CN105671181A - Genetic mark, primer, probe and kit for detecting lung cancer - Google Patents

Abstract

The invention discloses a genetic mark for detecting lung cancer. The genetic marker comprises an SFTPB gene, an FGFR1 gene and an FILIP1L gene. Research studies show that mRNAs (messenger ribonucleic acids) of SFTPB, FGFR1 and FILIP1L in blood mononuclear cells of patients with the lung cancer are not expressed normally, accuracy rate of diagnosis on the lung cancer reaches 98.3% after integration, and the genetic mark is much more superior to a single gene in terms of diagnosis specificity and sensitivity. Through measurement of expression quantities of the SFTPB gene, the FGFR1 gene and the FILIP1L gene in blood, diagnosis on the lung cancer (especially early lung cancer from which the patients suffer without symptoms) is achieved, so that clinical lung cancer detection rate is increased, and death rate of the patients with the lung cancer is reduced.

Description

For detecting the gene marker of pulmonary carcinoma, primer, probe and test kit

Technical field

The present invention relates to lung cancer detection technical field, be particularly used for the detection gene marker of pulmonary carcinoma, primer, probe and test kit.

Background technology

Pulmonary carcinoma betides bronchial mucosa epithelium, and the M & M of pulmonary carcinoma was always in rising trend in recent years, it has also become the 21 century severe health problem that faces of the whole world. In China, it is contemplated that by 2025, patients with lung cancer was up to 1,000,000, occupy the 1st, the world. The relevant issues of the research generation of pulmonary carcinoma, development and treatment and prognosis are all the important topics that medical circle faces all the time. At present the early diagnosis of pulmonary carcinoma there is the inspection method such as chest x-ray and breast CT inspection, expectorant cytoscopy, fiberoptic bronchoscopy and Drug eluting stent, due to when these methods for clinical diagnosis diagnosings are relatively costly and have the particularity of instrument and technical limitations and detection to reasons such as the wounds of patient, these diagnostic methods are made to have a lot of limitation, can not get being widely applied, almost the patients with lung cancer of 2/3 has been late period (III phase or IV phase) when medical, misses optimal treatment period.

Research about lung cancer marker at present is also compared many, but the free microRNA in cancerous lung tissue and blood that focuses mostly on, not yet develop into the clinical diagnosis stage.

In tissue, the detection of lung cancer marker needs operation or biopsy to obtain cancerous tissue, is not suitable for the early detection of pulmonary carcinoma or repeatedly checks, because once need biopsy or operation, pulmonary carcinoma is relatively late already at ratio, and lung cancer marker diagnosis unnecessarily property.

So finding a kind of new lung cancer detection mark and developing into Clinical detection and the simple and practical technology of being available for, assist patients with lung cancer clinical diagnosis, improve the accuracy rate of diagnosis of pulmonary carcinoma, the morning of pulmonary carcinoma is found that early treatment is significant.

Summary of the invention

The technical problem to be solved in the present invention is that in existing tissue, lung cancer marker detection needs operation or biopsy, is not suitable for pulmonary carcinoma early detection or repeatedly checks, increasing patient painful; The diagnostic techniques of blood markers thing rests on conceptual phase more, and Detection results need to be further characterized by, and not yet develops into the clinical diagnosis stage.

For solving above-mentioned technical problem, present invention provide for the gene marker of detection pulmonary carcinoma early stage, it is the associating mark of three kinds of genes, specifically includes SFTPB gene, FGFR1 gene and FILIP1L gene.By to the mensuration of expression in three gene SFTPB, FGFR1 and FILIP1L blood, (pulmonary carcinoma has occurred and that to reach the early diagnosis of pulmonary carcinoma, but human body is substantially free of symptom), auxiliary improves the recall rate of clinical pulmonary carcinoma, reduces the mortality rate of patients with lung cancer.

