A kind of Spermatogonial Stem Cells are without feeder layer long-period culture method
Technical field
The invention belongs to cell engineering field, more particularly to a kind of Spermatogonial Stem Cells are without feeder layer long-term cultivation
Method.
Background technology
China is most one of country of raising pigs in the world, since pig is close with the affiliation of people, physiological and biochemical index
It is similar to the mankind, thus it is usually utilized to the reproductive development mechanism of the research mankind.
Stem spermatogonium (spermatogonial stem cells, SSC) is in the mammalian body uniquely can will be hereditary
Information passes to follow-on adult stem cell.In early stage is studied, SSCs is considered as single energy always, and actually SSC
It can independently reprogram to form ES sample pluripotent stem cells in incubation, although spontaneous reprogramming is relatively inefficient,
Therefore, stem spermatogonium is also considered as a kind of ideal source of multipotential cell, can break up to various kinds of cell type, packet
Include smooth muscle cell, vascular endothelial cell, ovum mother like cell, liver stem cells like cell, kidney parenchyma, neuron cell,
Neural epithelium like cell etc..
Nowadays, the stem spermatogonium of Cultured Mouse and some other species has been carried out.1998, Brinster
Deng the long-term cultivation reported for the first time about stem spermatogonium, studies have shown that spermatogonium fast breeding can be made by being overexpressed GDNF,
And interfering GDNF then can be such that spermatogonium quantity reduces, this finds the optimization for then having quickly promote stem spermatogonium culture medium
With screening.Screening effective Spermatogonial Stem Cells cultivating system must not for the research relevant mechanism of action of spermatogenesis
It can lack.By the end of currently, reported there are mainly four types of the cultivating system of spermatogonial stem cells into mouse, and the domestic animals such as pig are long-term
The stabilising system for cultivating SSCs is established not yet, especially when SSCs is carried out without feeder layer culture.Pig is as a kind of important
Model animal, the cultivating system for establishing and improving pig stem spermatogonium (pSSC) are extremely important.Existing stem spermatogonium is long-term
Cultivating system can not fully achieve the longterm culture in vitro of pig stem spermatogonium, therefore we need to optimize the external of pSSCs
Cultivating system lays the foundation to explore its biological characteristics.
Invention content
The purpose of the present invention is to provide a kind of Spermatogonial Stem Cells without feeder layer long-period culture method, passes through screening
Different extracellular matrixs and the stem spermatogonium long-term cultivation by chemical small molecule substance applied to pig, in vitro can be by pig
Stem spermatogonium culture to three months.
To achieve the above object, the technical solution adopted by the present invention is:
A kind of Spermatogonial Stem Cells are without feeder layer long-period culture method, it is characterised in that:It is natural artificial synthesized with 2D matches
Polypeptide matrices coating observes typical grape beading stem spermatogonium cluster as a kind of extracellular matrix in incubation,
The Spermatogonial Stem Cells culture of pig to two months and is maintained into preferable stem spermatogonium characteristic.
A kind of Spermatogonial Stem Cells are without feeder layer long-period culture method, it is characterised in that:It is natural artificial synthesized with 2D matches
Polypeptide matrices coating observes typical grape beading stem spermatogonium cluster as a kind of extracellular matrix in incubation,
Different chemical small molecule combinations is screened, by adding Chir99021, Repsox and CD lipid concentrates, by pig
Spermatogonial Stem Cells culture to three months and maintain preferable stem spermatogonium characteristic.
The 2D matches the artificial synthesized polypeptide that natural artificial synthetic polypeptide matrix coating is a kind of commercialization, application
In pig stem spermatogonium without feeder layer culture.
A kind of Spermatogonial Stem Cells are without feeder layer long-period culture method, it is characterised in that include the following steps:
1) separation of pig testis primary cell:
It is adherent through difference twice in succession using two step enzyme digestions, it is rich to separation by multipotent stem cells dyestuff CDy1
Collect obtained pig stem spermatogonium identification;
2) culture and passage of stem spermatogonium:
It when the stem spermatogonium stand density of pig reaches 80-90%, is passed on, first, gentle manipulation discards former training
Nutrient solution is then cleaned once with PBS, and the trypsase that 1-1.5mL 0.25% is added digests 3-5min in 37 DEG C, is used after taking-up
DMEM in high glucose (10%FBS) terminates digestion, and cell suspension is collected after soft piping and druming in centrifuge tube, and 1200rpm centrifuges 5min,
It is then resuspended with prepared pig stem spermatogonium culture solution, is inoculated in the tissue culture plate anticipated.
The cell culture board processing method is:Poly-D-lysine is coated with culture dish at least 4h, later uses culture plate
PBS is washed twice and is spontaneously dried.Gelatin (0.1%) is coated with culture dish 1h, then washed once for use with PBS.Laminin
Coated tablet (10 μ L/mL) 1h.After 10 μ L/mL laminins are coated with culture dish 1h, inoculating cell.2D matches natural agent box
Contain component A and B.Liquid A is added in cultivation plate hole and incubates 10min.After sucking liquid A, ingredient B is added, it is spare to incubate 1h.
The preparation method of the culture solution of pig stem spermatogonium is:DM/F12 basal liquids are used to prepare 500mL complete mediums,
The beta -mercaptoethanol (1000 ×) of 10%KSR, 1%NEAA, 5%FBS, 0.1%, 1% L-Glutamine concentrate is added
(100 ×) after being mixed well with magnetic stirring apparatus, in 0.22 μm of filter filtration sterilization, are sub-packed in the bottle of 20/50mL, 4 DEG C
It preserves, LIF, bFGF, EGF, GDNF is sequentially added before each use;Each factor final concentration is 20ng/mL.
A kind of Spermatogonial Stem Cells are without feeder layer long-period culture method, it is characterised in that specifically include following operation:
1) PBS (dual anti-100X) is added in 50mL centrifuge tubes, is positioned in ice chest, 75% alcohol washes pig testis is primary,
It is then washed twice with the dual anti-PBS of addition, cuts off epididymis, fat etc., then cut off tunica albuginea, it is intermediate repeatedly to replace surgical instrument,
It leaves a part of sample and is fixed for embedded section with PFA, remaining testis tissue shreds in 60 ware of glass, adds appropriate IV type
Clostridiopetidase A (2mg/mL) is added 1 when tissue shear to exquisiteness and when being visible by naked eyes tissue block:1:1 type Ⅳ collagenase (2mg/
mL);Dnase(20μg/mL);Dispase (2mg/mL), 37 DEG C of incubator digestion, midway is repeatedly rocked, is taken out after 15min, used
Pipette tips are chosen, until it is no longer sticky, it is transferred in 50mL centrifuge tubes, and about 30mL PBS are added, it is naturally heavy later to overturn mixing
5min drops, the liquid in addition to tissue block is transferred to new centrifuge tube by naked eyes visible bottom pink colour tissue block precipitation, 300g from
Heart 5min, abandons supernatant, and bottom white convoluted seminiferous tubule is cleaned centrifugation twice repeatedly with PBS, to remove interstitial cell and red blood cell,
5mL trypsase is then added, blows and beats mixing, 37 DEG C of incubators digest 5min, after taking-up, take a drop in training with 20 μ L liquid-transfering guns
It supports in ware, microscopy, when observing that 80% or more convoluted seminiferous tubule digests out, terminates digestion (serum or isometric training completely
Nutrient solution), supernatant is abandoned in centrifugation, and complete culture solution is resuspended, you can inoculated and cultured ware then carried out a difference patch every two hours
Wall carries out pig stem spermatogonium culture twice in succession.
2) from 60d when the combination of various chemical small molecules is added, the small molecule being related to includes:Chir99021 (C),
REPSOX (R), AM580 (A), SGC0946 (S), VC (V), folic acid (F) and lipid (L) they include six experimental groups in total, point
It is not:CR (Chir99021, REPSOX);CRAS (Chir99021, REPSOX, AM580, SGC0946);CRV (Chir99021,
REPSOX, VC);CRF (Chir99021, REPSOX, folic acid);CRL (Chir99021, REPSOX, Lipid) and CRASF
(Chir99021, REPSOX, AM580, SGC0946, folic acid) group, partly amount changes liquid daily, is all made of TrypLE (Gibco) digestion
Cell.After the first generation, every 3-6d, by cell after passing on and being cultivated in 24 orifice plates, every group in triplicate.
3) PKH26 marks pig stem spermatogonium to carry out heterograft:Trypsin digestion and cell, by 2 × 107A cell adds
Enter in 15mL centrifuge tubes, 5min is centrifuged with 400 × g;Supernatant is removed, ensures that remaining liquid is less than 25 μ L in cell block;Add
Enter 1mL dilution C, before label, prepares 4 × 10-6The PKH26 dyestuffs (being diluted with diluent C) of M are placed in centrifuge tube, then
1mL cells are added in 1mL dyestuffs as early as possible, and sample is subjected to piping and druming mixing immediately, are incubated 2min in 25 DEG C later, are added
Isometric serum terminates reaction, is incubated 1min, 400 × g of cell, 25 DEG C centrifuge 10min, are then transferred to cell in new pipe simultaneously
Washing three times, ensures to remain without excess dyestuff, and centrifugation suspends again;With glass slide, a drop is added dropwise and is detected under fluorescence microscope
Labeling effciency.
Compared with prior art, the present invention has technique effect beneficial below:
1) it after the present invention is by screening different extracellular matrixs, is matched naturally as cell culture substrate, in body using 2D
Two different colony morphologies can be observed in incubation by the stem spermatogonium culture of pig to two months outside.It is a kind of with
Typical mouse embryo stem cell clone is similar, the AP positives is presented, when it is carried out subculture with different cultivating systems, still
AP positive compacts clone can be formed again.Another kind is typical grape beading stem spermatogonium cluster, the former is very likely
The new method of one boar multipotent stem cells acquisition is provided;
2) chemical small molecule substance is applied to the stem spermatogonium long-term cultivation of pig by the present invention for the first time, different by screening
Chemical small molecule combination, finally determine Chir99021, Repsox and CD lipids concentrate can make pig stem spermatogonium train
The foster time extended to three months from two months, and cell viability is preferable, still maintained the growth of epithelium shape, and kept preferably smart former dry thin
Born of the same parents' characteristic, cellular immunofluorescence result prove that it can still express typical stem spermatogonium label such as PGP9.5;
3) present invention determine that potential destiny after the stem spermatogonium heterograft to mouse convoluted seminiferous tubule of pig.It was found that
It in pSSCs heterografts to the testis of azoospermatism mouse, can be proliferated and self-renewing, maintain in sterile mouse seminiferous tubule
Its undifferentiated state, but meiosis further cannot downstream occur.Meiosis, which cannot be carried out, after pSSCs transplanting goes forward side by side one
Step form sperm in mouse convoluted seminiferous tubule, this may be due to the species variation between rodent and pig it is excessive caused by.
Description of the drawings
Fig. 1 pluripotency markers CDy1 detection separation pig stem spermatogonium positive rates
Fig. 2 shows that Peptide-coating 2D contribute to the characteristic of pig stem spermatogonium to maintain;
The label detection of Fig. 3 difference generation pig stem spermatogoniums;
The screening of Fig. 4 difference chemical small molecules combination extends pig stem spermatogonium incubation time;
Stem spermatogonium vigor after different chemical small molecules is added in Fig. 5 CCK8 detections;
Pig essence original is dry carefully after Fig. 6 cellular immunofluorescences detect addition Chir99021, REPSOX and lipid complex
The characteristic of born of the same parents;
Fig. 7 PHK26 mark stem spermatogonium effect detection;
Fig. 8 receives label red fluorescence observation after sample;
Pig stem spermatogonium characteristic after Fig. 9 paraffin section Immunofluorescence test heterografts.
Specific implementation mode
A kind of Spermatogonial Stem Cells of present invention offer are to match natural artificial synthetic polypeptide with 2D without feeder layer cultural method
As pig Spermatogonial Stem Cells culture substrate, it is found that it contributes to the maintenance of the male germ stem cells undifferentiated state of pig,
The stem spermatogonium culture of pig can be made to two months, further screen different chemical small molecule substances, it is final to determine
Chir99021, REPSOX and lipid complex combination contribute to the long-term cultivation of pig stem spermatogonium, can further by
The Spermatogonial Stem Cells culture of pig was to three months, and cell still keeps preferable vigor and Epithelial form to grow, and characteristic is good
Good, by it with after labeling dye PKH26 labels, after heterograft is in mouse convoluted seminiferous tubule, still holding is proliferated and self
Updating ability, but normal meiosis cannot be carried out.
The present invention matches natural artificial synthetic polypeptide matrix coating as a kind of extracellular matrix, to small point different of chemistry using 2D
Sub-portfolio is screened, by adding Chir99021, Repsox and CD lipid concentrates, by the Spermatogonial Stem Cells of pig
Culture was to three months.
The 2D matches the artificial synthesized polypeptide that natural artificial synthetic polypeptide matrix coating is a kind of commercialization, can answer
For stem cell without feeder layer culture.
The pig stem spermatogonium shows two kinds of colony morphologies, a kind of and mouse embryo stem cell in incubation
Clone similar, another kind is typical grape beading stem spermatogonium cluster, and it is dry that the former very likely provides a boar versatility
The new method that cell obtains.
The chemical small molecule includes Chir99021, Repsox and CD lipid concentrates etc., and pig essence can be made former dry
The cell culture time extended to three months from two months, and maintained preferable stem spermatogonium characteristic.
The Spermatogonial Stem Cells of pig of the present invention include the following steps without feeder layer cultural method:
1, the separation of pig testis primary cell:
It is adherent through difference twice in succession using two step enzyme digestions, it is rich to separation by multipotent stem cells dyestuff CDy1
Collect obtained pig stem spermatogonium identification.
2, the culture and passage of stem spermatogonium:
It when the stem spermatogonium stand density of pig reaches 80-90%, is passed on, first, gentle manipulation discards former training
Nutrient solution is then cleaned once with PBS, and the trypsase that 1-1.5mL 0.25% is added digests 3-5min in 37 DEG C, is used after taking-up
DMEM in high glucose (10%FBS) terminates digestion, and cell suspension is collected after soft piping and druming in centrifuge tube, and 1200rpm centrifuges 5min,
It is then resuspended with prepared pig stem spermatogonium culture solution, is inoculated in the culture dish anticipated.The cell culture
Plate is handled:Poly-D-lysine is coated with culture dish at least 4h, and culture plate is washed twice and spontaneously dried with PBS later.Gelatin
(0.1%) it is coated with culture dish 1h, then washed once for use with PBS.The coated tablet of laminin (10 μ L/mL) 1h.10μ
After L/mL laminins are coated with culture dish 1h, inoculating cell.2D match natural agent boxes contain component A and B.Add in cultivation plate hole
Enter liquid A and incubates 10min.After sucking liquid A, ingredient B is added, it is spare to incubate 1h.
3, the stem spermatogonium cultivating system of pig is:
10%KSR, 1%NEAA, 5%FBS, 0.1% is added for preparing 500mL complete mediums in DM/F12 basal liquids
Beta -mercaptoethanol (1000 ×), 1% L-Glutamine concentrate (100 ×), after being mixed well with magnetic stirring apparatus, in
0.22 μm of filter filtration sterilization, is sub-packed in the bottle of 20/50mL, and 4 DEG C of preservations sequentially add LIF, bFGF before each use,
EGF, GDNF, final concentration of 20ng/mL.
4, the chemical small molecule related generally in experiment includes:
Chir99021 (C), REPSOX (R), AM580 (A), SGC0946 (S), VC (V), folic acid (F) and lipid (L).
All groups are applied 2D to match natural coating as matrix coating.From various chemical small molecules combinations are added when cultivating 60d, always
Include six groups altogether, respectively:CR (Chir99021, REPSOX);CRAS (Chir99021, REPSOX, AM580,
SGC0946);CRV (Chir99021, REPSOX, VC);CRF (Chir99021, REPSOX, folic acid);CRL (Chir99021,
REPSOX, Lipid) and CRASF (Chir99021, REPSOX, AM580, SGC0946, folic acid) group, partly amount changes liquid daily.Adopt
With TrypLE (Gibco) vitellophag.After the first generation, every 3-6d, cell is cultivated after passage and in 24 orifice plates, every group of weight
Again three times.
Invention Spermatogonial Stem Cells specifically include following operating procedure without feeder layer cultural method:
1, PBS (dual anti-100X) is added in 50mL centrifuge tubes, is positioned in ice chest, 75% alcohol washes pig testis is primary,
It is then washed twice with the dual anti-PBS of addition, cuts off epididymis, fat etc., then cut off tunica albuginea, it is intermediate repeatedly to replace surgical instrument,
It leaves a part of sample to be fixed with PFA and (be used for embedded section), remaining testis tissue shreds in 60 ware of glass, addition appropriate IV
Collagenase Type (2mg/mL) is added 1 when tissue shear to exquisiteness and when being visible by naked eyes tissue block:1:1 type Ⅳ collagenase
(2mg/mL);Dnase(20μg/mL);Dispase (2mg/mL), 37 DEG C of digestion, midway are repeatedly rocked, are taken out after 15min, used
Pipette tips are chosen, until it is no longer sticky, it is transferred in 50mL centrifuge tubes, and about 30mL PBS are added, it is naturally heavy later to overturn mixing
5min drops, the liquid in addition to tissue block is transferred to new centrifuge tube by naked eyes visible bottom pink colour tissue block precipitation, 300g from
Heart 5min, abandons supernatant, and bottom white convoluted seminiferous tubule is cleaned centrifugation twice repeatedly with PBS, to remove interstitial cell and red thin
5mL pancreatin is then added in born of the same parents, blows and beats mixing, and 37 DEG C of incubators digest 5min, after taking-up, take a drop in training with 20 μ L liquid-transfering guns
It supports in ware, microscopy, when observing that 80% or more convoluted seminiferous tubule digests out, terminates digestion (serum or isometric training completely
Nutrient solution), supernatant is abandoned in centrifugation, and complete culture solution is resuspended, you can inoculated and cultured ware then carried out a difference patch every two hours
Wall, twice in succession;
2, culture dish is handled with different extracellular matrixes, includes mainly:Poly-D-lysine is coated with culture dish at least 4h, later
Culture plate is washed twice and spontaneously dried with PBS.Gelatin (0.1%) is coated with culture dish 1h, then washed once for use with PBS.
The coated tablet of laminin (10 μ L/mL) 1h.After 10 μ L/mL laminins are coated with culture dish 1h, inoculating cell.2D is matched
Natural agent box contains component A and B.Liquid A is added in cultivation plate hole and incubates 10min.After sucking liquid A, ingredient B, temperature is added
Educate that 1h is spare, be inoculated with respectively difference it is adherent after pig stem spermatogonium.
3, in conjunction with versatility dyestuff CDy1 positive rates count, determine isolated pig stem spermatogonium ratio be 80% with
On.The stem spermatogonium long-term cultivation that pig is carried out using 2D match natural agent boxes, in conjunction with immunofluorescence and sxemiquantitative to smart former dry
Cell specific marker is detected, and discovery can be by the Spermatogonial Stem Cells culture of pig to 2 months, on this basis, into one
Step screens some chemical small molecule substances, finally found that being applied in combination for Chir99021, Repsox and CD lipid concentrate can
So that pig stem spermatogonium incubation time extended to three months from two months, and maintain preferable stem spermatogonium characteristic.
4, by the way that its potential Development And Differentiation potential will be explored in the spermatogonial stem cell transplantation of pig to mouse convoluted seminiferous tubule.It is main
Two groups of cells are transplanted, the pig stem spermatogonium respectively just isolated and purified (adds with trimestral pig stem spermatogonium is cultivated
Add Chir99021, Repsox, lipid complex group).Before cell is injected testis, supplied to show in receptor convoluted seminiferous tubule
The positioning of body cell, using red fluorescence dyestuff (PKH26;Sigma the stem spermatogonium of pig) is marked.
Embodiment:
Below by way of to pig stem spermatogonium be separately cultured identification and cell morphological characteristic, marker gene and
The experiments such as identified by immunofluorescence elaborate, and the explanation of the invention is not limited.
1, the separation and purifying of pig stem spermatogonium
The Guanzhong Black Pig testis of 20 ages in days is picked up from Yangling District peasant household, versatility dyestuff adherent by difference twice in succession
CDy1, which is identified, finds that stem spermatogonium positive rate is 80% or more (Fig. 1).
2, the screening of different extracellular matrixes:
The main screening for including four kinds of matrix, poly-D-lysine are coated with culture dish at least 4 hours, later use culture plate
PBS is washed twice and is spontaneously dried.Gelatin (0.1%) is coated with culture dish 1 hour, then washed once for use with PBS.Layer adhesion egg
White coated tablet (10 μ L/mL) 1 hour.10 μ L/mL laminins were coated with culture dish after 1 hour, inoculating cell.2D matches day
Right kit contains component A and B.Liquid A is added in cultivation plate hole to incubate 10 minutes.After sucking liquid A, ingredient B is added, incubates
1 hour spare.The pig stem spermatogonium isolated and purified is inoculated on the culture plate handled well, is cultivated;It uses
Medium component is:DM/F12 basal liquids are used to prepare 500mL complete mediums, and 10%KSR, 1%NEAA, 5%FBS is added,
0.1% beta -mercaptoethanol (1000 ×), 1% L-Glutamine concentrate (100 ×), is mixed well with magnetic stirring apparatus
Afterwards, it in 0.22 μm of filter filtration sterilization, being sub-packed in the bottle of 20/50mL, 4 DEG C of preservations sequentially add LIF before each use,
BFGF, EGF, GDNF, final concentration of 20ng/mL.Alkaline phosphatase positive clone can preferably tie up on 2D match natural substrates
Its undifferentiated state (Fig. 2) is held,
Pig stem spermatogonium label PGP9.5 to cultivating different generations is detected, according to the pig in GENEBANK
PGP9.5cDNA sequences, designing PGP9.5 primer sequences with PRIMER is:
Sense primer:GATGCTGAACAAAGTGTTGG
Downstream primer:GAGTTTCCGATGGTCTGCTT
1.1.1.PCR response procedures are:
It was found that its expression is good (Fig. 3).
3, the screening of different chemical small molecule combinations:
The stem spermatogonium culture of pig to three months and can be maintained preferable characteristic on 2D match natural substrates, in this base
On plinth, different chemical small molecule combinations (Fig. 4) is screened, pig stem spermatogonium can be preferably observed in conjunction with Giemsa staining
Form.
4, the CHARACTERISTICS IDENTIFICATION of pig stem spermatogonium.
Cell viability detection (Fig. 5) further is carried out to the different groups of cells for being added to chemical small molecule, utilizes CCK-
8Cell Counting Kit detection kits are as follows with reference to its specification concrete operations:
(1) cell inoculation:5 repetitions of every group of inoculation in 96 orifice plates are required to specifications, and 5000 cells are inoculated with per hole,
Stationary culture in 37 DEG C of incubators.In addition prepare blank well zeroing to use.
(2) small molecule stimulates:After inoculating cell is adherent overnight, the complete medium containing different small molecules, processing is added
24h。
(3) dyeing liquor is prepared:+ 10 μ L CCK-8 premix dyeing of 100 μ L DM/F12 complete mediums is added according to every hole
Liquid.
(4) CCK-8 is incubated:Old culture medium is abandoned, PBS is washed 1 time, and 110 μ L dyeing liquors are added per hole, put back in 37 DEG C of incubators
It is incubated 1h.
(5) OD values measure:Each hole light absorption value is measured under 450nm wavelength.The repeating hole each handled takes its average value.
(6) cell viability calculates:Cell viability=(processing group cell OD- blank group OD)/(cellular control unit OD- blank
Group OD) × 100%.
5, cellular immunofluorescence detects pig stem spermatogonium feature.
Reason group cell abandons culture medium everywhere in 48 orifice plate cultures, and PBS is cleaned 1 time, and 250 μ L, 4% paraformaldehydes are added per hole
Fixer room temperature fixes 15min.Fixer is abandoned, PBS is cleaned 3 times, and 250 μ L 0.1%TritonX-100 room temperature cell membranes are added
Punching 10min (skips this step) if detection target protein if cell membrane localization.PBS is cleaned 3 times, and 250 rooms μ L 1%BSA are added
Temperature closing 30min.Confining liquid is abandoned, the primary antibody that 100 μ L have diluted, 4 DEG C of overnight incubations are added.Primary antibody is abandoned, PBS is cleaned 3 times, according to
The corresponding fluorescent marker secondary antibodies diluted of 100 μ L, 37 DEG C of incubation 1h are added in primary antibody source.Secondary antibody is abandoned, PBS is cleaned 3 times,
250 μ L, 1 μ g/mL Hoechst33342 dye liquors are added, room temperature is protected from light 5min.PBS is cleaned 3 times, note of taking a picture under fluorescence microscope
Record.Concrete outcome as shown in figure 6, adds training after chemical small molecule substance C hir99021, REPSOX and lipid complex
It supports three months, pig stem spermatogonium still can express marker such as CD90, CD49f, PGP9.5 etc..
6, phospholipid bilayer combination dye PKH26 marks the pig stem spermatogonium of long-term cultivation.
By the way that its potential Development And Differentiation potential will be explored in the spermatogonial stem cell transplantation of pig to mouse convoluted seminiferous tubule.Mainly
Two groups of cells are transplanted, the pig stem spermatogonium respectively just isolated and purified (is added with trimestral pig stem spermatogonium is cultivated
Chir99021, Repsox, Lipid group).Before cell is injected testis, in order to show donorcells in receptor convoluted seminiferous tubule
Positioning, we use with red fluorescence dyestuff (PKH26;Sigma the stem spermatogonium for) marking pig, marks result such as (Fig. 7)
Shown, it is trypsin digestion and cell that PKH26, which marks pig stem spermatogonium operating process, by 2 × 10715mL is added in a cell
In centrifuge tube, centrifuged 5 minutes with 400 × g.Supernatant is removed, ensures that remaining liquid is less than 25 μ L in cell block.1mL is added
Dilution C before label, prepares 4 × 10-6The PKH26 dyestuffs (being diluted with diluent C) of M are placed in centrifuge tube.Then as early as possible will
1mL cells are added in 1mL dyestuffs, and sample is carried out piping and druming mixing immediately, are incubated 2 minutes in 25 DEG C later, the bodies such as addition
Hematocele terminates clearly reaction, is incubated 1 minute, and 400 × g of cell, 25 DEG C centrifuge 10 minutes, and then cell is transferred in new pipe and is washed
It washs three times, ensures to remain without excess dyestuff, centrifugation suspends again.With glass slide, a drop is added dropwise and detects mark under fluorescence microscope
Remember efficiency.
7, convoluted seminiferous tubule transplanting and the observation of frozen section result
Experiment mice weight is in 25g between 30g, after handling surrounding modeling through busulfan, by what is marked with PKH26
PSSC is injected into seminiferous tubule, and every mouse transplants 200,000 cells, and every group has 7 repetitions to be sampled after eight weeks.It is fresh
Testis sample fixed with 4% PFA, 30% sucrose is dehydrated 48h, is embedded with embedding medium in -25 DEG C, in freezing microtome
Slice, is attached at adherency glass slide, and after being placed at room temperature for 3 minutes, PBS is cleaned 3 times, every time 5 minutes.Hoechest33342 dyes are thin
Karyon about 3 minutes, PBS cleanings 2 times, 5 minutes every time, mounting, under the microscope (Fig. 8) in fluorescence microscopy.
8, Characteristics Detection after heterograft
After receiving sample, paraffin section Immunofluorescence test is carried out, detailed process is as follows:
Piece is dried through 60 DEG C 4-8 hours, and dimethylbenzene I dewaxes 8 minutes (being heated to 40-60 DEG C), and dimethylbenzene II dewaxes 8 minutes.
Graded ethanol rehydration:100% alcohol 6 minutes, 95% alcohol 6 minutes, 75% alcohol 6 minutes, distilled water 2 minutes.Carry out antigen
It repairs:The citric acid antigen that slice is placed in 0.1mol/L and ph=6.0 is repaired in liquid, and 10 minutes are heated extremely with microwave ingle
Pico- boiling, then low firepower maintains 10 minutes in using stops natural cooling 20-30 minutes after heating.With PBS 2 minutes × 2 times,
The PBS outside sample is wiped with filter paper.1%BSA is added dropwise to close 30 minutes for 37 DEG C in wet box.Confining liquid is wiped with filter paper, is not washed.
The primary antibody that suitable concentration is added dropwise sets in wet box 4 DEG C of overnight incubations, then with PBS 3 minutes × 5 times, washes away primary antibody, is wiped with filter paper
PBS outside sample.Dropwise addition fluorescence secondary antibody room temperature, which is set, is protected from light incubation 1-1.5 hours in wet box.With PBS 3 minutes × 3 times, two are washed away
It is anti-, the PBS outside sample is wiped with filter paper.Hoechst33342 is added dropwise and is protected from light incubation 2 minutes, aobvious core, blue can be carried out to sample
Fluorescence.Hoechst33342 is washed away with PBS 1 minute × 3 times, and the PBS outside sample is wiped with filter paper.Finally quenched with containing anti-fluorescence
Go out the mounting fluid-tight piece of agent, and is observed immediately under fluorescence microscope.
Immunofluorescence results are shown, after the stem spermatogonium for transplanting pig, cell arrangement in the convoluted seminiferous tubule of mouse with just
Normal mouse tube chamber is completely different, has lost the structure of normal spermatogenic cells at different stages ordered arrangement, and can not observe
Sperm exists.Most of donorcells are reproduction cell label VASA protein positives, and apparent cell string can be observed, show
Go out the spermatogonium form (Fig. 9) of differentiation.