CN105695340A - Aspergillus oryzae and application thereof - Google Patents
Aspergillus oryzae and application thereof Download PDFInfo
- Publication number
- CN105695340A CN105695340A CN201610122690.7A CN201610122690A CN105695340A CN 105695340 A CN105695340 A CN 105695340A CN 201610122690 A CN201610122690 A CN 201610122690A CN 105695340 A CN105695340 A CN 105695340A
- Authority
- CN
- China
- Prior art keywords
- aspergillus oryzae
- naringinase
- naringin
- enzyme
- fermentation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/66—Aspergillus
- C12R2001/69—Aspergillus oryzae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2445—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01021—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/0104—Alpha-L-rhamnosidase (3.2.1.40)
Abstract
The invention relates to aspergillus oryzae and application thereof and belongs to the technical field of microbial fermentation. The aspergillus oryzae is named aspergillus oryzae 11250, and the preservation number is CGMCC NO.11320. The activity of naringinase in liquid fermentation broth of the aspergillus oryzae reaches 251 U/mL, the activity of total naringinase after purification can reach 12,052 U, and the specific enzymatic activity reaches 2,198 U/mg; the fermentation broth of the aspergillus oryzae also contains naringin and naringenin which is a naringin hydrolysis substrate; naringenin is a flavonoid substance and has the healthcare effects of reducing blood pressure, removing toxicity, promoting diuresis, resisting bacteria and the like. Besides, orange peel serves as a fermentation substrate of the aspergillus oryzae, household refuse waste is fully utilized, and cost is reduced. The molecular weight of naringinase produced by the aspergillus oryzae is 48 kDa, the optimum action temperature is 45 DEG C, and the optimum pH is 5.0. Furthermore, the aspergillus oryzae 11250 has the advantages that the enzyme output is high, produced naringinase is an extracellular enzyme, there is no need to adopt an ultrasonic wall-breaking mode and the like to release an intracellular enzyme, enzyme activity losses are reduced, and therefore cost in industrial application is greatly reduced.
Description
Technical field
The present invention relates to a kind of aspergillus oryzae and application thereof；Belong to technical field of microbial fermentation。
Technical background
Naringinase is a kind of important enzyme being hydrolyzed for bitter substance in fruit juice, it is by alpha-L-Rhamnosidase (α-L-rhamnosidase, EC3.2.1.40) with β-D-Glucose glycosides enzyme (β-D-glucosidase, EC3.2.1.21) a kind of glycoside hydrolysis compound enzyme system formed, there is alpha-L-Rhamnosidase and the activity of β-D-Glucose two kinds of enzymes of glycosides enzyme simultaneously, naringinase can act on the naringin of bitterness and is hydrolyzed generation Flavonoid substances, process is: naringin first generates rhamnose and Pu Luning (Prunin under alpha-L-Rhamnosidase effect, translations prunin again), the bitterness of Pu Luning is about 1/3rd of naringin, therefore bitterness alleviates to some extent, then general Shandong would rather be broken down into the flavonoid of the peel of pomelo material (being mainly naringin) without bitterness under the effect of β-D-Glucose glycosides enzyme。The microbe-derived aspect of naringinase is concentrated mainly on mycete (aspergillus niger and penicillium sp etc.), and the relevant report of Production by Bacteria naringinase is less。
China is Orange Producing big country, but the processing industry subject matter at present at orange juice is exactly the deep processing and utilization problem of peel。Containing abundant flavonoid of the peel of pomelo (being mainly naringin), pectin, dietary fiber etc. being taken as rubbish to process the peel of Citrus reticulata Blanco dropped in a large number, if being made full use of, ambient pressure can not only be alleviated, it is also possible to bring benefit to the mankind。Modern pharmacology research finds; flavonoid of the peel of pomelo has multiple physiologically active: the fragility of scalable blood capillary and permeability, cardioprotection, has the effects such as antiulcer, removing toxic substances, diuresis, antibacterial, antiinflammatory heat clearing away; also it is a kind of efficient Natural antioxidant, is a kind of natural health promoting product。Therefore the deep processing of Pericarpium Citri grandis will be greatly improved the income of orchard worker, improve the added value etc. of Fructus Citri grandis。
Although the research of naringinase is more and more deep, but the production only having minority naringinase at present achieves industrialization, there are two problems in the heavy industrialization application aspect limiting naringinase at present: first subject matter is that China lacks the high bacterium producing multi enzyme preparation being suitable for industrialized production, and this just strongly limit application；The cultivation where the shoe pinches of high naringinase-producing strain is in that how to select high efficiency for outstanding mutant in substantial amounts of mutagenic progeny, up to the present there is no good way, the Breeding Progress of bacterial strain is slow, the efficient screening technique that development makes new advances is necessary, and therefore the cultivation to superior strain is the current task of top priority。Second Problem is that naringin fixation techniques for enzyme there is also a lot of defects at home, there is high expensive in the reagent or the carrier that use in immobilization, immobilization efficiency is low, less stable, the equipment that continuous operation uses is more complicated etc., this is accomplished by process for fixation more applicable while that our country developing easier further, naringinase is applied to the de-hardship relevant report existing with processing foreign of mandarin orange and other goods, but do not apply aborning on a large scale at China's naringinase, main cause is domestic to there is no commodity naringinase prepared by scale and sell, we should strengthen the method about breeding high-yield naringinase bacterial strain from now on, and the pure enzyme of naringinase preparing low cost, there is important practical significance。
Compared with producing naringinase with bacterial liquid fermentation, mycete liquid fermentation produces naringinase and mostly is exoenzyme, it is not necessary to adopt the modes such as ultrasonication to discharge endocellular enzyme, decreases enzyme loss alive, thus the cost reduced in commercial Application；It addition, mycete produces zymologic property many slant acidity conditional stability of naringinase, this de-hardship etc. being more suitable for industrial fruit juice is applied, and obtained researcher in recent years and more pays close attention to。But, the naringinase activity that mycete produces has the disadvantage in that and has been found that naringinase producing strains kind is less and lacks superior strain；Naringinase fermentation efficiency is on the low side, production cost is high for mycete product；Domestic but without the commercial enzyme preparation that can be used for industrialized production in a large number；Naringinase structural research is less。
Summary of the invention
The present invention studies by experiment, and separation and Culture has gone out a kind of aspergillus oryzae that can produce naringinase。The aspergillus oryzae of the present invention, in its liquid fermentation liquid, naringinase vigor reaches 251U/mL, and after purification, the total enzyme activity of naringinase can reach 12052U, and specific enzyme activity power reaches 2198U/mg；Its fermentation liquid is possibly together with naringin and naringin hydrolysis substrate naringenin；Naringenin is Flavonoid substances, has blood pressure lowering, removing toxic substances, diuresis, the health-care effect such as antibacterial。It addition, the aspergillus oryzae of the present invention is with orange peel for fermentation substrate, take full advantage of house refuse garbage, save cost。The naringinase that the aspergillus oryzae of the present invention produces, molecular weight is 48kDa, optimum operative temperature, pH respectively 45 DEG C, 5.0。Compared with the naringinase produced before the present invention, by antibacterial and mycete, there is following special character: the naringinase that the aspergillus oryzae of the present invention produces keeps enzyme activity stable in acid condition, it has better application prospect in fields such as the acidic juice of commercial application prospect are de-bitter, measure through efficient liquid phase simultaneously and play an important role in improving local flavor vinous, provide important evidence to separate purification and the property Quality Research of naringinase for preparing the commercial enzyme better industrially applied。
Technical scheme
A kind of aspergillus oryzae, called after aspergillus oryzae 11250, its preserving number is CGMCCNO.11320。
The aspergillus oryzae 11250 of the present invention, can produce naringinase。Specifically, aspergillus oryzae 11250 can ferment with the fermentation substrate containing orange peel and produce the fermentation liquid containing naringinase；Possibly together with naringin and naringenin in fermentation liquid。The naringinase molecular weight that the present invention obtains is 23kDa, optimum operative temperature, pH respectively 45 DEG C, 5.0；Can being hydrolyzed naringin, neohesperidin, Hesperidin, skin glycosides, rutin and p-nitrophenyl rhamnoside, be used for reducing in fruit juice bitter substance produces the contour reactive yellow ketone compounds of naringenin, hesperetin and Pi Su simultaneously。It addition, the advantage that the aspergillus oryzae 11250 of the present invention has " produce enzyme level height, produced naringinase is exoenzyme, it is not necessary to the modes such as employing ultrasonication discharge endocellular enzyme, decrease enzyme loss alive, thus reducing the cost in commercial Application greatly "。
Therefore, present invention also offers aspergillus oryzae 11250 and produce slant medium used by the purposes of naringinase, fermentation generation naringinase and seed culture medium and the method producing naringinase。
The application of the aspergillus oryzae 11250 of the present invention, produces naringinase。
The aspergillus oryzae 11250 of the present invention produces slant medium used by naringinase and seed culture medium:
Slant medium: pH is 6.0, containing following component: MgSO in every 1L40.5g、KH2PO41.5g、CaCl20.1g, (NH4)2SO41.5g、KCl0.5g、KNO31.5g, yeast extract 2g, orange meal 15g, agar 20g, water surplus；
Seed culture medium:
PH is 7.5, containing following component in every 1L: maltose 15.1g, tryptone 10g, (NH4)2HPO420g, NaCl10g, naringin 10g, yeast extract 5g, water surplus；
Or, pH is 6.0, containing following component: MgSO in every 1L40.5g、KH2PO41.5g、CaCl20.1g, (NH4)2SO41.5g、KCl0.5g、KNO31.5g, yeast extract 2, orange meal 7.5g, water surplus。
The method that the aspergillus oryzae 11250 of the present invention produces naringinase, comprises the following steps:
(1) aspergillus oryzae 11250 is carried out slant culture, obtain slant strains；
(2) taking slant strains and be inoculated into seed culture medium, the condition bottom fermentation at 30 DEG C, 180rpm cultivates 48-96h, obtains fermentation liquid；
Slant medium:
PH is 6.0, containing following component: MgSO in every 1L40.5g、KH2PO41.5g、CaCl20.1g, (NH4)2SO41.5g、KCl0.5g、KNO31.5g, yeast extract 2g, orange meal 15g, agar 20g, water surplus；
Seed culture medium:
PH is 7.5, containing following component in every 1L: maltose 15.1g, tryptone 10g, (NH4)2HPO420g, NaCl10g, naringin 10g, yeast extract 5g, water surplus；
Or, pH is 6.0, containing following component: MgSO in every 1L40.5g、KH2PO41.5g、CaCl20.1g, (NH4)2SO41.5g、KCl0.5g、KNO31.5g, yeast extract 2, orange meal 7.5g, water surplus。
The inoculum concentration of slant culture and fermentation culture can be obtained by prior art, does not need to pay performing creative labour。The inoculum concentration of slant culture can reach the seed liquor of inoculum concentration needed for fermentation culture, and the inoculum concentration of fermentation culture is generally 0.2%(V/V)。
Said method, namely gained fermentation liquid contains naringinase；Naringinase vigor reaches 251U/mL。Gained fermentation liquid can pass through centrifugation, ammonium sulfate precipitation, QSepharoseFastFlow ion-exchange chromatography, SephacrylS-200 gel permeation chromatography, and the rate of being recycled is the pure naringinase of electrophoresis of 32。Gained naringinase is purification be 26.78 the pure naringinase of electrophoresis；Total enzyme activity can reach 8512U, and specific enzyme activity power reaches 2194U/mg。Wherein, centrifugation, ammonium sulfate precipitation, QSepharoseFastFlow ion-exchange chromatography, SephacrylS-200 gel permeation chromatography are routine operation。
In the present invention, for the percentage ratio of the content of certain composition, if not otherwise specified, percentage by weight (w/w) is referred both to。
Technical term used by the present invention illustrates:
1U refers to the naringin enzyme amount required for decomposition 1 μ g naringin substrate per minute, is called that a naringinase enzyme is lived。
Beneficial effect
(1) compared with the aspergillus oryzae of existing product naringinase, the aspergillus oryzae of the present invention has following special character: the naringinase produced has can be hydrolyzed naringin, neohesperidin, Hesperidin, skin glycosides, rutin and p-nitrophenyl rhamnoside, is used for reducing in fruit juice bitter substance and produces the contour reactive yellow ketone compounds of naringenin, hesperetin and Pi Su simultaneously；
(2) produce what special character fermentation substrate used by naringinase has: orange peel used by this fermentation is life garbage waste material, save fermentation costs
(3) in fermentation liquid, enzyme is lived and is significantly improved 180%, and naringinase yield is to significantly improve；
(4) advantage having " produce enzyme level height, produced naringinase is exoenzyme, it is not necessary to the modes such as employing ultrasonication discharge endocellular enzyme, decrease enzyme loss alive, thus reducing the cost in commercial Application greatly "。
Preservation information
China Committee for Culture Collection of Microorganisms of depositary institution common micro-organisms center
Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, address 3 Institute of Microorganism, Academia Sinica
Preservation date on 09 23rd, 2015
Deposit number CGMCCNO.11320
Classification And Nomenclature aspergillus oryzae (Aspergillusoryzae)。
Accompanying drawing explanation
Fig. 1 is aspergillus oryzae 11250 cultural characteristic after different culture media cultivates 7d,
Fig. 2 is the morphological feature of aspergillus oryzae 11250,
Fig. 3 is the pcr amplification product electrophoretogram (adopting the amplification that this general primer of ITS carries out) of aspergillus oryzae 11250, and 1 is DNA standard substance；2,3,4 is pcr amplification product；
Fig. 4 is the 18SrDNA phylogenetic tree based on ITS district of aspergillus oryzae 11250；
Fig. 5 is the high-efficient liquid phase chromatogram of aspergillus oryzae 11250 fermentation liquid,
Fig. 6 is that aspergillus oryzae 11250 produces naringinase SDS-PAGE result, in figure: M-standard protein sample；The protein band of 1-crude enzyme liquid；The protein band of 2-50 ~ 70% ammonium sulfate precipitation concentration gained；The protein band that 3-obtains through QSepharoseFastFlow ion-exchange chromatography；The protein band that 4-obtains through SephacrylS-200 gel permeation chromatography；
Fig. 7 is that aspergillus oryzae 11250 produces the naringinase enzymolysis HPLC to naringin and schemes,
Fig. 8 is that aspergillus oryzae 11250 produces the naringinase enzymolysis HPLC to neohesperidin and schemes,
Fig. 9 is that aspergillus oryzae 11250 produces the naringinase enzymolysis HPLC to Hesperidin and schemes,
Figure 10 is that aspergillus oryzae 11250 produces the naringinase enzymolysis HPLC to p-nitrophenyl-alpha-L-rhamnoside and schemes,
Figure 11 is that aspergillus oryzae 11250 produces the naringinase enzymolysis HPLC to skin glycosides and schemes,
Figure 12 is that aspergillus oryzae 11250 produces the naringinase enzymolysis HPLC to rutin and schemes；
In Fig. 7-12, Naringinase, β-L-Rhammosidase is naringinase；Naringin is naringin；Neohesperidin is neohesperidin；Hesperidin is Hesperidin；4-Nitrophenyla-L-rhamnopyranoside(RNP-Rha) for p-nitrophenyl-alpha-L-rhamnoside；Quercitrin is skin glycosides；Rutin is rutin。
Detailed description of the invention
In all specific embodiments described below, if no special instructions, it is method commonly used in the art。Unreceipted concrete technology or condition person in embodiment, technology described by the document in this area or condition (such as: with reference to Puri et al. document) or carry out according to product description。Agents useful for same or the unreceipted production firm person of instrument, be can pass through city available from conventional products。
Embodiment 1 aspergillus oryzae 11250 screening and separating and qualification
One, aspergillus oryzae (Aspergillusoryzae) 11250 screening and separating
Weigh 2g to gather and vibrate in the 100mL conical flask equipped with the 18mL normal saline of sterilization treatment 30min from soil sample in all parts of the country, conical flask is preferably put a little bead。Then being diluted to volumetric concentration respectively with sterilized water is 1 × 10-3、1×10-4The diluent of two gradients, draws 100 μ L diluents with the rifle head of sterilizing respectively and coats preparation and the selectivity plating medium of sterilizing in advance (composition of described selectivity plating medium is (g/L): MgSO40.5, KH2PO41.5, CaCl20.1, (NH4)2SO41.5, KCl0.5, KNO31.5, yeast extract 2, orange meal 7.5, agar 20, water surplus) in, cultivate 48-96h in 30 DEG C。From selectivity plating medium, line separates single bacterium colony, and the part film-making microscopy in single bacterium colony of picking judges bacterial strain purity (it is same morphological characteristic that microscope observes thalline, for pure bacterium colony)。If not pure bacterium colony, repeated multiple times line single bacterium colony should be separated, till obtaining pure bacterium colony。Simultaneously, the selectivity plating medium of isolated pure bacterium colony drips diglycol (DES) reagent (dropping 15mL), observes transparent circle phenomenon, the bacterial strain having transparent circle is picked out, with slant medium, (slant medium pH is 6.0, containing following component: MgSO in every 1L40.5g、KH2PO41.5g、CaCl20.1g, (NH4)2SO41.5g、KCl0.5g、KNO31.5g, yeast extract 2g, orange meal 15g, agar 20g, water surplus；) preserve, obtain the bacterial strain inclined-plane pure culture body the having transparent circle basis as follow-up multiple sieve。
Follow-up multiple sieve: the bacterial strain having transparent circle is carried out shake-flask culture, chooses the big bacterial strain of transparent circle as aimed strain；The nutritional labeling of Shake flask medium used is (g/L): MgSO40.5, KH2PO41.5, CaCl20.1, (NH4)2SO41.5, KCl0.5, KNO31.5, yeast extract 2, orange meal 7.5, water surplus；PH6.0。
Two, aspergillus oryzae 11250(Aspergillusoryzae) identify
1. morphological characteristic
By aimed strain dibbling (dibbling: after the Inoculating needle after sterilizing is connect bacterium from inclined-plane, point sample makes it grow from central point in the center of culture medium flat plate) in CA culture medium (Cha Shi agar culture medium), CYA culture medium (Cha Shi yeast extract culture medium), MEA culture medium (m alt extract agar culture medium), 3 kinds of standards of G25N culture medium (25% glycerin medium) identify culture medium, respectively 4, 25, cultivate at 36 DEG C, observe the speed of colony growth, diameter, colony edge feature, the thickness of bacterium colony and degree of compaction, mycelium feature, the feature such as quality and color, comparison Fungal identification handbook compares, result is in Table 1。
Electron microscope observation: (pH6.0, containing following component: MgSO in every 1L in base plate culture medium by bacterial strain dibbling40.5g、KH2PO41.5g、CaCl20.1g, (NH4)2SO41.5g、KCl0.5g、KNO31.5g, yeast extract 2, orange meal 7.5g, water surplus), 30 DEG C of inserted sheets cultivate (inserted sheet is cultivated: inserts the plating medium being connected to bacterium colony by oblique for the microscope slide after sterilizing 45 ° and makes its part mycelium along microscope slide growth to observe thalli morphology at microscope), observe morphological characteristic, cut 3-4mm2And with the agar block of conidium structure, put in aseptic small container together, add 2% appropriate glutaraldehyde solution, fixing 1-2 hour, sucking-off fixative, adding ethanol serial dehydration step by step, the concentration of alcohol (v/v) of dehydrant is followed successively by the dehydration step by step of 30%-50%-70%-95%-100% ethanol；Each serial dehydration twice, stops 5-10 minute every time, is dried by sample, carries out vacuum metal spraying and SEM(scanning electron microscope afterwards) microscopy (as shown in Figure 1)。
Can drawing according to table 1 and Fig. 1, aimed strain is aspergillus oryzae, called after: aspergillus oryzae 11250。
The composition that above-mentioned culture medium flat plate is cultivated:
(1) CA culture medium (Cha Shi agar culture medium): NaNO30.3g/L、K2HPO40.1g/L、KCl0.05g/L、MgSO47H2O0.05g/L、FeSO47H2O0.001g/L, sucrose 3g/L, agar 1.5g/L, H2O surplus；
(2) CYA culture medium (Cha Shi yeast extract culture medium): NaNO30.3g/L、K2HPO40.1g/L、KCl0.05g/L、MgSO47H2O0.05g/L、FeSO47H2O0.001g/L, yeast extract 0.5g/L, sucrose 3g/L, agar 1.5g/L, H2O surplus；
(3) MEA culture medium (m alt extract agar culture medium): Fructus Hordei Germinatus extract 2g/L, peptone 0.1g/L, glucose 2g/L, agar 1.5g/L, H2O surplus；
(4) G25N culture medium (25g/L glycerin medium): NaNO30.3g/L、K2HPO40.1g/L、KCl0.05g/L、MgSO47H2O0.05g/L、FeSO47H2O0.001g/L, yeast extract 0.5g/L, agar 1.5g/L, glycerol 333g, H2O surplus。
Table one bacterial strain 11250 cultural characteristic after different culture media is cultivated
| Cultivate Base | Bacterium colony 7d diameter | Color characteristic | Colony characteristics |
| CA | 4.19cm | Front white, back side white | Bacterium colony is relatively thin, smooth, and quality is velvet-like and sparse, without transudate, without endless belt, without conidium |
| CYA | 4.25cm- 5.31cm | Front middle green or white, an outside circle is yellow, and edge is white, the inclined Chinese red in the back side, Edge is faint yellow | Rapidly, bacterium colony is thicker, and quality is velvet-like and tight, has arborizations, has endless belt in growth, has multiple conidium, without oozing Go out liquid |
| MEA | 5.31cm | Center green, edge white, the deep yellow colour cast in the back side is green, edge white, has obvious endless belt | Bacterium colony is thicker, and quality is cotton-shaped and tight, has obvious projection 0.7-0.8cm, without transudate, produces numerous mitogenetic spore Son |
| G25N | 2.00cm | Front white, there is yellow point at center, and the back side is faint yellow, middle buff partially | Mycelia is relatively thin, and quality is velvet-like and sparse, without transudate, without endless belt, and the scattered radial little bacterium in oriented one end Fall。 |
2.18SrDNA sequence analysis:
Few sequence nucleotide primer is fungus pcr amplification universal primer:
Forward primer ITS1:5'-TCCGTAGGTGAACCTGCGG-3', as shown in SEQIDNO.1；
Downstream primer ITS4:5'-TCCTCCGCTTATTGATATGC-3'；As shown in SEQIDNO.2；
Round pcr is utilized to expand the 18SrDNA of the aimed strain obtained；
The concrete operations of pcr amplification reaction are as follows:
Reaction system is sequentially added into PE tubule；Open PCR amplification instrument amplification；Instrument is closed after completing reaction；Take out reactant liquor and carry out agarose gel electrophoresis inspection DNA amplification；
Various reagent and consumption involved by pcr amplification reaction system: pcr amplification reaction system: 0.5 μ L template DNA, 1.0 μ LdNTP, 0.5 μ LTaq enzyme, each 1.0 μ L of primer, moisturizing is to 50 μ L。
Pcr amplification reaction condition: 94 DEG C of preheating 4min, each circulation includes: 94 DEG C of degeneration 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 6min, 30 circulations, finally again with 72 DEG C, 10min。
Pcr amplification product is order-checking after agarose gel electrophoresis is checked, and the ITS district gene order total length of aspergillus oryzae 11250 is 583bp, and DNA sequence table is: SEQIDNO:3；Amplified production electrophoretogram is as shown in Figure 3。
3. the sequence analysis of the 18SrDNA of aspergillus oryzae 11250 and phylogenetic tree
The ITS district gene order of this amplified production gene order with the aspergillosis related strain in GenBank data base is compared, sequence alignment is carried out with MEGA6 software, adopt contiguous phase connection (Neighbor-joining, NJ) phylogenetic tree construction, through 1000 stochastic sampling, calculate Bootstrap value, constructed phylogenetic tree such as Fig. 4。The bacterial strain of this product naringinase has been identified by phylogenetic tree further that build aspergillus oryzae 11250 from molecular level, as can be seen from the figure 11250 reach 98% with type strain AB008417 homology, and the bacterial strain ecology cultural characteristic synthesis measuring before being aided with more can improve the precision identifying that it is aspergillus oryzae。
Embodiment 2 is containing the preparation of naringinase, aspergillus oryzae 11250 liquid fermentation liquid
(1) slant culture: aspergillus oryzae 11250 is inoculated on slant medium, cultivates 48 hours at 40 DEG C, obtains inclined-plane bacterial strain。Slant medium used is: MgSO40.5、KH2PO41.5、CaCl20.1, (NH4)2SO41.5, KCl0.5, KNO31.5, yeast extract 2, orange meal 15, agar 20, water surplus, (g/L)；PH6.0,1 × 105Pa sterilizing 20min。
(2) liquid shake-flask fermentation: by inclined-plane bacterial strain with 0.2%(V/V) inoculum concentration be inoculated in liquid submerged culture base, cultivation temperature 30 DEG C, shaking speed 180r/min, trainingSupportTime 96h；Obtain fermentation liquid。Liquid submerged culture base is: maltose concentration 2, beef extract-peptone 3, MgSO40.5、KH2PO41.5、CaCl20.1, (NH4)2SO41.5、KCl0.5、KNO31.5, yeast extract 2, orange meal 7.5, water surplus, (g/L)；PH5.7,1 × 105Pa sterilizing 20min。
(3) composition of fermentation liquid is confirmed
By the composition of Fermentation Liquor by High Performance Liquid Chromatography, location parameter is: detection wavelength 280nm, 30 DEG C, liquid phase post ZORBAXEclipsePlusC184.6*100mm, water: methanol=1:1；Measurement result is as shown in Figure 5；
(4) mensuration of naringinase enzyme activity: adopt improvement Davis method；Adding the content of naringin in naringin titer 2mL(naringin titer in test tube is 1g/L), in the acetate buffer solution 1.9mL(acetate buffer solution of pH5.5 the content of acetic acid be 0.2mol/L), 40 DEG C of thermostat water baths preheat 5min, add the fermentation liquid of 0.1mL step (2), 40 DEG C of isothermal reaction 30min；Obtain enzymolysis solution。Take 0.1mL enzymolysis solution add 90%(mass fraction) the NaOH solution 0.5mL of diglycol 5mL, 1mol/L, distilled water 0.4mL；Take 0.1mL distilled water and do blank (distilled water and the difference of enzymolysis solution absorbance are enzyme Basis alive)。After 40 DEG C of water bath with thermostatic control 15min, survey absorbance at 420nm place。With 40 DEG C, pH5.5 when, the enzyme amount needed for hydrolysis 1 μ g naringin per minute is 1 enzyme activity unit (U)。The naringinase enzyme recording liquid fermentation liquid prepared by step (2) is lived as 243U/mL。(above-mentioned steps is also the confirmation to enzyme simultaneously, measures substrate naringin consumption and reflects naringinase size alive)。
" specifically the calculating process " of above-mentioned enzyme activity determination method is that those skilled in the art generally know, and according to general steps disclosed above, those skilled in the art can measure enzyme and live。
Embodiment 3 aspergillus oryzae 11250 liquid fermentation produces naringinase
Centrifugation: by fermentation liquid centrifugation, take supernatant；Centrifugal rotating speed is 8000rpm, and centrifugation time is 10min。
By supernatant ammonium sulfate precipitation: add ammonium sulfate (ammonium sulfate is analytical pure sulfuric acid ammonium reagent) in supernatant, making its mass body volume concentrations is 50%, it is filtered to remove the precipitation of generation, then in filtrate, ammonium sulfate is continuously added, being 50%-70% to its mass body volume concentrations, it is filtrated to get and precipitates containing naringinase。Meaning that in every mL supernatant containing the quality (g) of ammonium sulfate of described mass body volume concentrations。
Eluting: will be 0.6mol/L with 0 ~ 1mol/LNaCl(optimal concentration containing naringinase precipitation) carry out eluting after, collection naringinase eluent。
QSepharoseFastFlow ion-exchange chromatography: first formulation content is that the Tris-HCl buffer of 40mmol/L, pH7.0 is to balance QSepharose post material；Adding naringinase eluent 300 microlitre after baseline balance, adsorption time is 30min；Carrying out gradient elution by the NaCl solution of 0-1mol/L after absorption, flow velocity is set to 1mL/min, detects often naringinase vigor and protein content in pipe eluent；At about 0.6mol/LNaCl, destination protein goes out peak。
SephacrylS-200 gel permeation chromatography: fill in SephacrylS-200 post material；With 50mmol/LNaCl solution (50mmol/L, pH7.0 phosphate buffer is solvent), flow velocity 0.1mL/min, balance columns material；With same buffer eluting after balance, flow velocity is maintained at 0.1mL/min, arranges often pipe and collects 1mL；Detect often naringinase vigor and protein content in pipe；Wherein, SephacrylS-200 is the model of chromatographic column。
Above-mentioned centrifugation, ammonium sulfate precipitation, eluting, QSepharoseFastFlow ion-exchange chromatography, SephacrylS-200 gel permeation chromatography are routine operation；Those skilled in the art can as the case may be from Row sum-equal matrix。
Liquid fermentation liquid prepared by embodiment 2 is easily separated, purification, all can obtain the pure naringinase of electrophoresis；Purity and Rate activity are shown in shown in following table。Be can be seen that final through the pure naringinase of electrophoresis that the SephacrylS-200 response rate obtained is 32 by data in table, its purification is 26.78 times；Total enzyme activity can reach 8512U, and specific enzyme activity power reaches 2194U/mg
The purification conclusive table of table 2 aspergillus oryzae 11250
Aspergillus oryzae 11250 can be recorded through SDS-PAGE to produce the molecular weight of naringinase and be about 23kDa, SDS-PAGE result and see Fig. 6。
The liquid fermentation liquid of embodiment 4 aspergillus oryzae 11250 purifies the application of naringinase
(1) it is in 0.1% naringin, neohesperidin, Hesperidin, skin glycosides, rutin and p-nitrophenyl rhamnoside substrate test tube that the molecular weight that embodiment 3 obtains is about the naringinase of 23kDa is separately added into containing 2mL mass concentration, the mensuration adopting the naringinase enzyme activity in embodiment 2 improves Davis method, reacts 30min at 40 DEG C；
(2) reacted liquid blending is taken 1mL and cross the filter membrane of 0.22um, be positioned in liquid phase bottle；
(3) 0-7min, high purity water: methanol: acetonitrile=62:12:26(v:v are adopted)；7-9min, high purity water: methanol: acetonitrile=15:35:50；15-17min, high purity water: methanol: acetonitrile=62:12:26
Carrying out gradient elution, column temperature is 30 DEG C, detects wavelength 280nm, adopts C18 post, 10*1cm specification；Read high performance liquid chromatography, contrast with the high performance liquid chromatography appearance time of corresponding enzymatic hydrolysate standard substance respectively；Can drawing, naringinase can be hydrolyzed naringin, neohesperidin, Hesperidin, p-nitrophenyl rhamnoside, skin glycosides, rutin respectively。Fig. 7-12 represents: the molecular weight that embodiment 3 obtains is about the naringinase of 23kDa and is hydrolyzed the high-efficient liquid phase chromatogram of naringin, neohesperidin, Hesperidin, p-nitrophenyl rhamnoside, skin glycosides, rutin respectively。
<110>Beijing Technology and Business University
<120>a kind of aspergillus oryzae and application thereof
<160>1
<210>1
<211>575
<212>DNA
<213>aspergillus oryzae (Aspergillusoryzae)
<400>1
ggcttttccggagtggagggttctagcgagcccaacctcccacccgtgtttactgtacct60
tagttgcttcggcgggcccgccattcatggccgccgggggctctcagccccgggcccgcg120
cccgccggagacaccacgaactctgtctgatctagtgaagtctgagttgattgtatcgca180
atcagttaaaactttcaacaatggatctcttggttccggcatcgatgaagaacgcagcga240
aatgcgataactagtgtgaattgcagaattccgtgaatcatcgagtctttgaacgcacat300
tgcgccccctggtattccggggggcatgcctgtccgagcgtcattgctgcccatcaagca360
cggcttgtgtgttgggtcgtcgtcccctctccgggggggacgggccccaaaggcagcggc420
ggcaccgcgtccgatcctcgagcgtatggggctttgtcacccgctctgtaggcccggccg480
gcgcttgccgaacgcaaatcaatctttttccaggttgacctcggatcaggtagggatacc540
cgctgaacttaagcatatcaaaagccggaggaaga575
Claims (10)
1. an aspergillus oryzae, called after aspergillus oryzae 11250, its preserving number is CGMCC11320。
2. aspergillus oryzae according to claim 1, it is characterised in that naringinase can be produced。
3. aspergillus oryzae according to claim 1 and 2, it is characterised in that can ferment with the fermentation substrate containing orange peel and produce the fermentation liquid containing naringinase；Possibly together with naringin and naringenin in fermentation liquid。
4. aspergillus oryzae according to claim 3, it is characterised in that produced naringinase molecular weight is 23kDa, optimum operative temperature, pH respectively 45 DEG C, 5.0。
5. aspergillus oryzae according to claim 4, it is characterised in that produced naringinase can be hydrolyzed naringin, neohesperidin, Hesperidin, skin glycosides, rutin and p-nitrophenyl rhamnoside。
6. the purposes of aspergillus oryzae described in any one in a claim 1-5, it is characterised in that produce naringinase。
7. the method that in a claim 1-5, aspergillus oryzae described in any one produces naringinase, it is characterised in that comprise the following steps:
(1) aspergillus oryzae 11250 is carried out slant culture, obtain slant strains；
(2) taking slant strains and be inoculated into seed culture medium, the condition bottom fermentation at 30 DEG C, 180rpm cultivates 48-96h, must contain the fermentation liquid of naringinase；
Slant medium:
PH is 6.0, containing following component: MgSO in every 1L40.5g、KH2PO41.5g、CaCl20.1g, (NH4)2SO41.5g、KCl0.5g、KNO31.5g, yeast extract 2g, orange meal 15g, agar 20g, water surplus；
Seed culture medium:
PH is 7.5, containing following component in every 1L: maltose 15.1g, tryptone 10g, (NH4)2HPO420g, NaCl10g, naringin 10g, yeast extract 5g, water surplus；Or,
PH is 6.0, containing following component: MgSO in every 1L40.5g、KH2PO41.5g、CaCl20.1g, (NH4)2SO41.5g、KCl0.5g、KNO31.5g, yeast extract 2, orange meal 7.5g, water surplus。
8. method according to claim 7, it is characterised in that gained fermentation liquid passes through centrifugation, ammonium sulfate precipitation, QSepharoseFastFlow ion-exchange chromatography, SephacrylS-200 gel permeation chromatography, obtains the pure naringinase of electrophoresis。
9. in a claim 1-5, aspergillus oryzae described in any one produces slant medium used by naringinase, it is characterised in that pH is 6.0, containing following component: MgSO in every 1L40.5g、KH2PO41.5g、CaCl20.1g, (NH4)2SO41.5g、KCl0.5g、KNO31.5g, yeast extract 2g, orange meal 15g, agar 20g, water surplus。
10. in a claim 1-5, aspergillus oryzae described in any one produces seed culture medium used by naringinase, it is characterised in that
PH is 7.5, containing following component in every 1L: maltose 15.1g, tryptone 10g, (NH4)2HPO420g, NaCl10g, naringin 10g, yeast extract 5g, water surplus；Or,
PH is 6.0, containing following component: MgSO in every 1L40.5g、KH2PO41.5g、CaCl20.1g, (NH4)2SO41.5g、KCl0.5g、KNO31.5g, yeast extract 2, orange meal 7.5g, water surplus。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610122690.7A CN105695340B (en) | 2016-03-04 | 2016-03-04 | Aspergillus oryzae and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610122690.7A CN105695340B (en) | 2016-03-04 | 2016-03-04 | Aspergillus oryzae and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105695340A true CN105695340A (en) | 2016-06-22 |
| CN105695340B CN105695340B (en) | 2020-08-21 |
Family
ID=56220109
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610122690.7A Active CN105695340B (en) | 2016-03-04 | 2016-03-04 | Aspergillus oryzae and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105695340B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106490450A (en) * | 2016-10-25 | 2017-03-15 | 中南林业科技大学 | A kind of de- hardship acerbity removing method of cork oak kernel |
| CN107455668A (en) * | 2017-07-28 | 2017-12-12 | 湖北土老憨调味食品股份有限公司 | A kind of preparation method of no bitter taste dried orange peel black bean sauce |
| CN107594451A (en) * | 2017-08-30 | 2018-01-19 | 珠海天香苑生物科技发展股份有限公司 | The method that aspergillus oryzae prepares yeast extract |
| CN111662831A (en) * | 2020-06-12 | 2020-09-15 | 浙江工业大学 | Aspergillus niger Rha-N1 and application thereof |
| CN116686929A (en) * | 2023-05-05 | 2023-09-05 | 华南理工大学 | Method for preparing debitterized citrus product by using whole cell catalysis technology and product thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643754A (en) * | 2012-04-18 | 2012-08-22 | 中国农业大学 | Aspergillus oryzae and application thereof in aspect of improving yield of alcohol |
| CN104404016A (en) * | 2014-12-17 | 2015-03-11 | 北京工商大学 | Naringinase production method |
-
2016
- 2016-03-04 CN CN201610122690.7A patent/CN105695340B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643754A (en) * | 2012-04-18 | 2012-08-22 | 中国农业大学 | Aspergillus oryzae and application thereof in aspect of improving yield of alcohol |
| CN104404016A (en) * | 2014-12-17 | 2015-03-11 | 北京工商大学 | Naringinase production method |
Non-Patent Citations (3)
| Title |
|---|
| A.MENDOZA-CAL ET AL.: "Naringinase production from filamentous fungi using grapefruit rind in solid state fermentation", 《AFRICAN JOURNAL OF MICROBIOLOGY RESEARCH》 * |
| DONG-XIAO CHEN ET AL.: "Optimizing culture medium for debittering constitutive enzyme naringinase production by Aspergillus oryzae JMU316", 《AFRICAN JOURNAL OF BIOTECHNOLOGY》 * |
| 李勇如等: "米曲霉利用农业废弃物产木聚糖酶的条件优化", 《北京工商大学学报（自然科学版）》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106490450A (en) * | 2016-10-25 | 2017-03-15 | 中南林业科技大学 | A kind of de- hardship acerbity removing method of cork oak kernel |
| CN106490450B (en) * | 2016-10-25 | 2019-06-28 | 中南林业科技大学 | A kind of de- bitter acerbity removing method of cork oak kernel |
| CN107455668A (en) * | 2017-07-28 | 2017-12-12 | 湖北土老憨调味食品股份有限公司 | A kind of preparation method of no bitter taste dried orange peel black bean sauce |
| CN107455668B (en) * | 2017-07-28 | 2020-08-18 | 湖北土老憨调味食品股份有限公司 | Preparation method of bitter-taste-free tangerine peel and fermented soya bean sauce |
| CN107594451A (en) * | 2017-08-30 | 2018-01-19 | 珠海天香苑生物科技发展股份有限公司 | The method that aspergillus oryzae prepares yeast extract |
| CN111662831A (en) * | 2020-06-12 | 2020-09-15 | 浙江工业大学 | Aspergillus niger Rha-N1 and application thereof |
| CN116686929A (en) * | 2023-05-05 | 2023-09-05 | 华南理工大学 | Method for preparing debitterized citrus product by using whole cell catalysis technology and product thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105695340B (en) | 2020-08-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105695340A (en) | Aspergillus oryzae and application thereof | |
| CN102220270B (en) | Screening method for producing chondroitin sulfate bacterial strain and application of bacterial strain fermentation method in production of chondroitin sulfate | |
| CN105154358B (en) | A kind of method of bacillus and its simultaneous saccharification and fermentation production Pfansteihl | |
| CN102796716B (en) | Method for preparing tannase | |
| CN101085989B (en) | Process for producing tomatine using bacteria fermentation | |
| CN104342390A (en) | Sinorhizobium meliloti strain and composition and application of sinorhizobium meliloti strain | |
| CN103497911A (en) | Application of Chryseobacterium sp. and carbonyl reductase thereof in production of aprepitant chiral intermediate | |
| CN104498365A (en) | Bacterial strain capable of producing chitin deacetylase and application of bacterial strain in production of chitin deacetylase through fermentation | |
| CN109825444A (en) | A kind of bacterial strain and its brewing method improving red rice yellow wine food safety | |
| CN106834141A (en) | A kind of anaerobic fungi and the method for producing formic acid with its rice straw that ferments | |
| CN102719378B (en) | Method for preparing (-) gamma-lactam by catalysis asymmetry of microorganism | |
| Li et al. | Production of pigment-free pullulan by swollen cell in Aureobasidium pullulans NG which cell differentiation was affected by pH and nutrition | |
| CN103627698A (en) | Breeding of acetoin high-tolerance bacterial strain and acetoin fermentation production with bacterial strain | |
| CN105255745A (en) | Rhizopus for producing beta-glucosidase and method of producing enzyme through rhizopus fermentation | |
| CN104845893A (en) | Rhodotorula mucilaginosa and application thereof to fermentation production of malus micromalus astaxanthin | |
| CN104450655A (en) | Preparation method and product of paenibacillus chymosin | |
| CN104404016B (en) | Naringinase production method | |
| CN104762229A (en) | A bacillus subtilis strain and applications thereof | |
| CN104611236A (en) | Cumminghamella echinulata(Thaxter) thaxter FAR3 and method for fermentation preparation of Gamma-linolenic acid grease with Cumminghamella echinulata(Thaxter) thaxter FAR3 | |
| CN106636252A (en) | Thelephora ganbajun Zang exopolysaccharide, preparation method thereof and application of exopolysaccharide | |
| CN100390295C (en) | Microorganism polysaccharide and its preparation method and application | |
| CN102363757A (en) | Screening method for 2-keto-D-gluconic acid high-yield bacterial strain, and fermentation method of such bacterial strain | |
| CN109136313A (en) | Utilize the method for Michigan's Klebsiella synthesis 2'-deoxyadenosine | |
| CN104531573B (en) | A kind of bacillus amyloliquefaciens and its application | |
| CN101008000A (en) | Rhodotorula mucilaginosa for producing beta-caroten, beta-caroten and its production method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |