
- C12N2533/50—Proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2533/00—Supports or coatings for cell culture, characterised by material
- C12N2533/90—Substrates of biological origin, e.g. extracellular matrix, decellularised tissue
Abstract
The present invention discloses a kind of cultural method that liver cell vitro differentiation phenotype and function can be improved, it is characterised in that：The method follows the steps below：Use liver cell for seed cell, using porous silk albumen holder as Hepatocytes culture in vetro carrier, liver cell, liver source property interstitial cell and extracellular matrix are inoculated by a certain percentage on porous silk albumen holder, and porous silk albumen branch is placed in the in vitro culture microenvironment of simulation liver cell and is cultivated；The three-dimensional liver cell co-culture system that this method is established, can be used not only for engineered hepatocyte function unit, and can be additionally used in influence and hepatotoxicity wind agitation detection of the in-vitro evaluation drug to hepatic metabolism enzyme, and new screening and assessment tool is provided for new drug development.
Description
Technical field
The present invention relates to a kind of extracorporeal culturing method of liver cell, especially one kind, and liver cell vitro differentiation phenotype can be improved
And the cultural method of function.
Background technology
Primary hepatocyte does not build the ideal seed cell source of engineered liver still, and is also to drug body
Outer ADME/T properties carry out the important models of accurate evaluation.But liver cell easily occurs in traditional external plane incubation
There is active reduction, the change of phenotype and functional activity in " dedifferenting "（Including synthesis and metabolic activity）Reduction very
To completely losing.Research confirms：For the human liver cell of fresh separated under condition of suspension culture, P450 enzymatic activitys only maintain 4h；
In the coated culture plate of collagen, the P450 expression of enzymes amount and enzymatic activity of attached cell will significantly reduce after 24-48h.And
Due to the reduction of enzyme functional activity, sensitivity of the liver cell monolayer method in hepatotoxic medication screening only has 50%.Therefore
" dedifferenting " phenomenon of liver cell is overcome or delayed in how cultivating in vitro, to effectively maintain the ideal differentiation shape of liver cell
State maintains " bottleneck " problem that its phenotype and correlation function are always urgently to be resolved hurrily in hepatocyte cultures and application study.
Invention content
The present invention is to propose that one kind ideal can maintain liver cell life to solve the above-mentioned deficiency present in the prior art
It is long acting, and significantly improve the new cultural method of Cultured Hepatocytes in vitro phenotype and functional activity.
Technical solution of the invention is：A kind of cultural method that liver cell vitro differentiation phenotype and function can be improved,
It is characterized in that：The method follows the steps below：Use liver cell for seed cell, with porous silk albumen holder
As Hepatocytes culture in vetro carrier, liver cell, liver source property interstitial cell and extracellular matrix are inoculated by a certain percentage more
On the fibroin holder of hole, and porous silk albumen branch is placed in the in vitro culture microenvironment of simulation liver cell and is trained
It supports,
Described is inoculated into porous silk albumen by a certain percentage by liver cell, liver source property interstitial cell and extracellular matrix
Concrete operation step on holder is as follows：By the liver cell of fresh separated and liver star interstitial cell according to cell number 3:1 ratio
Example mixing, and the cell mixing of acquisition is mixed with extracellular matrix, obtain cell-matrix mixture, the extracellular base
Matter is 1 according to volume ratio by collagen and matrigel:1 ratio mixes, and is then seeded to cell-matrix mixture multiple spot
Multiple porous silk albumen holders, and ensure that liver cell quantity is 600,000cells/ holders, the volume of matrigel is 30 μ L/
Holder,
Described is placed on porous silk albumen branch the tool cultivated in the in vitro culture microenvironment of simulation liver cell
Steps are as follows for gymnastics work：The porous silk albumen holder that inoculation is completed is placed into porous cell according to the density in 1 holder/hole
In culture plate, and porous cell culture plate is placed in cell incubator, in 37 DEG C, 5%CO2Under conditions of gelation 2h, then
It is added into each hole of porous cell culture plate and co-cultures base, the co-cultivation base is hepatocyte culture medium and star interstitial
Cell culture medium is 1 according to volume ratio:1 ratio mixes.
The present invention compared with the existing technology, has the following advantages that：
The extracorporeal culturing method of liver cell disclosed in this invention, the cultural method utilize between cell and cell and thin
Complicated interaction between born of the same parents and extracellular matrix forms the microenvironment similar with internal liver cell, makes the growth of liver cell
Form is closer to internal three dimensional growth mode；It is used as culture holder using porous fibroin albumen, while adding collagen and matrix
Glue constructs a compound criteria system as culture substrate, which is not only able to provide three-dimensional for liver cell
Growing space, and it has the characteristics that biocompatibility, material plasticity and supports hepatic cell growth and organized, in addition,
Its porous character is also greatly improved the transmission of the substance in cultivating system, is tieed up in incubation in vitro to be conducive to liver cell
Hold its activity；Biocompatibility, mechanical strength feature and biodegradation character specific to porous silk albumen holder so that should
Cultivating system is easily achieved Hepatocyte transplant and recycling, this can not only promote liver cell replacement therapy, but also may be
It inquires into the correlative study in relation to hepatocyte transplantation and ideal research model system is provided；In the model that the cultural method is established,
Iuntercellular establishes cell communication each other, and can be differentiated to form bile capillaries structure, illustrates constructed hepatocyte cultures system more
Have systematism feature, its phenotype and function are maintained in incubation in vitro to be conducive to liver cell；This method is established
Cultivating system in, the secretion of the albumin of liver cell and urea synthesizing function are all remarkably higher than plane culture group and " sandwich " training
Group is supported, closer to the functional activity in body liver cell, while the metabolic enzyme activity of liver cell is significantly higher than biography in the cultivating system
System cultural method（Plane culture group and " sandwich " culture group）, more conducively drug metabolism activity and hepatotoxicity wind agitation are carried out accurate
In-vitro evaluation, so as to provide new appraisal tool for new drug development.
Description of the drawings
Fig. 1 is the scanning electron microscope (SEM) photograph of porous silk albumen holder（A：It is prepared by salting out method；B:It is prepared by organic solvent method）.
Fig. 2 is to show Rat Primary Hepatocytes using live cell fluorescent labeling method（It is red）With star interstitial cell（It is blue
Color fluorescence）Growthform on porous silk albumen holder（A：3D co-cultivation groups；B：Control group）And cell activity（C）.
Fig. 3 is morphosis of the HE dyeing display using the rat hepatocytes of the method for the invention culture（A1-2：This hair
Bright culture group；B：Control group）.
Fig. 4 is scanning electron microscope（SEM）Detection shows growth shape of the Rat Primary Hepatocytes on porous silk albumen holder
Looks and feature（A1-2）；Transmission electron microscope（TEM）Detection shows that Rat Primary Hepatocytes form cell connection（B）.
Fig. 5 is that the albumin of the rat hepatocytes of the method for the invention culture secretes (A) and urea synthesizing function (B).
Fig. 6 is to detect the method for the invention using qRT-PCR methods to express Rat Primary Hepatocytes metabolic enzyme gene
Horizontal one of influence legend.
Fig. 7 is to detect the method for the invention using qRT-PCR methods to express Rat Primary Hepatocytes metabolic enzyme gene
The two of horizontal influence legend.
Fig. 8 is to detect the method for the invention using qRT-PCR methods to express Rat Primary Hepatocytes metabolic enzyme gene
The three of horizontal influence legend.
Fig. 9 is the method for the invention on the active influences of Rat Primary Hepatocytes metabolic enzyme CYP3A1.
Specific implementation mode
Below in conjunction with the specific implementation mode of the description of the drawings present invention.As shown in Figures 1 to 7：
The preparation of porous silk albumen holder：
The silk fibroin protein solution for preparing a concentration of 6-7% first, using saltout-seasoning prepares porous fibroin albumen holder,
It is 500-600 μm to control holder aperture by salt particle size, is fully infiltrated in deionized water after dry, then using mark
Quasi- card punch prepares diameter 5mm, the three-dimensional rack of thickness 3mm（That is porous silk albumen holder）.Porous silk albumen holder exists
It needs to handle through autoclave sterilization before inoculating cell, and is immersed in culture medium and carries out pre-equilibrating 12 h.