SFTPB, FGFR1 and FILIP1L find that it is relevant to pulmonary carcinoma respectively in different research. Wherein SFTPB is a kind of parent's surfactant protein, and proteomics research shows that the blood plasma level of SFTPB independent risk factor known to the clinic of pulmonary carcinoma is relevant, is a kind of up-and-coming blood marker of nonsmall-cell lung cancer. Additionally, SFTPB is relevant with the early stage of lung cancer, the tumor of prompting potential nonsmall-cell lung cancer in early days is appropriate for excision. FGFR1 is a kind of fibroblast growth factor acceptor, and its expression can reduce apoptosis, promotes the survival of cancerous cell, is an independent poor prognosis mark thing of early stage prognosis of squamous cell lung cancer. FILIP1L is a kind of tenuin, it is possible to by suppressing the expression of matrix metalloproteinase, thus the invasion and attack of anticancer and transfer, in cancerous lung tissue, the mrna expression level of FILIP1L albumen and regulation and control FILIP1L albumen is lower than normal structure. Current research only stays in the dependency of the content typing different from pulmonary carcinoma of SFTPB, FGFR1 and FILIP1L albumen. This research is by substantial amounts of early-stage Study, screening obtains SFTPB, FGFR1 and FILIP1L gene expression and pulmonary carcinoma significant correlation in blood mononuclear cell, and can be used for assisting the early diagnosis of pulmonary carcinoma, after three gene markers are integrated, the accuracy rate of diagnosis of the early stage of lung cancer can be reached 98.3% by it, and is applicable to the diagnosis of different typing pulmonary carcinoma.

Primer for detecting pulmonary carcinoma provided by the invention and probe, including SFTPB primed probe group, FGFR1 primed probe group and FILIP1L primed probe group, nucleotide sequence is as follows:

SFTPB primed probe group:

Forward primer: SEQIDNO:1 (5 '-CAGAAACTACAGACAAAGAGAGTGGAA-3 '),

Downstream primer: SEQIDNO:2 (5 '-TTCAGTTGCTTCAGGCCATCT-3 '),

Probe: SEQIDNO:3 (5 '-CAGGCCTCTGAGCCCAAGCTAAGCC-3 ');

FGFR1 primed probe group:

Forward primer: SEQIDNO:4 (5 '-CACGGGACATTCACCACATC-3 '),

Downstream primer: SEQIDNO:5 (5 '-ACCCCGAAAGACCACACATC-3 '),

Probe: SEQIDNO:6 (5 '-ACTATAAAAAGACAACCAACGGCCGACTGC-3 ');

FILIP1L primed probe group:

Forward primer: SEQIDNO:7 (5 '-CATCCCTGAAACACCTTGATTTTAT-3 '),

Downstream primer: SEQIDNO:8 (5 '-TCAAGGCTTAAAACAACATCCATTT-3 '),

Probe: SEQIDNO:9 (5 '-AAGCCACGCTGTATCTGGACTTCTGATCTG-3 ');

Wherein, the nucleotide sequence 5 ' of probe holds mark fluorescent reporter group, 3 ' end mark fluorescent quenching groups.

Preferably, described fluorescent reporter group is FAM, and fluorescent quenching group is TAMRA.

A kind of lung cancer detection test kit provided by the invention, including the above-described primer for detecting pulmonary carcinoma and probe. For convenience of fluorescence quantitative PCR detection, test kit preferably also includes Taqman reaction buffer, dNTPs, Mg²⁺Deng.

Preferably, above-mentioned lung cancer detection test kit, also include detection primer and the probe of reference gene GAPDH, its concrete nucleotides sequence is classified as forward primer: SEQIDNO:10, downstream primer SEQIDNO:11, probe: SEQIDNO:12;The nucleotide sequence 5 ' of probe holds mark fluorescent reporter group, 3 ' end mark fluorescent quenching groups. The preferred FAM of fluorescent reporter group, the preferred TAMRA of fluorescent quenching group.

SEQIDNO:10 (5 '-GCATCCTGGGCTACACTGAG-3 ');

SEQIDNO:11 (5 '-TCCACCACCCTGTTGCTGTA-3 ');

SEQIDNO:12(5’-TCCTCTGACTTCAACAGCGACACCC-3’)。

Preferably, above-mentioned lung cancer detection test kit, also include positive reference substance, positive reference substance includes the SFTPB gene of gradient concentration, FGFR1 gene, FILIP1L gene and GAPDH gene.

Preferably, above-mentioned lung cancer detection test kit, also includeUniversalPCRMasterMix and RNase-freewater. Both reagent is commercial goods.

Present invention also offers the using method of lung cancer detection test kit described in any of the above, comprise the following steps:

(1) sample total serum IgE is extracted, reverse transcription synthesis cDNA;

(2) with cDNA for template, use respectively and carry out quantitative fluorescent PCR reaction for the primer and probe detecting pulmonary carcinoma described in claim 2, collect fluorescence signal, obtain the expression of FGFR1 gene, SFTPB gene and FILIP1L gene; When in test kit containing reference gene, the detection primer and the probe that use reference gene GAPDH carry out quantitative fluorescent PCR reaction, the PCR reaction result of GAPDH gene is for being normalized the measurement result of three genes of interest, and the Ct value difference that correction is caused by initial sampling amount is different;

(3) the associated prediction factor is calculated: the expression formula of the associated prediction factor is: y=1.77x1+3.68x2-x3, wherein y represents the associated prediction factor, x1 represents the relative expression quantity after sample FGFR1 gene reference gene normalization, x2 represents the relative expression quantity after sample SFTPB gene reference gene normalization, and x3 represents the relative expression quantity after sample FILIP1L gene reference gene normalization; As y > 34.44, this sample is judged to that pulmonary carcinoma is positive; As y < 34.44, this sample is judged to that pulmonary carcinoma is negative, i.e. normal sample.

Compared with prior art, the method have the advantages that

The present invention finds SFTPB, FGFR1 and FILIP1LmRNA abnormal expression in blood of patients with lung cancer mononuclear cell by studying, and after its integration, the accuracy rate of diagnosis of pulmonary carcinoma is reached 98.3%, and the specificity of its diagnosis and sensitivity are also far superior to individual gene.

Further, the mensuration sample of this test kit is mononuclear cell in peripheral blood, draws materials conveniently, and wound is little, safety; Adopt RT-PCR technology to carry out the quantitative assay of three target genes, there is specificity and advantage that is highly sensitive, simple to operate and that be prone to big flux examination.

The present invention can be widely used in the detection of patients with lung cancer SFTPB, FGFR1 and FILIP1L gene amplification level, can be used for the early diagnosis of pulmonary carcinoma and therapeutic evaluation, improve repeatability and the accuracy of pathology detection, avoid excessive tissue biopsy, the patients with lung cancer that examination more accurately goes out, early treatment intervenes, medical treatment cost and expense can be greatly reduced, reduce the waste of medical resource, prolongation survival of patients phase, improve life in patients.

Accompanying drawing explanation

Fig. 1 is SFTPB, FGFR1 and FILIP1L three target genes change of △ Ct in normal control and clinical samples. Note: * represents compared with normally, P < 0.05.

The ROC curve that Fig. 2 is three target genes of SFTPB, FGFR1 and FILIP1L analyzes result.

Fig. 3 is that after three target genes of SFTPB, FGFR1 and FILIP1L are integrated, ROC curve analyzes result.

Detailed description of the invention

Below in conjunction with specific embodiment, the invention will be further described, so that those skilled in the art can be better understood from the present invention and can be practiced, but illustrated embodiment is not as a limitation of the invention.

Embodiment 1 is for detecting preparation and the use of the test kit of pulmonary carcinoma

1, the real-time fluorescence quantitative PCR test kit composition of SFTPB, FGFR1 and FILIP1L gene expression dose is detected:

SFTPB gene-specific primer (upstream and downstream primer premix), 10 μMs; Specific fluorogenic probe, 2 μMs;

FGFR1 gene-specific primer (upstream and downstream primer premix), 10 μMs; Specific fluorogenic probe, 2 μMs;

FILIP1L gene-specific primer (upstream and downstream primer premix), 10 μMs; Specific fluorogenic probe, 2 μMs;

GAPDH gene-specific primer (upstream and downstream primer premix), 10 μMs; Specific fluorogenic probe, 2 μMs;

UniversalPCRMasterMix, purchased from ABI company;

RNase-freewater, purchased from TIANGEN Biotech (Beijing) Co., Ltd..

Positive reference substance individually preserves, and carries out Concentraton gradient dilution during use.

2, the using method of test kit:

(1) real-time fluorescence quantitative PCR reaction system

Table 1 real-time fluorescence quantitative PCR reaction system

Note: above-mentioned reaction reagent adopts American AB I company's T aqman fluorescence quantitative kit, it is also possible to other company's similar-type products.

The amplification condition of PCR is: 95 DEG C of denaturation 10min, 95 DEG C of degeneration 10s, 60 DEG C of annealing 30s, and 72 DEG C of amplification 30s carry out 45 circulations.

(2) data process

This test kit adopts relative quantification method to carry out data analysis. By detecting the Ct value of 3 target genes of sample and 1 reference gene, by 2^-△△CtMethod analyzes the difference of the expression of the relatively normal sample of cancer sample. SFTPB, FGFR1 and FILIP1L gene expression dose adopts it to represent with the reference gene GAPDH difference △ Ct expanding Ct value. The content negative correlation of the size of △ Ct and SFTPB, FGFR1 and FILIP1L gene. Compared to normal group, if the △ Ct value of patients with lung cancer SFTPB gene reduces, namely meaning in patients with lung cancer group, the expression of SFTPB gene increases.

The calculating of diagnostic threshold after SFTPB, FGFR1 and FILIP1L gene integration: SFTPB, FGFR1 and FILIP1L gene expression Ct value adopts reference gene to be normalized, and carries out threshold calculations with the ratio of target gene Yu reference gene. Target gene relative expression quantity after normalization is brought equation y=1.77x1+3.68x2-x3 into and is calculated, wherein y represents the associated prediction factor, x1 represents the relative expression quantity after sample FGFR1 gene reference gene normalization, x2 represents the relative expression quantity after sample SFTPB gene reference gene normalization, and x3 represents the relative expression quantity after sample FILIP1L gene reference gene normalization. Bringing equation into after clinical sample records expression of target gene amount normalization to be calculated, if y is positive more than 34.44, namely the diagnosis of this sample is patients with lung cancer; If y is negative less than 34.44, namely the diagnosis of this sample is normal.

(3) test kit detection system batch in and batch between repeatability

Take arbitrary sample at random, repeat to detect for 6 times in once experiment simultaneously, investigate batch interior repeatability; Taking arbitrary sample at random, repeat 6 secondary responses at different time, investigate repeatability between criticizing, result is in Table 2.

In 2 batches, table and batch between gene redundancy

As shown in Table 2, the RSD of batch interior gene absolute magnitude of this kit test method system is 0.69%, and between batch, the RSD of gene absolute magnitude is 1.09%, is respectively less than 5%.Data above absolutely proves that the detection method system set up has well batch interior and official written reply repeatability, it is ensured that measurement result is accurately and reliably.

Embodiment 2 clinical sample detects

1, clinical sample is collected:

50 example healthy volunteer's samples are collected in this research altogether, 50 example patients with lung cancer samples.

2, the extraction of total serum IgE in fresh peripheral blood:

(1) the centrifugal 10min of whole blood 1mL, the 5000rpm of EDTA (ethylenediaminetetraacetic acid) anticoagulant, abandons blood plasma, adds erythrocyte cracked liquid 1mL, fully mixes, and puts and reacts the centrifugal 5min of 15min, 5000rpm on ice;

(2) abandoning supernatant, add PBS (PhosphateBufferedSaline, phosphate buffer) 1mL, fully mix, 5000rpm is centrifuged 5min; Repetitive operation three times, transparent to supernatant, abandon supernatant;

(3) adding 1mLTrizol reagent in lower sediment cell, fully mix, room temperature places 5min;

(4) adding chloroform 200 μ L, fully mix 30s, room temperature places the centrifugal 20min of 3min, 10000rpm;

(5) take supernatant 500 μ L, to new PE pipe, add isopropanol 500 μ L, place overnight for-80 DEG C after mixing; Or room temperature place half an hour, be made directly (6th) step centrifugally operated.

(6) taking out PE pipe from-80 DEG C, after room temperature is dissolved, 10000rpm is centrifuged 30min, abandons supernatant, adds 1mL, 75% ethanol-DEPC water (V/V, DEPC are pyrocarbonic acid diethyl ester) dissolving, fully mixes, and 7500rpm is centrifuged 10min;

(7) abandoning supernatant, mud chamber's warm air is done, and adds the DEPC water dissolution of 22 μ L, obtains total rna solution, stand-by, or-80 DEG C of preservations.

3, the synthesis of cDNA:

(1) 2 μ L total rna solutions are taken, 50 times of dilutions, measure OD (absorbance) through UV detector, calculate the concentration of said extracted gained total serum IgE, and detect OD260/280 >=1.8 and determine purity;

(2) taking 0.2 μ g total serum IgE and reverse transcription reagents, by the cDNA synthetic reaction system of table 3, application of sample reacts; Described reagent adopts the RevertAidFirstStrandcDNASynthesisKit of ThermoScientific company of the U.S., it is also possible to other company's similar-type products.

The reaction system of table 3:cDNA synthesis

Reaction reagent	Volume (μ L)
		10×Buffer RT	2
dNTP Mix(2.5mM each dNTP)	2
		Oligo-dT Primer(10μm)	2
Quant Reverse Transcriptase	1
		RNasin-free water	12
Sample total serum IgE (0.2 μ g)	1
		Cumulative volume	20

(3) reaction system is placed in 37 DEG C of hatching 60min, cDNA product-20 DEG C preservations.

4, sample detection by quantitative

Using sample cDNA as template, adopting Taqman quantitative fluorescent PCR reaction method, react in ABIPrism7300 real-time fluorescent PCR amplification instrument, reaction system and reaction condition are in Table 1. The amplification condition of PCR is: 95 DEG C of denaturation 10min, 95 DEG C of degeneration 10s, 60 DEG C of annealing 30s, and 72 DEG C of amplification 30s carry out 45 circulations.

Adopt 2^-△△CtThe relative amount of sample target gene is calculated by method. Result of calculation is as shown in table 4.

The relative amount of table 4SFTPB, FGFR1, FILIP1LmRNA

Note: 2^-△△CtValue refers to the ratio of target gene relative amount and normal group after normalization.

Fig. 1 measures the △ Ct of Ct value change in the sample to carry out doing the content of figure, △ Ct and sample target gene and be inversely proportional to target gene, and △ Ct increases, and target gene content reduction in the sample is described. It follows that the expression of SFTPB and FILIP1LmRNA increases in patients with lung cancer sample, the expression of FGFR1mRNA reduces.

In sum, the expression in peripheral blood lymphocytes of SFTPB, FGFR1, FILIP1L gene can as the potential source biomolecule mark of pulmonary cancer diagnosis.

For the diagnosis capability to patients with lung cancer and the therapeutic evaluation ability of above three gene, this research adopts Receiver Operating Characteristics (Receiveroperatincharacteristic, ROC) curve to evaluate. ROC curve is a kind of important tool evaluating mark accuracy. Available two leading indicators include: sensitivity (sensitivity), or True Positive Rate, evaluate its performance in selecting specified disease patient. In filler test, general requirement has high sensitivity to get rid of the people not having disease; Specificity (specificity), or true negative rate, indicate it not have the ability in the people of disease at selecting properly. In diagnosis, general requirement has high specific to obtain relatively low false positive rate. First three target genes being carried out ROC curve analysis, result is as shown in Figure 2. Wherein, abscissa is 100-specificity, i.e. false positive rate, and vertical coordinate is sensitivity, i.e. True Positive Rate.

As shown in Figure 2, three target genes are when distinguishing normal control (50 example) and patients with lung cancer (50 example), accuracy rate of diagnosis all can reach more than 90%, and FGFR1 and FILIP1L gene has higher sensitivity, and SFTPB gene then has higher specificity. Further investigation finds, being integrated by three target genes in test kit, compared to individual gene, its diagnosis capability can be improved. Initially set up logistic regression model, obtain the associated prediction factor, the expression formula of predictor is: y=1.77x1+3.68x2-x3, wherein y represents the associated prediction factor, x1 represents the expression of sample FGFR1 gene, x2 represents the expression of sample SFTPB gene, and x3 represents the expression of sample FILIP1L gene. Bringing the expression measurement result of each three target genes of sample into predictor equation, obtain the predictor of each sample, and with it for analysis indexes, carry out lapped biorthogonal transform ROC curve analysis, result is as indicated at 3.

As shown in Figure 3, after three target genes are integrated, its diagnostic sensitivity and specificity all improve, after integration predictor carry out the sensitivity of pulmonary cancer diagnosis and specificity respectively reaches 100% and 90%, 91%, and area is 0.983 (P < 0.0001) under ROC curve, illustrate that three target genes are used for pulmonary cancer diagnosis and have the accuracy rate of diagnosis of 98.3% after integrating, there is clinical diagnostic applications and be worth, can as the accessory molecule index of clinical pulmonary cancer diagnosis.

Relative expression quantity after measuring SFTPB, FGFR1, FILIP1L gene normalization in sample brings the equation y=1.77x1+3.68x2-x3 road associated prediction factor (y value) being calculated into. Y > 34.44, this sample is judged to disease sample; Y < 34.44, this sample is judged to normal sample.

Additionally, the therapy target researched and developed also contemplated as future drugs of this integrator gene mark group and evaluation index, carry out drug screening and new drug development.

Embodiment described above is only the preferred embodiment lifted for absolutely proving the present invention, and protection scope of the present invention is not limited to this. Equivalent replacement that those skilled in the art make on basis of the present invention or conversion, all within protection scope of the present invention. Protection scope of the present invention is as the criterion with claims.

SEQUENCELISTING

<110>king, justice is bright

<120>for detecting the gene marker of pulmonary carcinoma, primer, probe and test kit

<130>

<160>12

<170>PatentInversion3.5

<210>1

<211>27

<212>DNA

<213>artificial sequence

<400>1

cagaaactacagacaaagagagtggaa27

<210>2

<211>21

<212>DNA

<213>artificial sequence

<400>2

ttcagttgcttcaggccatct21

<210>3

<211>25

<212>DNA

<213>artificial sequence

<400>3

caggcctctgagcccaagctaagcc25

<210>4

<211>25

<212>DNA

<213>artificial sequence

<400>4

caggcctctgagcccaagctaagcc25

<210>5

<211>20

<212>DNA

<213>artificial sequence

<400>5

accccgaaagaccacacatc20

<210>6

<211>30

<212>DNA

<213>artificial sequence

<400>6

actataaaaagacaaccaacggccgactgc30

<210>7

<211>25

<212>DNA

<213>artificial sequence

<400>7

catccctgaaacaccttgattttat25

<210>8

<211>25

<212>DNA

<213>artificial sequence

<400>8

tcaaggcttaaaacaacatccattt25

<210>9

<211>30

<212>DNA

<213>artificial sequence

<400>9

aagccacgctgtatctggacttctgatctg30

<210>10

<211>20

<212>DNA

<213>artificial sequence

<400>10

gcatcctgggctacactgag20

<210>11

<211>20

<212>DNA

<213>artificial sequence

<400>11

tccaccaccctgttgctgta20

<210>12

<211>25

<212>DNA

<213>artificial sequence

<400>12

tcctctgacttcaacagcgacaccc25

Claims (8)

1. for detecting the gene marker of pulmonary carcinoma, it is characterised in that include SFTPB gene, FGFR1 gene and FILIP1L gene.

2. for detecting primer and the probe of pulmonary carcinoma, it is characterised in that including SFTPB primed probe group, FGFR1 primed probe group and FILIP1L primed probe group, nucleotide sequence is as follows:

SFTPB primed probe group:

Forward primer: SEQIDNO:1,

Downstream primer: SEQIDNO:2,

Probe: SEQIDNO:3;

FGFR1 primed probe group:

Forward primer: SEQIDNO:4,

Downstream primer: SEQIDNO:5,

Probe: SEQIDNO:6;

FILIP1L primed probe group:

Forward primer: SEQIDNO:7,

Downstream primer: SEQIDNO:8,

Probe: SEQIDNO:9;

Wherein, the nucleotide sequence 5 ' of probe holds mark fluorescent reporter group, 3 ' end mark fluorescent quenching groups.

3. primer for detecting pulmonary carcinoma according to claim 2 and probe, it is characterised in that described fluorescent reporter group is FAM, and fluorescent quenching group is TAMRA.

4. a lung cancer detection test kit, it is characterised in that include primer and the probe for detecting pulmonary carcinoma described in Claims 2 or 3.

5. lung cancer detection test kit according to claim 4, it is characterised in that also include detection primer and the probe of reference gene GAPDH, its concrete nucleotides sequence is classified as forward primer: SEQIDNO:10, downstream primer SEQIDNO:11, probe: SEQIDNO:12; The nucleotide sequence 5 ' of probe holds mark fluorescent reporter group, 3 ' end mark fluorescent quenching groups.

6. lung cancer detection test kit according to claim 5, it is characterised in that also include positive reference substance, positive reference substance includes the SFTPB gene of gradient concentration, FGFR1 gene, FILIP1L gene and GAPDH gene.

7. lung cancer detection test kit according to claim 5, it is characterised in that also includeUniversalPCRMasterMix and RNase-freewater.

8. the using method of the arbitrary described lung cancer detection test kit of claim 4～7, it is characterised in that comprise the following steps:

(1) sample total serum IgE is extracted, reverse transcription synthesis cDNA;

(2) with cDNA for template, use respectively and carry out quantitative fluorescent PCR reaction for the primer and probe detecting pulmonary carcinoma described in claim 2, collect fluorescence signal, obtain the expression of FGFR1 gene, SFTPB gene and FILIP1L gene; When in test kit containing reference gene, the detection primer and the probe that use reference gene GAPDH carry out quantitative fluorescent PCR reaction, GAPDH gene PCR reaction result is for being normalized the measurement result of three genes of interest, and the Ct value difference that correction is caused by initial sampling amount is different;

(3) the associated prediction factor is calculated: the expression formula of the associated prediction factor is: y=1.77x1+3.68x2-x3, wherein y represents the associated prediction factor, x1 represents the relative expression quantity after sample FGFR1 gene reference gene normalization, x2 represents the relative expression quantity after sample SFTPB gene reference gene normalization, and x3 represents the relative expression quantity after sample FILIP1L gene reference gene normalization; As y > 34.44, this sample is judged to that pulmonary carcinoma is positive; As y < 34.44, this sample is judged to that pulmonary carcinoma is negative, i.e. normal sample.