CN105648117A - Apple stem grooving virus detection kit and method - Google Patents
Apple stem grooving virus detection kit and method Download PDFInfo
- Publication number
- CN105648117A CN105648117A CN201610125351.4A CN201610125351A CN105648117A CN 105648117 A CN105648117 A CN 105648117A CN 201610125351 A CN201610125351 A CN 201610125351A CN 105648117 A CN105648117 A CN 105648117A
- Authority
- CN
- China
- Prior art keywords
- seqidno
- sequence
- primer
- apple stem
- stem grooving
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to reverse transcription-loop-mediated isothermal amplification (RT-LAMP) kit of apple stem grooving virus, comprising a primer, a reaction buffer, AMV reverse transcriptase, Bst DNA polymerase and nucleic acid dye. The invention also discloses a method for detecting apple stem grooving virus by using RT-LAMP technology. The kit and detection method have the advantages of high speed, operation simplicity, high sensitivity, high specificity and the like, enable apple stem grooving virus to be quickly detected, are easy to popularize and apply in a wide range and have a promising market prospect.
Description
Technical field
The present invention relates to microorganism detection field, specifically, the present invention relates to a kind of apple stem grooving virus detection kit and detection method.
Background technology
Fructus Mali pumilae is one of big fruit in the world four, widely distributed, has significantly high economic worth, at China's cultivation history of existing more than 2,000 year. At present, China's apple tree cultivated area and total output all rank first in the world, but the level of production and fruit quality still exist suitable gap with advanced country, and its influence factor is a lot, and the harm of virosis is one of major reason causing this phenomenon. Apple virus disease is widely distributed all over the world, and impact is serious, has the advantages that hazardness is strong, Spreading and diffusion fast and is difficult to cure. After tree body is subject to virus harm, virus is at host cell endoparasitism and breeds, destroy the normal physiological function of interference tree body, have a strong impact on the growth of fruit tree, reduce yield, quality, the keeping quality of fruit and resistance to transport power, also affect root system of the apple to the absorption of soil nutrient and utilization, cause serious economic loss.
Apple stem grooving virus (Applestemgroovingvirus, ASGV) it is one of common latent virus, the fruit trees such as harm Fructus Mali pumilae, pears, Citrus, Fructus Pruni pseudocerasi, Fructus Pruni, the mode infection hosts such as seed, grafting, mechanical inoculation, juice friction can be passed through, not yet find its communication media so far. The fruit tree plant infected by apple stem grooving virus shows grafting part necrosis, and blade turns yellow in various degree, and the symptoms such as bulk black speck or leaf roll occurs in the later stage, and diseased plant more healthy strain growth is short and small and weak. Owing to its symptom there is no typicality compared with the infection of other common virus, therefore easily out in the cold.
Apple stem grooving virus is the representative member sending out shape Tobamovirus (Capillovirus), and its genome has the polyprotein of two ORF:ORF1 coding molecule amount 241KDa, and CP is positioned at its C end, is sized to 27KDa; ORF2 is positioned at inside ORF1, and coding molecule amount is the motor protein of 36KDa, and motor protein is overlapping with coat protein portion gene. Detection to apple stem grooving virus at present, many employing traditional biological methods, serological method and molecular biology method. But, traditional method length consuming time, sensitivity is not high, poor specificity; Serological method somewhat expensive, operating procedure is many, consuming time longer, and would be likely to occur in sample and the impurity of antibody generation nonspecific reaction, false positive results easily occurs, is therefore suitable only for primary dcreening operation; And molecular biology method is due to its high specificity, highly sensitive, is apply maximum methods being in study frontier now.In order to adapt to industry development demand, it is necessary to develop a kind of method that more quickly and accurately apple stem grooving virus can be carried out molecular Biological Detection.
Loop-mediated isothermal amplification technology (loop-mediatedisothermalamplification, LAMP) it is that a kind of novel nucleic acid amplification method grown up in recent years is (see document NotomiT, OkayamaH, MasubuchiH, YonekawaT, WatanabeK, AminoN, HaseT.Loop-mediatedisothermalamplificationofDNA.NucleicA cidsRes.2000Jun15; 28 (12): E63). And reverse transcription-loop-mediated isothermal amplification technology (RT-LAMP) is based on the LAMP RNA detection technique set up, its sensitivity is 100 times of conventional RT-PCR. It is identical with LAMP that RT-LAMP expands principle, but adds reverse transcriptase in reaction system, makes the reverse transcription of RNA and LAMP amplification step in same test tube of cDNA complete. Compared with Standard PCR, RT-LAMP is without processes such as the thermal denaturation of template, temperature cycles, electrophoresis and ultraviolet visualizations, the nucleic acid amplification of a large amount of copy number can be realized in short time, and without high-end instrument and equipment, have high specificity, highly sensitive, be prone to interpretation, can the advantage such as qualitative, quantitative.
Summary of the invention
It is an object of the invention to provide a kind of apple stem grooving virus detection kit and detection method.
In order to realize the purpose of the present invention, in an aspect, the invention provides a kind of apple stem grooving virus detection kit, it is characterised in that including 4 specific primers: outer primer F3, its sequence is such as shown in SEQIDNO:1; Outer primer B3, its sequence is such as shown in SEQIDNO:2; Inner primer FIP, its sequence is such as shown in SEQIDNO:3; Inner primer BIP, its sequence is such as shown in SEQIDNO:4. Primer sequence is specific as follows:
Outer primer F3:TGTTCCTGAATTGAAAACCTT (SEQIDNO:1)
Outer primer B3:CAAAGTCAAATGCAACCCA (SEQIDNO:2)
Inner primer FIP:TCGGCAAAAGGCTCACAAAG-TACTTCTAGGCAAAATTCTTTGAAC (SEQIDNO:3)
Inner primer BIP:CTGGCACGTGAATTTCTTCATGA-TTCTCAAATGCTTTGGGC (SEQIDNO:4).
The concentration of preferred described outer primer F3 and B3 is 5pmol/ �� l, and the concentration of described inner primer FIP and BIP is 40pmol/ �� l.
Further, the test kit of the present invention can also include reaction buffer, AMV reverse transcriptase, BstDNA polymerase and nucleic acid dye, and wherein said reaction buffer is by 10mMdNTP, 10 �� ThermoPol reaction buffer, 5mM glycine betaine and 50mMMgSO4Composition.
Preferred described nucleic acid dye is SYBRGreenI.
Further, the test kit of the present invention can also include RNA extraction reagent and positive control and negative control.
In one aspect of the method, present invention also offers a kind of apple stem grooving virus detection method, it utilizes RT-LAMP technology, comprises the following steps:
(1) testing sample RNA is extracted;
(2) primer is designed and synthesized;
(3) the RT-LAMP reaction system of 25 �� l is set up, it includes the outer primer F31 �� l of 5pmol/ �� l, the outer primer B31 �� l of 5pmol/ �� l, the inner primer FIP1 �� l of 40pmol/ �� l, the inner primer BIP1 �� l of 40pmol/ �� l, reaction buffer 2.5 �� l, 2UAMV reverse transcriptase 1 �� l, 8UBstDNA polymerase 1 �� l, template DNA 2 �� l, add water and be supplemented to 25 �� l, and using apple stem grooving virus genomic DNA as positive control, using 100mMTris-HClpH8.0 and 50mMEDTA as negative control;
(4) LAMP reaction: by PCR pipe in step (3) in 63 DEG C of isothermal reaction 60min;
(5) analysis judges product result: adds 1 �� l nucleic acid dye in (4) in gained product, judges whether apple stem grooving virus according to the color of reactant liquor.
In the detection method of the present invention, the sequence of described outer primer F3 is such as shown in SEQIDNO:1, and the sequence of outer primer B3 is such as shown in SEQIDNO:2, and the sequence of inner primer FIP is such as shown in SEQIDNO:3, and the sequence of inner primer BIP is such as shown in SEQIDNO:4.
Preferred described reaction buffer is by 10mMdNTP, 10 �� ThermoPol reaction buffer, 5mM glycine betaine and 50mMMgSO4Composition.
Preferred described nucleic acid dye is SYBRGreenI, if reactant liquor color is orange, represents that result is negative, without ASGV in testing sample; If reactant liquor color is green, represent that result is positive, containing ASGV in testing sample.
The apple stem grooving virus detection kit of the present invention and detection method utilize RT-LAMP technology, and 4 specific primers are designed in the CP region for ASGV, and it identifies 6 specific regions of ASGV, and specificity and sensitivity are higher. Reaction carries out under isothermal (63 DEG C) condition, do not need the expensive instruments such as circulating instrument, one step completes reverse transcription and amplification step, false positive rate is low, quick, efficient, and gets final product result of determination by visual color change, it is not necessary to the step such as electrophoresis and ultraviolet visualization, identify simplicity, more traditional detection method advantage is notable, it is easy to popularization and application on a large scale, has wide market prospect.
Detailed description of the invention
Following example are used for illustrating the present invention, but are not limited to the scope of the present invention.
Embodiment 1 apple stem grooving virus specific detection
The preparation of 1.1 reagent
Primer is synthesized by TIANGEN Biotech (Beijing) Co., Ltd.; QIAampRNAMiniKit is purchased from Qiagen; BstDNA polymerase and 10 �� ThermoPol reaction buffer are purchased from NEB; AMV reverse transcriptase is purchased from Promega company; SYBRGreenI is purchased from Invitrogen; Reagent needed for all the other PCR reagent and preparation CTAB extraction buffer is purchased from Sigma.
Meanwhile, required reagent in following RT-LAMP reaction is prepared:
Reaction buffer, prepares according to formula as below: 10mMdNTP, 10 �� ThermoPol reaction buffer, 5mM glycine betaine, 50mMMgSO4;
Primer: outer primer F3, its sequence is such as shown in SEQIDNO:l; Outer primer B3, its sequence is such as shown in SEQIDNO:2; Inner primer FIP, its sequence is such as shown in SEQIDNO:3, and inner primer BIP, its sequence is such as shown in SEQIDNO:4. Wherein the concentration of outer primer F3 and outer primer B3 is 5pmol/ �� l, and the concentration of inner primer FIP and inner primer BIP is 40pmol/ �� l.
The AMV reverse transcriptase of 2U;
The BstDNA polymerase of 8U;
Nucleic acid dye: 1000 �� SYBRGreenI;
Positive control: apple stem grooving virus genomic DNA;
Negative control: 100mMTris-HCl (pH8.0) and 50mMEDTA.
1.2RT-LAMP detects
Testing sample includes picking up from indoor tissue cultured seedling 6 strain infecting apple stem grooving virus in Agricultural University Of Hebei's living collection and infecting each 2 strains of indoor tissue cultured seedling of apple chlorotic leaf spot virus, Fructus Mali pumilae rust fruit virus, apple mosaic virus, apple stem pitting virus.
According to following steps, apple stem grooving virus is detected:
(1) QIAampRNAMiniKit is utilized to extract testing sample RNA;
(2) LAMP reaction system is set up: in PCR pipe, prepare 25 �� l reaction systems, the wherein four kinds of each 1 �� l of primer, reaction buffer 2.5 �� l, 2UAMV reverse transcriptase 1 �� l, 8UBstDNA polymerase 1 �� l, step (1) gained template DNA 2 �� l, add water and be supplemented to 25 �� l, and using apple stem grooving virus genomic DNA as positive control, using 100mMTris-HClpH8.0 and 50mMEDTA as negative control;
(3) LAMP reaction: by PCR pipe in step (2) in 63 DEG C of isothermal reaction 60min;
(4) analysis judges product result: add 1 �� l1000 �� SYBRGreenI in (3) in gained product, if reactant liquor color is orange, represents that result is negative; If reactant liquor color is green, represent that result is positive.
1.3 testing results
Infect in the indoor tissue cultured seedling of apple stem grooving virus and the PCR pipe of positive control and all present green, and the colour developing result infecting the PCR pipe of apple chlorotic leaf spot virus, Fructus Mali pumilae rust fruit virus, apple mosaic virus, the indoor tissue cultured seedling of apple stem pitting virus and negative control is orange, it was shown that primer has very strong specificity for apple stem grooving virus.
Embodiment 2 apple stem grooving virus sensitivity technique
2.1RT-LAMP sensitivity technique
Extract the RNA of the indoor tissue cultured seedling infecting apple stem grooving virus according to the step (1) of embodiment 1, and be diluted to 100ng, 10ng, 1ng, 100pg, 10pg, 1pg, 100fg totally 7 gradients with 10 times of concentration series dilution methods.
RT-LAMP reaction system and reaction condition and interpretation of result are with step (2)-(4) of embodiment 1.
2.2 testing results
Except PCR pipe that DNA concentration is 100fg show orange except, the PCR pipe of all the other concentration all presents green, it was shown that the lowest detection limit of the detection method of the present invention reaches 1pgDNA, and sensitivity is significantly high.
Claims (8)
1. an apple stem grooving virus detection kit, it is characterised in that including 4 specific primers: outer primer F3, its sequence is such as shown in SEQIDNO:1; Outer primer B3, its sequence is such as shown in SEQIDNO:2; Inner primer FIP, its sequence is such as shown in SEQIDNO:3; Inner primer BIP, its sequence is such as shown in SEQIDNO:4.
2. test kit according to claim 1, it farther includes reaction buffer, AMV reverse transcriptase, BstDNA polymerase and nucleic acid dye.
3. test kit according to claim 2, wherein said reaction buffer is by 10mMdNTP, 10 �� ThermoPol reaction buffer, 5mM glycine betaine and 50mMMgSO4Composition.
4. test kit according to claim 2, wherein said nucleic acid dye is SYBRGreenI.
5. test kit according to claim 1 and 2, it farther includes RNA and extracts reagent and positive control and negative control.
6. an apple stem grooving virus detection method, it comprises the following steps:
(1) testing sample RNA is extracted;
(2) primer is designed and synthesized;
(3) the RT-LAMP reaction system of 25 �� l is set up, it includes the outer primer F31 �� l of 5pmol/ �� l, the outer primer B31 �� l of 5pmol/ �� l, the inner primer FIP1 �� l of 40pmol/ �� l, the inner primer BIP1 �� l of 40pmol/ �� l, reaction buffer 2.5 �� l, 2UAMV reverse transcriptase 1 �� l, 8UBstDNA polymerase 1 �� l, template DNA 2 �� l, add water and be supplemented to 25 �� l, and using apple stem grooving virus genomic DNA as positive control, using 100mMTris-HClpH8.0 and 50mMEDTA as negative control;
(4) LAMP reaction: by PCR pipe in step (3) in 63 DEG C of isothermal reaction 60min;
(5) analysis judges product result: adds 1 �� l nucleic acid dye in (4) in gained product, judges whether apple stem grooving virus according to the color of reactant liquor.
7. detection method according to claim 6, the sequence of wherein said outer primer F3 is such as shown in SEQIDNO:1, the sequence of outer primer B3 is such as shown in SEQIDNO:2, and the sequence of inner primer FIP is such as shown in SEQIDNO:3, and the sequence of inner primer BIP is such as shown in SEQIDNO:4.
8. apple stem grooving virus RT-LAMP detection method according to claim 6, wherein said reaction buffer is by 10mMdNTP, 10 �� ThermoPol reaction buffer, 5mM glycine betaine and 50mMMgSO4Composition.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610125351.4A CN105648117A (en) | 2016-03-07 | 2016-03-07 | Apple stem grooving virus detection kit and method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610125351.4A CN105648117A (en) | 2016-03-07 | 2016-03-07 | Apple stem grooving virus detection kit and method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105648117A true CN105648117A (en) | 2016-06-08 |
Family
ID=56492238
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610125351.4A Pending CN105648117A (en) | 2016-03-07 | 2016-03-07 | Apple stem grooving virus detection kit and method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105648117A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101016571A (en) * | 2007-03-09 | 2007-08-15 | 大连大学 | PCR detection kit for fruit tree main virus and using method |
| CN102634608A (en) * | 2012-04-18 | 2012-08-15 | 西北农林科技大学 | Method for detecting apple viruses by adopting reverse transcription loop-mediated isothermal amplification technology |
| CN103382508A (en) * | 2013-07-12 | 2013-11-06 | 西南大学 | Method for synchronous detection of 4 apple viruses and viroid |
| CN104561358A (en) * | 2015-02-02 | 2015-04-29 | 邓继红 | LAMP detection kit and detection method for dendrobium officinale-phytophthora nicotianae |
-
2016
- 2016-03-07 CN CN201610125351.4A patent/CN105648117A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101016571A (en) * | 2007-03-09 | 2007-08-15 | 大连大学 | PCR detection kit for fruit tree main virus and using method |
| CN102634608A (en) * | 2012-04-18 | 2012-08-15 | 西北农林科技大学 | Method for detecting apple viruses by adopting reverse transcription loop-mediated isothermal amplification technology |
| CN103382508A (en) * | 2013-07-12 | 2013-11-06 | 西南大学 | Method for synchronous detection of 4 apple viruses and viroid |
| CN104561358A (en) * | 2015-02-02 | 2015-04-29 | 邓继红 | LAMP detection kit and detection method for dendrobium officinale-phytophthora nicotianae |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110567951B (en) | Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof | |
| CN104762409A (en) | Method for detecting pseudomonas syringaepv altinidia through recombinase-mediated isothermal amplification technology | |
| CN105238876B (en) | LAMP primer group and its application method for tobacco ralstonia solanacearum detection | |
| ji Cho et al. | Development of a multiplex PCR method to detect fungal pathogens for quarantine on exported cacti | |
| CN111676296A (en) | Test strip RPA primer for detecting potato rot stem nematode and detection kit thereof | |
| CN104561278A (en) | Detection primer, detection kit and detection method for watermelon wilt disease fungi | |
| CN104593502A (en) | Loop-mediated isothermal amplification primer composition capable of detecting colletotrichum truncatum and application thereof | |
| CN103074447A (en) | Establishment of PCR-HRM analysis method for rapid differential diagnosis of different serotypes of avian leukemia viruses | |
| Khurana et al. | Recent developments towards detection & diagnosis for management of plant viruses | |
| Shi et al. | Molecular detection and quantification of Xanthomonas albilineans in juice from symptomless sugarcane stalks using a real-time quantitative PCR assay | |
| CN113249503B (en) | LAMP primer group and method for detecting haemolytic mannheimia | |
| CN113025724B (en) | Dual PCR primer, method and kit for identifying small pissodes punctatus | |
| CN112176080B (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| CN105648117A (en) | Apple stem grooving virus detection kit and method | |
| CN113667776A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) method for detecting plantain mosaic virus in lily | |
| CN112280890A (en) | Primer and probe combination for detecting peronophythora litchi based on RPA-lateral flow chromatography technology and detection method thereof | |
| CN112063759A (en) | RT-LAMP primer, kit and detection method for simultaneously detecting multiple viruses of banana | |
| CN111808992A (en) | Hot pepper vein mottle virus polygene joint detection and identification method | |
| CN105543417A (en) | Detection kit and detection method for ACLSV (apple chlorotic leaf spot virus) | |
| CN113322353B (en) | RPA kit for detecting sweet potato pinnate mottle virus and sweet potato chlorotic stunt virus | |
| CN105861745B (en) | A kind of virus detection kit and detection method | |
| CN109295256A (en) | The real-time fluorescence quantitative RT-PCR detection method and kit of Grapevine virus A | |
| CN114703313B (en) | Wild rice black powder fungus typing identification method and application thereof | |
| CN104164486B (en) | The LAMP detection kit of the shrivelled pathogen of a kind of Eucalyptus and using method thereof | |
| CN105671200A (en) | Detection kit for identifying fusarium sporotrichioides in food and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160608 |