Rat Primary Hepatocytes are separately cultured：
Rat uses two step perfusion method of clostridiopetidase A after anesthesia（0.5mg/ml,Collagenase Type）Separation obtains rat（At
Year, male Sprague Dawley rats）Primary hepatocyte is purified after the separation of gradient percoll liquid, is enriched with.It is logical
It often can get 2 × 108Cell total amount, and competent cell>The hepatocyte cultures of 90%. fresh separateds are cultivated in William ' s E
Base adds 0.5 U/mL insulin (Invitrogen), 7 ng/mL glucagons (Sigma), 7.5 μ g/mL hydrogenations
Ground loose (Sigma) and 1% antibiotic (Invitrogen) are examined,
Rat primary liver star interstitial cell purchases U.S. ScienCell, is incubated at Stellate culture mediums, cell life
It is long to carrying out 1 when nearly 90% degrees of fusion：3 routine passage cultures,
All cells are incubated at 37 DEG C, in 5%CO2 cell incubators.
Carry out the in vitro culture of rat hepatocytes：
It is thin as liver using porous silk albumen holder using the Rat Primary Hepatocytes obtained in above-mentioned steps as seed cell
The outer culture carrier of cell space, porous silk egg is inoculated by liver cell, liver source property interstitial cell and extracellular matrix by a certain percentage
On white rami frame, and porous silk albumen branch is placed in the in vitro culture microenvironment of simulation liver cell and is cultivated,
By the liver cell of fresh separated and liver star interstitial cell according to cell number 3:1 ratio mixing, and by acquisition
Cell mixing is mixed with extracellular matrix, obtains cell-matrix mixture, and the extracellular matrix is pressed by collagen and matrigel
It is 1 according to volume ratio:1 ratio mixes（The collagen and matrigel selects the product of BD Biosciences）, so
Cell-matrix mixture multiple spot is seeded to multiple porous silk albumen holders afterwards, and ensures that liver cell quantity is 600,
The volume of 000cells/ holders, matrigel is 30 μ L/ holders,
The porous silk albumen holder that inoculation is completed is placed into porous cell culture plate according to the density in 1 holder/hole
In, and porous cell culture plate is placed in cell incubator, in 37 DEG C, 5%CO2Under conditions of fully gelation 2h, then to
It is slowly added to co-culture base in each hole of porous cell culture plate, the co-cultivation base is between hepatocyte culture medium and star
Cell plastid culture medium is 1 according to volume ratio:1 ratio mixes,
Through the above steps, the three-dimensional co-culture model of liver cell is constructed.
Rat Primary Hepatocytes with batch fresh separated are directly inoculated in respectively with equal densities through collagen coated 24
Orifice plate as a control group 1（Plane culture group）；It is control group 2 to concurrently set traditional sandwich culture group.
Establish the morphologic detection platform of evaluation liver cell three-dimensional co-culture model：
Hepatic cell growth form and Activity determination：In order to preferably observe different cells in three-dimensional co-culture system, first
Using viable cell labelling dyestuff DiI and DiD（Invitrogen）Primary hepatocyte and star interstitial cell, culture 5 are marked respectively
It is directly observed under laser confocal microscope after it.Cell activity dyeing uses calcein-AM/EthD-1 staining kits
(Invitrogen), 37 DEG C of incubation 2h, remaining operation by specification carry out.Observed under laser confocal microscope after dyeing,
It takes pictures.
H&E is dyed：24 h are fixed at room temperature through PBS flushings, 4% paraformaldehyde after sample collection, are prepared by morphology center
Paraffin section.Again H&E stained slices are prepared by dewaxing, H&E dyeing and mounting successively.Face optical microphotograph under the microscope,
It takes pictures.
Scanning electron microscope and transmission electron microscope observing：Collected sample is fixed before 2.5% glutaraldehyde solution after PBS is fully cleaned
4-6 h fix 2 h after PBS is rinsed after 2% osmic acid, after PBS is fully cleaned again, sample segment is placed in vacuum drying chamber and does
It is dry overnight.Sample is observed under scanning electron microscope and is taken pictures after metal spraying 15min after drying.Remaining sample send to transmission electron microscope and detects
Center prepares ultra-thin section after resin embedding, observes, takes pictures under transmission electron microscope.
Establish the functional activity detection platform of evaluation liver cell three-dimensional co-culture model：
Albumin content measures and urea synthesizing measures：Periodically collect culture medium in each culture group in incubation, -80
DEG C preserve after measure batch albumin and urea content.Wherein, albumin measuring uses rat albumin ELISA kit, urine
The measurement of element synthesis uses QuantiChrom urea detection kits.Concrete operations are completed according to specification.
Quantitative RT-PCR measures metabolic enzyme gene expression：Sample is periodically collected, TRIZOL lytic cells are directly used,
After RNAeasy kits (Qiagen) extracts total serum IgE, using PrimeScriptTM RT kits and SYBR Premix Ex
TaqTMII kits（TaKaRa）Carry out quantitative RT-PCR amplification.According to the Ct values of each target gene and the Ct values of reference gene
Carry out quantitative analysis（ABI smart I）, determine the expression of each target gene.The primer sequence of institute's amplification gene is as follows：
The primer sequence of quantitative RT-PCR detection
| Gene | Forward | Reverse |
| rGAPDH | CAAGGTCATCCATGACAACTTTG | GGGCCATCCACAGTCTTCTG |
| rCYP1A2 | CGGTGATTGGCAGAGATCGG | GTCCCTCGTTGTGCTGTGG |
| rCYP2B1 | CTCCAAAAACCTCCAGGAAATCCTC | GTGGATAACTGCATCAGTGTATGGC |
| rCYP3A1 | GAGGAGTAATTTGCTGACAGAACCTGC | CCAGGAAT CCCCTGTTTCTTGAA |
r: Rat-specific primer
Liver cell metabolic enzyme activity measures：In culture the 6th day, serum free medium is replaced, and 50 μM of testosterones are added, 37
Culture medium is collected after DEG C being incubated 4h, 4 DEG C of centrifugations（12000rpm, 10min）Supernatant is collected afterwards to preserve to -80 DEG C of refrigerators.Band sample
After product are collected, the level of 6 β hydroxyl stosterones of CYP3A metabolites is detected using HPLC methods（Testing conditions：A
(methanol): B (water) = 52:48, 0-15 min, B 48-30, 15-20 min30-20, UV 254 nm）.
As a result：
1. hepatic cell growth form and activity：As shown in Fig. 2, primary hepatocyte grows shape on porous silk albumen holder
State is good, and cell activity dyeing shows that most cells are green fluorescence, illustrates that its activity is ideal.Only a small amount of cell is dead
It dies, is displayed in red fluorescence.Agglomerate growth pattern is presented in three-dimensional co-culture system in cell marking picture prompting, liver cell, and easily
In polymerized together agglomerating with star interstitial cell；And cellular control unit more disperses, and has no cell agglomerating phenomenon polymerized together.Point
Analysis liver cell polymerization is agglomerating to be had reason liver cell incubation preferably maintains its phenotype and function in vitro.
2. H&E is dyed（Fig. 3）As a result formation and the morphological feature of liver cell group are further proved.It can be seen that：Most of liver is thin
The agglomerate on porous silk albumen holder is grown born of the same parents with star interstitial cell.Wherein, liver cell present polygonal, it is seen that monokaryon or
Double-core, and star interstitial cell be distributed in liver cell group in, the two closely condenses together, support two kinds of iuntercellulars there may be
It interacts between cell-ECM.
3. as shown in figure 4, scanning electron microscope result shows liver cell compact growth in porous silk albumen rack surface and three
Hole, cellular morphology rule are tieed up, and secretes a large amount of extracellular matrix.It is connected with each other to each other, forms the apparent of class loading
Shape characteristic.Saturating color electron microscope analysis, which further displays, can establish cell tight junction between liver cell and liver cell, to each other
There are exchanges, and " class loading " feature is presented.These all support excellent activity, systematism of the liver cell in vitro in incubation
Feature and desired phenotypes.
As shown in figure 5, the secretion of liver cell albumin and urea synthesizing testing result show：Compared with the control group, it is based on silk
Liver cell can secrete the albumin of higher level in the three-dimensional co-cultivation group of albumen holder；In addition its urea synthesizing level also compares
Control group is significantly increased（P<0.05）.The result illustrates that primary hepatocyte is able to maintain that ideal conjunction under the cultivating system
At functional activity.
The evaluation and enzyme assay of liver cell metabolic enzyme expression：The change of liver cell metabolic enzyme is to liver cell generation
Thank to the important indicator that function is evaluated.As shown in Fig. 6,7,8,9, Rat Primary Hepatocytes is a variety of thin after three-dimensional co-culture
Born of the same parents' metabolism of pigment enzyme gene table level is significantly higher than control group, and is found by specific substrate metabolic analysis：It is cultivated with compareing
Group compares, and liver cell improves the metabolism of testosterone in dimensional culture system, it was demonstrated that the metabolic activity of its CYP3A is in the cultivating system
It inside ideal can also maintain, to provide an experiment argument for the ideal functionality of liver cell.
Claims (1)
1. a kind of cultural method that liver cell vitro differentiation phenotype and function can be improved, it is characterised in that：The method according to
Following steps carry out：Use liver cell for seed cell, it, will using porous silk albumen holder as Hepatocytes culture in vetro carrier
Liver cell, liver source property interstitial cell and extracellular matrix are inoculated by a certain percentage on porous silk albumen holder, and will be porous
Fibroin branch is placed in the in vitro culture microenvironment of simulation liver cell and is cultivated,
Described is inoculated into porous silk albumen holder by a certain percentage by liver cell, liver source property interstitial cell and extracellular matrix
On concrete operation step it is as follows：By the liver cell of fresh separated and liver star interstitial cell according to cell number 3:1 ratio is mixed
Close, and the cell mixing of acquisition mixed with extracellular matrix, acquisition cell-matrix mixture, the extracellular matrix by
Collagen and matrigel are 1 according to volume ratio:1 ratio mixes, and is then seeded to cell-matrix mixture multiple spot multiple
Porous silk albumen holder, and ensure that liver cell quantity is 600,000cells/ holders, the volume of matrigel is 30 μ L/ holders,
Described is placed on porous silk albumen branch the specific behaviour cultivated in the in vitro culture microenvironment of simulation liver cell
Steps are as follows for work：The porous silk albumen holder that inoculation is completed is placed into porous cell culture according to the density in 1 holder/hole
In plate, and porous cell culture plate is placed in cell incubator, in 37 DEG C, 5%CO2Under conditions of gelation 2h, then to more
It is added in each hole of porocyte culture plates and co-cultures base, the co-cultivation base is hepatocyte culture medium and star interstitial cell
Culture medium is 1 according to volume ratio:1 ratio mixes,
The porous silk albumen holder is prepared in accordance with the following steps：The silk fibroin protein solution of a concentration of 6-7% is prepared first,
Using saltout-seasoning prepares porous fibroin albumen holder, it is 500-600 μm to control holder aperture by salt particle size,
It is fully infiltrated in deionized water after drying, diameter 5mm is then prepared using standard hole device, the three-dimensional rack of thickness 3mm, i.e.,
Porous silk albumen holder, and porous silk albumen holder needs to handle through autoclave sterilization before inoculating cell, and impregnate
It carries out pre-equilibrating 12 h in culture medium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510937399.0A CN105695392B (en) | 2015-12-15 | 2015-12-15 | A kind of cultural method that liver cell vitro differentiation phenotype and function can be improved |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510937399.0A CN105695392B (en) | 2015-12-15 | 2015-12-15 | A kind of cultural method that liver cell vitro differentiation phenotype and function can be improved |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105695392A CN105695392A (en) | 2016-06-22 |
| CN105695392B true CN105695392B (en) | 2018-11-13 |
Family
ID=56227952
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510937399.0A Expired - Fee Related CN105695392B (en) | 2015-12-15 | 2015-12-15 | A kind of cultural method that liver cell vitro differentiation phenotype and function can be improved |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105695392B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3595686A4 (en) * | 2017-02-01 | 2020-12-02 | PhoenixSongs Biologicals, Inc. | Compositions and methods comprising co-culture of hepatocytes |
| CN107446885B (en) * | 2017-09-06 | 2021-02-26 | 大连医科大学 | Mesenchymal stem cell in-vitro osteogenic induced differentiation scaffold material and application thereof |
| CN110384823B (en) * | 2019-07-19 | 2021-08-03 | 大连医科大学 | Bionic liver lobule based on silk fibroin scaffold and construction method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103289107A (en) * | 2013-05-28 | 2013-09-11 | 苏州丝美特生物技术有限公司 | Preparation method and application of injectable silk fibroin in-situ gel |
| CN103418022A (en) * | 2013-07-15 | 2013-12-04 | 江苏海泽医疗科技发展有限公司 | Composite multifunctional biological hemostatic material and preparation method thereof |
| CN104667349A (en) * | 2015-02-06 | 2015-06-03 | 福州大学 | Growth factor-loading silk fibroin/collagen bracket material and preparation method thereof |
-
2015
- 2015-12-15 CN CN201510937399.0A patent/CN105695392B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103289107A (en) * | 2013-05-28 | 2013-09-11 | 苏州丝美特生物技术有限公司 | Preparation method and application of injectable silk fibroin in-situ gel |
| CN103418022A (en) * | 2013-07-15 | 2013-12-04 | 江苏海泽医疗科技发展有限公司 | Composite multifunctional biological hemostatic material and preparation method thereof |
| CN104667349A (en) * | 2015-02-06 | 2015-06-03 | 福州大学 | Growth factor-loading silk fibroin/collagen bracket material and preparation method thereof |
Non-Patent Citations (2)
| Title |
|---|
| 以胶原水凝胶为支架构建肝细胞三维培养系统;王敏等;《中国组织工程研究》;20130716;第17卷(第29期);第5323-5330页 * |
| 旋转生物反应器内微载体共培养CL1肝细胞与人肝星形细胞;潘康明等;《南方医科大学学报》;20130630;第33卷(第6期);第902-905页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105695392A (en) | 2016-06-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kapałczyńska et al. | 2D and 3D cell cultures–a comparison of different types of cancer cell cultures | |
| Anada et al. | An oxygen-permeable spheroid culture system for the prevention of central hypoxia and necrosis of spheroids | |
| EP3515600B1 (en) | Organoid arrays | |
| Wang et al. | Human induced pluripotent stem cell-derived beating cardiac tissues on paper | |
| Elkayam et al. | Enhancing the drug metabolism activities of C3A—a human hepatocyte cell line—by tissue engineering within alginate scaffolds | |
| Lee et al. | Engineering liver tissue spheroids with inverted colloidal crystal scaffolds | |
| Lu et al. | Three-dimensional co-culture of rat hepatocyte spheroids and NIH/3T3 fibroblasts enhances hepatocyte functional maintenance | |
| CN103710263B (en) | Cell culture apparatus | |
| AU2015248875B9 (en) | Method of preparing cells for 3D tissue culture | |
| CN105695392B (en) | A kind of cultural method that liver cell vitro differentiation phenotype and function can be improved | |
| CN108795850A (en) | A kind of Spermatogonial Stem Cells are without feeder layer long-period culture method | |
| CN110951676A (en) | Bionic liver organoid culture model and application thereof | |
| US11685900B2 (en) | Nanofiber-based long-term primary hepatocyte three-dimensional culture system and culturing method | |
| CN102575226A (en) | Methods and kits for cell release | |
| De Bartolo et al. | Effect of isoliquiritigenin on viability and differentiated functions of human hepatocytes maintained on PEEK-WC–polyurethane membranes | |
| Charwat et al. | The third dimension in cell culture: From 2D to 3D culture formats | |
| Kojima et al. | Spheroid array of fetal mouse liver cells constructed on a PEG-gel micropatterned surface: upregulation of hepatic functions by co-culture with nonparenchymal liver cells | |
| CN110384823B (en) | Bionic liver lobule based on silk fibroin scaffold and construction method | |
| He et al. | Modular assembly–based approach of loosely packing co-cultured hepatic tissue elements with endothelialization for liver tissue engineering | |
| He et al. | Bottom-up fabrication of 3D cell-laden microfluidic constructs | |
| CN105132353A (en) | Monocolonal cell acquisition method | |
| Li et al. | Improved performance of primary rat hepatocytes on blended natural polymers | |
| CN108118079B (en) | Drug hepatotoxicity evaluation method based on three-dimensional liver model of qualitative filter paper | |
| Henkens et al. | Rat hepatocyte cultures: conventional monolayer and cocultures with rat liver epithelial cells | |
| WO2019059702A2 (en) | Nanofiber-based long-term primary hepatocyte three-dimensional culture system and culturing method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20181113 Termination date: 20211215 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |