CN105641682B - A kind of bifidobacterium longum protein is used to be promoted the application of salmonella typhimurium Antibiotic Sensitivity - Google Patents

A kind of bifidobacterium longum protein is used to be promoted the application of salmonella typhimurium Antibiotic Sensitivity Download PDF

Info

Publication number
CN105641682B
CN105641682B CN201610107536.2A CN201610107536A CN105641682B CN 105641682 B CN105641682 B CN 105641682B CN 201610107536 A CN201610107536 A CN 201610107536A CN 105641682 B CN105641682 B CN 105641682B
Authority
CN
China
Prior art keywords
bifidobacterium longum
protein
antibiotic
added
salmonella typhimurium
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201610107536.2A
Other languages
Chinese (zh)
Other versions
CN105641682A (en
Inventor
徐锋
魏华
杨栋
武晓丽
蔚晓敏
吴姚平
沙霈霈
懂翎逸
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanchang University
Original Assignee
Nanchang University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanchang University filed Critical Nanchang University
Priority to CN201610107536.2A priority Critical patent/CN105641682B/en
Publication of CN105641682A publication Critical patent/CN105641682A/en
Application granted granted Critical
Publication of CN105641682B publication Critical patent/CN105641682B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/429—Thiazoles condensed with heterocyclic ring systems
    • A61K31/43—Compounds containing 4-thia-1-azabicyclo [3.2.0] heptane ring systems, i.e. compounds containing a ring system of the formula, e.g. penicillins, penems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
    • A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
    • A61K31/7036—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin having at least one amino group directly attached to the carbocyclic ring, e.g. streptomycin, gentamycin, amikacin, validamycin, fortimicins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/164—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The present invention provides a kind of attachment proteins from bifidobacterium longum, and specify its amino acid sequence；Experiment finds that the attachment proteins can not only be adhered to enterocyte on this basis, and has the function of promoting microbial antibiotic sensibility, and especially to salmonella typhimurium, this antibiotic synergistic effect is especially prominent.Based on this beneficial discovery, it is determined that purposes of the albumen as the antibacterial synergist of salmonella typhimurium to extend its scope of use, while providing a kind of new way for promoting microorganism medicine sensitive.The present invention is based on rigorous laboratory facilities to obtain technical effect outstanding, has broad application prospects.

Description

A kind of bifidobacterium longum protein is quick to antibiotic for promoting salmonella typhimurium The application of perception
Technical field
The present invention relates to microorganisms technical fields, and in particular to a kind of bifidobacterium longum protein is husky for promoting mouse typhus The application of door Salmonella Antibiotic Sensitivity.
Background technique
Bifidobacterium is well-known as beneficial bacteria of intestinal tract, in recent years for its enteron aisle prebiotic effect the study found that bifid Certain metabolites of bacillus are able to suppress other microorganisms in the field planting of inner wall of intestine, and then reduce the infringement of pathogenic microorganism Risk.The important evidence that this feature has become screening bifidobacterium species at present, researches and develops functional probiotics microbial inoculum.
The prior art is the study found that Bifidobacterium is mainly logical in the suppression mechanism of inner wall of intestine to other Microorganism colonizations Crossing secretion organic acid reduces gut pH, adjusts intestine microenvironment, while secreting ectoenzyme to influence pathogenic bacteria or thin Verticillium toxin sticks site and its specific receptor.In addition, thering is scholar to think in recent years, by Bifidobacterium themselves in enteron aisle The occupation time process and space steric effect caused may be a key factor for hindering pathogenic bacteria to stick and invade.Stick egg The white important factor sticked as Bifidobacterium and be colonized in GI epithelium, material base, metabolic characteristic are in the prior art In there is no clear conclusion,
It whether is exactly thallus although once there is the Bifidobacterium of adhesiveness to express albumen for report part in the prior art The functional materials for being colonized in inner wall of intestine are still not clear；In addition, on the basis for clearly obtaining a kind of Adhesion of Bifidobacteria albumen On, to realize further application, expression quantity, purification efficiency should be optimized；Again, for Adhesion of Bifidobacteria egg It is white, its biological characteristics should be further studied, so that other purposes for the attachment proteins lay the foundation.
Bifidobacterium longum (Bifidobacterium longum) is one kind of Bifidobacterium, belongs to Gram-positive, nothing Gemma does not move, anaerobic bacillus, is widely present in the enteron aisle of human body especially baby, belongs to drug, microecological microbial agent preparation One of the conventional bacterial classification in field.
Summary of the invention
The present invention is directed to be directed to the technological deficiency of the prior art, a kind of bifidobacterium longum protein is provided for promoting mouse wound The application of cold salmonella Antibiotic Sensitivity, to solve, there are offices for bifidobacterium longum protein application range in the prior art Sex-limited technical problem.
Another technical problem to be solved by the present invention is that salmonella typhimurium have to the sensibility of antibiotic it is to be hoisted.
To realize the above technical purpose, the invention adopts the following technical scheme:
A kind of bifidobacterium longum protein, amino acid sequence is as shown in SEQ ID NO:1.
A kind of preparation method of above-mentioned bifidobacterium longum protein, comprising the following steps:
1) the expression of recombinant e. coli bacterial strain of bifidobacterium longum protein is prepared；
2) the expression of recombinant e. coli bacterial strain of step 1) the bifidobacterium longum protein is taken to be cultivated, until culture solution Inducer IPTG to final concentration of 0.8~1.2mM is added when OD600nm is 0.6~0.9, then in 35~39 DEG C, concussion condition 4~5h of lower Fiber differentiation；
3) thallus, broken, collection supernatant are collected；
4) step 3) supernatant is taken, using GST affinitive layer purification, is concentrated by ultrafiltration after collecting eluent, desalination, it is dry, Obtain the bifidobacterium longum protein.
Preferably, broken described in step 3) is after thallus is resuspended in PBS buffer solution, ultrasound is broken under condition of ice bath Broken 20~30 times, the broken duration is 2~4s every time, every 2 times it is broken between time interval be 4~6s.
Preferably, step 4) specifically includes following operation:
A) buffer solution A is taken, glutathione Sepharose resin column is balanced with the flow velocity of 2.5~3.5mL/min；
B) step 2) supernatant is taken, with the flow velocity loading of 1~2mL/min；
C) buffer solution B is taken, is eluted with the flow velocity of 0.8~1.2mL/min, collecting solution at eluting peak is eluent；
D) it takes eluent to be concentrated by ultrafiltration, then crosses desalting column, pure water is recycled to elute with the flow velocity of 2.5~3.5mL/min, Collecting solution at eluting peak is the second eluent, is then freeze-dried to get the bifidobacterium longum protein is arrived；
Wherein the buffer solution A is the PBS buffer solution containing 1.5~2.5mM EDTA；
The buffer solution B is the PBS buffer solution containing 1.5~2.5mM EDTA, 15~25mM glutathione；It is further excellent Choosing, the buffer solution A dosage in step a) for balancing glutathione Sepharose resin column is 25~35mL, more optimizedly 30mL。
Preferably, concussion described in step 1) is the shaking table culture of 150~200r/min revolving speed, more optimizedly The shaking table culture of 180r/min revolving speed.
Amino acid sequence protein as shown in SEQ ID NO:1 is for promoting salmonella typhimurium to antibiotic sensitive The application of property；It is further preferred that being application of the above-mentioned bifidobacterium longum protein as the antibacterial synergist of antibiotic.
Preferably, the antibiotic is beta-lactam antibiotic；It is further preferred that the beta-lactam antibiosis Element can be ampicillin, benzyl penicillin or cephalosporin.
Preferably, the antibiotic is aminoglycoside antibiotics；It is further preferred that the aminoglycoside antibiosis Element is kanamycins.
Preferably, the antibiotic is amphenicols antibiotic；It is further preferred that the amphenicols antibiotic is Chloramphenicol.
Preferably, the application using be 45~55 μ g/mL containing concentration, amino acid sequence is SEQ ID NO: 1 protein solution handles salmonella typhimurium with the way of contact；It is further preferred that salmonella typhimurium processed Concentration in the protein solution is 106CFU/mL；It is further preferred that the processing time is 1.5~2.5h.
In above technical scheme, the sensibility refers to the degree that microorganism is inhibited by antibiotic, described to promote micro- life Object Antibiotic Sensitivity refers to after being incubated for microorganism using the medium containing bifidobacterium longum protein of the present invention, processed Microorganism fungistatic effect under antibiotic effect is more significant.The bifidobacterium longum protein is to illustrate to be somebody's turn to do under natural environment Albumen source does not constitute the restriction effect to the DNA techniques feature in bifidobacterium longum；In the present invention, the albumen The technical characteristic of matter is only limited by its sequence.The expression of recombinant e. coli bacterial strain of the bifidobacterium longum protein, refers to whole Close the recombination bacillus coli for having the natural expressing gene of bifidobacterium longum of the present invention；It is total that preparation method generally includes bifidobacterium longum The extraction of DNA, the amplification of target gene, the purifying of amplified production, the digestion of target gene and carrier, connection, recombinant vector to Importing in Escherichia coli, the screening of recon and etc.；Practical preparation method can according to this field general technology common sense into Row adaptability design.
As it was noted above, the present invention can be used for being promoted microorganism to the sensibility of antibiotic.But utilize the long bifid of the present invention Treated that substance not necessarily gives antibiotic treatment for thuringiensis protein, and when giving antibiotic treatment, processing method can Use following scheme: ampicillin activity is 1~50 μ g/mL；Benzyl penicillin activity is 1~50 μ g/mL；Cephalo Mycin activity is 1~50 μ g/mL；Kanamycins activity is 1~25 μ g/mL；Chloramphenicol activity is 1~25 μ g/mL。
The present invention provides a kind of attachment proteins from bifidobacterium longum, and specify its amino acid sequence；Herein On the basis of obtain the expression bacterial strain of one plant of albumen based on genetic engineering technology, and for the characteristic of bacterial strain and attachment proteins from Inducing expression, chromatographic purifying, ultrafiltration concentration etc. carry out innovative design, and then obtain the efficient system of above-mentioned attachment proteins Preparation Method.Further, experiment finds that the attachment proteins can not only be adhered to enterocyte, and has and promote microorganism The effect of antibiotics sensitivity, based on this beneficial discovery, it is determined that purposes of the albumen as the antibacterial synergist of antibiotic, To extend its scope of use, while providing a kind of new way for promoting microorganism medicine sensitive.The present invention is based on rigorous Laboratory facilities obtain technical effect outstanding, have broad application prospects.
Detailed description of the invention
Fig. 1 is the expression and purification electrophoresis detection figure of bifidobacterium longum specific proteins AIP2 in the embodiment of the present invention 1；In figure Swimming lane M is Protein Marker (12-80kDa)；Swimming lane 1 is E.coli pGEX-4T-1 expression product (control)；Swimming lane 2 is AIP2 albumen after purification；Swimming lane 3 is E.coli pGEX-4T-AIP2 fusion protein expression products.
Fig. 2 is that bifidobacterium longum specific proteins AIP2 promotes 3 kinds of common food-borne pathogens pair in the embodiment of the present invention 5 The experimental result picture of ampicillin-sensitive；Part A is bifidobacterium longum specific proteins AIP2 to monokaryon hyperplasia Lee in figure The exercising result of this special bacterium；Part B is bifidobacterium longum specific proteins AIP2 to Escherichia coli O 157: the exercising result of H7；C Part is exercising result of the bifidobacterium longum specific proteins AIP2 to salmonella typhimurium.
Fig. 3 is that bifidobacterium longum specific proteins AIP2 promotes 3 kinds of common food-borne pathogens pair in the embodiment of the present invention 6 Benzyl penicillin, cephalosporin, kanamycins, chloramphenicol sensitivity experimental result picture.
Specific embodiment
Below by specific embodiments of the present invention will be described in detail.In order to avoid excessive unnecessary details, It will not be described in detail in following embodiment to belonging to well known structure or function.
Approximating language used in following embodiment can be used for quantitative expression, show in the feelings for not changing basic function Quantity is allowed to have certain variation under condition.Therefore, this is not limited to accurately with the modified numerical value of the language such as " about ", " left and right " institute Numerical value itself.In some embodiments, the range for allowing its modified numerical value in positive and negative 10 (10%) " about " is indicated Interior variation, for example, any numerical value that can be between 90 to 110 that " about 100 " indicate.In addition, " the about first numerical value arrives In the statement of second value ", the first and second numerical value two values are at about corrected.In some cases, approximating language It may be related with the precision of measuring instrument.
In addition to being defined, technical and scientific term used in following embodiment has and fields technology people of the present invention The identical meanings that member is commonly understood by.
Test reagent consumptive material used in following embodiment is unless otherwise specified conventional biochemical reagent；The experiment Method is unless otherwise specified conventional method；Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result It is averaged；% in following embodiment is unless otherwise instructed mass percentage.
Embodiment 1 (the expression of recombinant e. coli bacterial strain for preparing bifidobacterium longum protein)
1.1 experimental material
1.1.1 bacterial strain and carrier
Bifidobacterium longum, bacillus coli DH 5 alpha, vector pGEX -4T-1 are bought from market.
1.1.2 common agents
(1) TE buffer (pH 8.0): 10mmol/L Tris-HCl (pH 8.0), 1mmol/L EDTANa2(pH 8.0).With postponing high pressure sterilization, room temperature storage.
(2) 10mg/mL lysozyme: 100mg lysozyme is dissolved in 10mL ddH2In O, -20 DEG C are saved backup.
(3) 10%SDS:5g SDS adds ddH2O dissolution is settled to 50mL.
(4) 3M KAc:14.72g KAc is dissolved in ddH2In O and it is settled to 50mL.
(5) 3M NaAc:12.35g NaAc is dissolved in ddH2In O and it is settled to 50mL.
(6)0.1M CaCl2: 11.1g CaCl2It is dissolved in 1000mL ddH2In O, 121 DEG C of high pressure sterilization 15min, in 4 DEG C It saves.
(7) 50 × TAE electrophoresis buffer:12.2g Tris, 2.85mL glacial acetic acid, 10mL 0.25mol/L EDTA (pH 8.0), add ddH2O dissolution is settled to 50mL.
(8) 6 × loading buffer (sample-loading buffer): 0.25% dimethylbenzene blueness FF, 0.25% bromophenol blue, 30% is sweet Oil.
1.1.3 often using culture medium
(1) MRS culture medium: beef extract 3g, yeast powder 5g, Tween 80 1mL, MgSO4·7H2O 0.6406g, K2HPO4 5g, glacial acetic acid 4.3mL, MnSO4·H2O 0.13g, peptone 7g, glucose 20g, sodium acetate 5g , Shi peptone 7g, ammonium citrate 2g, L-cysteine 0.5g, adds ddH2O to 1000mL, adjusting pH is 6.5, then 115 DEG C of high pressure sterilization 15min.
(2) LB liquid medium: yeast extract 5g, peptone 10g, NaCl 10g add ddH2O to 1000mL adjusts pH extremely 7.0,121 DEG C of high pressure sterilization 15min.
(3) preparation of LB plate: agar powder is added by 1.5% (w/v) in LB liquid medium, after 121 DEG C of high pressure sterilizations Inverted plate.
(4) preparation of LB/Amp (Ampicillin, ampicillin) plate: 1.5% (w/v) is pressed in LB liquid medium Agar powder is added, non-scald on hand (about 50 DEG C) are then cooled to after 121 DEG C of high pressure sterilizations, the Amp of 100mg/mL is added to final concentration For 50 μ g/mL, inverted plate after mixing, be placed in superclean bench dry it is spare.
1.2 experimental method
1.2.1 the extraction and detection of bifidobacterium longum genomic DNA
1.2.1.1 the extraction of Bifidobacterium genomic DNA
The genomic DNA of bifidobacterium longum is extracted, this experiment uses " lysozyme-SDS- potassium acetate " method, and specific method is such as Under:
(1) Bifidobacterium is inoculated in the test tube for filling MRS fluid nutrient medium, stands Anaerobic culturel under the conditions of 37 DEG C 24h。
(2) Bifidobacterium that middle bottom of the tube is pipetted with 1mL suction pipe, is placed in 2mL centrifuge tube.
(3) it is centrifuged (4500rpm, 5min), abandons supernatant, remaining tube bottom about 0.1g wet thallus.
(4) plus 1mL TE (pH 8.0) resuspension washed once, and is centrifuged (4500rpm, 5min), abandons supernatant.
(5) lysozyme of 0.7mL TE (pH 8.0) and 0.1mL 10mg/mL is added, is blown and beaten with pipettor, keeps thallus equal It is even to be suspended in solution.
(6) 40 DEG C of water-bath effect 3h are set, are during which mixed by inversion for several times.
(7) it is rapidly added 0.1mL 10%SDS, 40 DEG C of water-baths of even postposition up and down act on 1h.
(8) it is centrifuged (10000rpm, 5min, 4 DEG C), pipettes 0.5mL supernatant in new 2mL centrifuge tube, abandon precipitating.
(9) KAc (3M) of 0.1mL (about 1/6 volume) ice pre-cooling is added, sets ice-water bath 15min.
(10) it is centrifuged (12000rpm, 10min, 4 DEG C), pipettes 400 μ L supernatants in new 2mL centrifuge tube, abandon precipitating.
(11) chloroform of isometric (400 μ L) is added: isoamyl alcohol (24:1) is stripped, mixing of gently turning upside down, Stand 3min.
(12) it is centrifuged (12000rpm, 5min, 4 DEG C), draws supernatant in new 2mL centrifuge tube.
(13) the anhydrous of the pre-cooling of the NaAc (3M) and 880 μ L (2 times of volumes) of the pre-cooling of 40 μ L (1/10 volume) ice is added Ethyl alcohol, it is even up and down to be placed on -20 DEG C of freezing 30min.
(14) it is centrifuged (12000rpm, 10min, 4 DEG C), removes supernatant.
(15) 75% ethanol washing of 400 μ L pre-cooling is added.
(16) it is centrifuged (12000rpm, 10min, 4 DEG C), removes supernatant, and keep ethyl alcohol volatilization clean.
(17) 40 μ L TE dissolution precipitating is added.
(18) RNaseA (final concentration of 50 μ g/mL) is added, 37 DEG C of water-bath 1h.
(19) -20 DEG C save backup.
1.2.1.2 agarose gel electrophoresis
(1) glue:
It weighs 0.25g agarose to be put into 150mL triangular flask, it is molten that 1 × TAE of 25mL moderate heat heating in micro-wave oven is added Solution is at gel solution.Electrophoresis mold and sample comb are installed, a small amount of gel solution is taken to shut electrophoresis both mold ends, 2 μ L are added DNA coloring matter GoldView dyestuff, pours into mold after mixing, pays attention to not can produce bubble.
(2) loading electrophoresis:
1 × TAE electrophoresis buffer is held in electrophoresis tank.Electrophoresis mold is put into electrophoresis tank after being gelled admittedly, then It is careful to take out sample comb.Loading after 6 × loading buffer is mixed, correct connection electrode, agarose is added in separately sampled product The loading wells of gel carries out electrophoresis under 5V/cm constant-pressure conditions, stops electrophoresis after 20min, gel is put into gel close to cathode Imaging system is imaged, is analyzed.
1.2.2AIP2 the amplification of gene
Upstream primer: 63.4 DEG C of TTCGAATTCGTGAAAACTTTCACTCCGAAGCC EcoR I
Downstream primer: 63.3 DEG C of CGCGCGGCCGCTTGGCCTGCTGCGAGAC Not I
1 PCR reaction system of table
Reaction solution is mixed with liquid-transfering gun, is slightly centrifuged, covers tightly lid, after pipe is covered and marked with marking pen, according to table 2 Shown program in PCR instrument in being expanded.
2 PCR response procedures of table
PCR uses 1.0% agarose gel electrophoresis to detect PCR product after reaction.Take 5 μ L PCR products and 1 μ L 6 × Loading buffer is mixed, and is clicked and entered in Ago-Gel loading hole, is control with DNA Marker (DL2000), in DNA 5V/cm constant pressure electrophoresis 30min in Horizontal electrophoresis tank.Gel gel imaging system is put into after electrophoresis to be imaged, analyze.
1.2.3PCR the purifying of product
Using the PCR product purification kit of Beijing SBS Genetech gene technology Co., Ltd, PCR product is purified, Specific step is as follows:
(1) by the PCR reaction product of no paraffin oil on 1% plain agar sugar gel electrophoresis, cut required DNA item Band is fitted into 2mL centrifuge tube.The Ago-Gel without DNA is cut away as far as possible.
0.4mL Purification Resin (mixing well before use) is added in (2) 200~400mg Ago-Gels, 70 DEG C of heat preservations 5 ~10min, every 2min are mixed by inversion 1 time, melt Ago-Gel completely.
(3) mixed liquor is transferred to centrifugal purification column, 13000rpm is centrifuged 30s, outwells the waste liquid in collecting pipe.
(4) 500 μ L, 80% ethyl alcohol is added, 13000rpm is centrifuged 30s, outwells the waste liquid in collecting pipe.
(5) previous step is repeated, this step 13000rpm is centrifuged 2min, ethyl alcohol is eliminated.
(6) centrifugal purification column sleeve is entered in clean 1.5mL or 2mL centrifuge tube, uncap 2~3min of placement, must make second Alcohol sufficiently volatilizees completely.30 μ L ddH are added2O is on Purification Resin.After placing 2min, 13000rpm is centrifuged 30s.
(7) liquid in centrifuge tube is the DNA fragmentation of purifying, takes 1 μ L electrophoresis detection.- 20 DEG C save backup.1.2.4 The digestion of target fragment and carrier is handled
After target fragment recycling, the digestion of target fragment and carrier is carried out, prepares digestion system, two digestions referring to table 3 System is placed in 37 DEG C of heat preservation 1.5h.
3 digestion system of table
1.2.5 the connection of target gene and vector pGEX -4T-1
Reference method 2.2.3, by the segment and carrier recovery after digestion, recovery product prepares connection reaction according to by table 4 System, 22 DEG C of connection 30min.
4 coupled reaction system of table
1.2.6 conversion
1.2.6.1 the preparation of competent cell
Bacillus coli DH 5 alpha is taken to prepare competent cell, the specific method is as follows:
(1) take -70 DEG C of bacillus coli DH 5 alpha streak inoculations frozen in non-resistant LB plate, in 37 DEG C of overnight incubations.
(2) the well-grown single colonie of picking is inoculated in 5mL LB liquid medium, is placed in 37 DEG C of shaking table 180rpm vibrations Swing overnight incubation.
(3) bacterium solution for staying overnight activation culture by 1% inoculum concentration is forwarded to the triangle of the LB liquid medium containing 100mL In bottle (500mL), 37 DEG C of shaking table 180rpm shaken cultivations to OD600It is 0.4~0.6.
(4) triangular flask is placed in ice water after standing 10min, is centrifuged (5000rpm, 10min, 4 DEG C), abandons supernatant.
(5) the 0.1M CaCl of 50mL ice pre-cooling is added2, thallus is gently dispelled with pipettor, then ice bath 10min.
(6) it is centrifuged (5000rpm, 10min, 4 DEG C), abandons supernatant, the 0.1M CaCl of 25mL ice pre-cooling is added2, use pipettor Thallus is gently dispelled, ice-water bath 10min.
(7) it is centrifuged (5000rpm, 10min, 4 DEG C), abandons supernatant, the 0.1M CaCl of 2mL ice pre-cooling is added2, add and sterilized Glycerol to final concentration of 10%, mixed gently with pipettor, every 200 μ L of pipe packing.
(8) -70 DEG C freeze it is spare.
1.2.6.2 connection product is transformed into competent cell
Connection product is transformed into DH5 α Bacillus coli cells.Specific step is as follows:
(1) LB/Amp plate is prepared.
(2) take 200 μ L competent cells be placed in ice water bathe it is cold.
(3) 5 μ L connection products are added into competent cell suspension, gently rotating centrifugal pipe is to mix content, in ice 30min is stood in bath.
(4) centrifuge tube is placed in 42 DEG C of water-bath heat shock 90s, then centrifuge tube is transferred in ice bath rapidly, keeps cell cold But 2min, the process not shake centrifuge tube.
(5) sterile LB medium (being free of antibiotic) of 37 DEG C of 1mL preheatings is added into each centrifuge tube, mixes postposition In 37 DEG C of shaking table 150rpm shaken cultivation 40min.
(6) centrifuge tube content is mixed, draws the competent cell that 500 μ L have been converted, is added to LB/Amp agar plate On culture medium, it is coated with sterile spreading rod uniform.Plate is placed in room temperature until liquid is absorbed, inversion is trained in 37 DEG C of incubators Support 12~16h.
1.2.7 the verifying of positive clone molecule
1.2.7.1 bacterium colony PCR is verified
With toothpick, picking individual colonies carry out bacterium colony PCR verifying (bacterium colony PCR system and PCR program point from plating medium It is not shown in Table 5 and table 6), and toothpick is put into the LB liquid medium for containing final concentration of 100 μ g/mL Amp to 5mL, 37 DEG C Shaking table 180rpm shaken cultivation 12h.
5 bacterium colony PCR reaction system of table
6 bacterium colony PCR response procedures of table
1.2.7.2 the extraction of recombinant plasmid
It takes bacterium colony PCR to be verified as positive correspondence bacterium solution, weight is extracted using EasyPure Plasmid MiniPrep Kit Group Plasmid DNA.The specific method is as follows:
(1) bacterium solution that is incubated overnight of 1~4mL is taken, 10000g is centrifuged 1min, as far as possible exhaustion supernatant.
(2) 250 μ L colourless solution RB (A containing RNase) are added, concussion suspension thalline precipitates, should not there are small fungus blocks.
(3) 250 μ L blue solution LB are added, leniently spins upside down mixing 4~6 times, cracks thallus sufficiently, are formed blue The bright solution of color, color from half it is bright become bright blue, indicate cracking completely (no more than 5min).
(4) 350 μ L yellow solution NB are added, being gently mixed 5~6 times, (color is turned yellow completely by blue, instruction mixing Uniformly, neutralize complete), until the yellow for forming consolidation is aggregated block, it is stored at room temperature 2min.
(5) 15000g is centrifuged 5min, and careful supernatant of drawing is added in adsorption column.
(6) 15000g is centrifuged 1min, abandons efflux.
(7) 650 μ L solution W B, 15000g are added and are centrifuged 1min, abandon efflux.
(8) 15000g is centrifuged 1~2min, completely removes remaining WB.
(9) adsorption column is placed in a clean centrifuge tube, 30 μ L EB or ddH is added in the center of column2After O, room temperature is quiet Set 1min.
(10) 1000g is centrifuged 1min, eluted dna, and the DNA eluted is saved in -20 DEG C.
1.2.7.3 double digestion recombinant plasmid identifies Insert Fragment size
It selects restriction enzyme site EcoR I and the Not I of recombinant plasmid multiple cloning sites two sides to carry out double digestion to plasmid, tests Demonstrate,prove target fragment size.Endonuclease reaction system is prepared by table 7.The condition of endonuclease reaction: 37 DEG C, 4h.
7 endonuclease reaction system of table
Using the effect of 1% agarose gel electrophoresis detection plasmid enzyme restriction, gel is put into gel imaging after electrophoresis System imaging, analysis.
1.2.7.4 sequence verification and analysis
It is positive bacterial strain sequencing by preliminary screening, after verifying is correct, naming the recombinant plasmid is pGEX-4T-AIP2, life The name recombination bacillus coli is E.coli DH5 α pGEX-4T-AIP2.
Embodiment 2 (expression and purity of bifidobacterium longum adhesion protein)
Step 1: the inducing expression of bifidobacterium longum adhesion protein
Bifidobacterium longum adhesion protein expression bacterial strain E.coli DH5 α pGEX-4T-AIP2 prepared by Example 1 is used IPTG carries out inducing expression, the specific steps are as follows:
(1) the bacterial strain single colonie of picking plate streaking culture, is seeded in 3ml LB liquid medium, and in test tube Amp to final concentration of 100 μ g/ml is added, cultivates 8h in 37 DEG C of constant temperature culture oscillator 180r/m.
(2) it is forwarded to 20ml less salt LB liquid medium by 1% inoculum concentration, Amp to final concentration of 100 μ g/ml is added, It is cultivated in 37 DEG C of constant temperature culture oscillator 180r/m.
(3) when cell density OD600nm=0.6-0.9, inducer IPTG to final concentration of 1mM is added, in 37 DEG C of perseverances Temperature culture oscillator 180r/m Fiber differentiation 4-5h.
(4) bacterium solution equivalent is transferred to two 50ml centrifuge tubes after Fiber differentiation, 4 DEG C, 5000r/m is centrifuged 8min, in abandoning Clearly.It is separately added into 10mlPBS buffer and washing thalline precipitating is resuspended, 5000r/m is centrifuged 8min, abandons supernatant, the centrifugation of 10ml bacterium solution 3ml PBS buffer solution is added in gained thallus to be resuspended, ice-bath ultrasonic (180W, work 3s, gap 5s) is 20-30 times broken, until bacterium Liquid clear.
(5) acquired solution is dispensed by 1mL/ pipe, and -20 DEG C save backup.
Step 2: SDS-PAGE detection expression albumen
Using the inducing expression situation of PAGE gel electrophoresis detection adhesion protein, the specific steps are as follows:
(1) each 100 μ l of gained sample in the first step is taken respectively, and 4 DEG C, 13000r/m is centrifuged 5min, takes 5 μ l supernatants respectively 2 × sds gel sample-loading buffer of equivalent is added, mixes spare.
(2) sample is boiled to loading after 6min in 100 DEG C of boiling water baths, by 80V, 25-35min+140V, 1-1.5h electrophoresis.
(3) after electrophoresis, gel is taken to be placed in sds gel dyeing liquor, room temperature horizontal shaker shakes dyeing 4-6h.
(4) dyeing liquor is recycled, after distilled water flushing gel, appropriate destainer is added, room temperature shaker shakes decoloration 6-8h, It replaces destainer 2-3 times therebetween.Observation analysis electrophoresis result.
Step 3: the affinity purification of Bifidobacterium adhesion protein
Using GST affinity chromatography column purification destination protein, steps are as follows:
(1) balance of glutathione resin prepacked column: chromatographic column is carried out using the buffer solution A (PBS+2mMEDTA) of 30ml Balance, coutroi velocity are 3mL/min or so.
(2) combination of fusion protein and chromatographic column: by clear cell crude extract loading, coutroi velocity 1-2mL/min Left and right.
(3) elution of fusion protein: buffer solution B (PBS+2mMEDTA+20mM glutathione) is used after curve smooth decreasing Destination protein is eluted, coutroi velocity 1ml/min, collects eluting peak.
(4) protein concentrate: using super filter tube concentrate eluant, crosses desalting column, pure water elution, and coutroi velocity 3mL/min takes Eluting peak solution after vacuum freeze drying, takes to be partly dissolved and carries out SDS-PAGE electroresis appraisal.Qualification result is as shown in Figure 1.
Embodiment 2 (method of producing protein that a kind of amino acid sequence is SEQ ID NO:1)
1) recombination bacillus coli E.coli DH5 α pGEX-4T-AIP2 is taken to cultivate, until culture solution OD600nm adds when being 0.6 Enter inducer IPTG to final concentration of 0.8mM, then the Fiber differentiation 4h under the conditions of 35 DEG C, concussion；
2) thallus is collected, after thallus is resuspended in PBS buffer solution, ultrasonication 20 times is (broken every time under condition of ice bath Duration be 2s, every 2 times it is broken between interval time be 4s), then collect supernatant；
3) buffer solution A is taken, glutathione Sepharose resin column is balanced with the flow velocity of 2.5mL/min；Step 2) supernatant is taken, With the flow velocity loading of 1mL/min；Buffer solution B is taken, is eluted with the flow velocity of 0.8mL/min, collecting solution at eluting peak is to elute Liquid；It takes eluent to be concentrated by ultrafiltration, then crosses desalting column, pure water is recycled to elute with the flow velocity of 2.5mL/min, collect at eluting peak Solution is the second eluent, is then freeze-dried to get the protein is arrived；
Wherein the buffer solution A is the PBS buffer solution containing 1.5mM EDTA；
The buffer solution B is the PBS buffer solution containing 1.5mM EDTA, 15mM glutathione.
Embodiment 3 (method of producing protein that a kind of amino acid sequence is SEQ ID NO:1)
1) recombination bacillus coli E.coli DH5 α pGEX-4T-AIP2 is taken to cultivate, until culture solution OD600nm adds when being 0.9 Enter inducer IPTG to final concentration of 1.2mM, then the Fiber differentiation 5h under the conditions of 39 DEG C, concussion；
2) thallus, broken, collection supernatant are collected；
3) buffer solution A is taken, glutathione Sepharose resin column is balanced with the flow velocity of 3.5mL/min；Step 2) supernatant is taken, With the flow velocity loading of 2mL/min；Buffer solution B is taken, is eluted with the flow velocity of 1.2mL/min, collecting solution at eluting peak is to elute Liquid；It takes eluent to be concentrated by ultrafiltration, then crosses desalting column, pure water is recycled to elute with the flow velocity of 3.5mL/min, collect at eluting peak Solution is the second eluent, is then freeze-dried to get the protein is arrived；
Wherein the buffer solution A is the PBS buffer solution containing 2.5mM EDTA；
The buffer solution B is the PBS buffer solution containing 2.5mM EDTA, 25mM glutathione.
Embodiment 4 (method of producing protein that a kind of amino acid sequence is SEQ ID NO:1)
1) recombination bacillus coli E.coli DH5 α pGEX-4T-AIP2 is taken to cultivate, until culture solution OD600nm adds when being 0.7 Enter inducer IPTG to final concentration of 0.9mM, then the Fiber differentiation 4.5h under the conditions of 37 DEG C, concussion；
2) thallus is collected, after thallus is resuspended in PBS buffer solution, ultrasonication 30 times is (broken every time under condition of ice bath Duration be 4s, every 2 times it is broken between interval time be 6s), then collect supernatant；
3) step 2) supernatant is taken, using GST affinitive layer purification, is concentrated by ultrafiltration after collecting eluent, desalination, it is dry, Obtain the protein.
(albumen prepared by embodiment 2 is respectively to listeria monocytogenes, Escherichia coli O 157: H7, mouse wound for embodiment 5 The ampicillin-sensitive of cold salmonella influences experiment)
Listeria monocytogenes, Escherichia coli O 157: H7 and salmonella typhimurium are specific with bifidobacterium longum Albumin A IP2 co-culture 2h, carry out count plate after respectively by three kinds of pathogenic bacteria equivalent be transferred to be added various concentration ammonia benzyl etc. Volume LB liquid medium carries out count plate comparison to adhesion protein processing group and GST processing group.The specific method is as follows:
(1) adhesion protein AIP2 is diluted to concentration respectively with sterile PBS solution is 45 μ g/mL, GST dilute as compareing It releases to same concentrations, 4 DEG C save backup.
(2) listeria monocytogenes culture is to mid-log phase, 8000r/min, after being centrifuged 5min under the conditions of 4 DEG C, collects Thallus, sterile PBS are washed 3 times, thallus are resuspended with GST dilution, adhesion protein AIP2 dilution respectively, is diluted to bacterial concentration It is 106CFU/mL handles 2h in 37 DEG C of Bacteria Culture oscillators.
(3) equivalent inoculation adhesion protein processes and the listeria monocytogenes of GST processing, Escherichia coli respectively The ammonia benzyl LB liquid medium of various concentration is added in 2mL for O157:H7 and salmonella typhimurium, and ammonia benzyl concentration gradient is 50, 25,10,1,0.1 μ g/mL cultivate 6h in 37 DEG C of isothermal vibration incubators, carry out count plate.Experimental result is shown in Fig. 2.
As shown in Fig. 2, compared with the control group, it is attached albumen treated that microorganism is antibacterial under the action of antibiotic Effect becomes apparent, and since control group is suitable with the biomass level of attachment proteins processing group at 0 point of antibiotic, can recognize For attachment proteins itself and do not have direct fungistatic effect, and only plays the antibacterial synergistic effect of antibiotic.
(albumen prepared by embodiment 2 is respectively to listeria monocytogenes, Escherichia coli O 157: H7, mouse wound for embodiment 6 The benzyl penicillin sensibility of cold salmonella, cephalosporin sensibility, kanamycins sensibility, chloramphenicol sensitivity influence experiment)
Listeria monocytogenes, Escherichia coli O 157: H7 and salmonella typhimurium are specific with bifidobacterium longum Albumin A IP2 co-culture 2h, carry out count plate after respectively by three kinds of pathogenic bacteria equivalent be transferred to be added various concentration ammonia benzyl etc. Volume LB liquid medium carries out count plate comparison to adhesion protein processing group and GST processing group.The specific method is as follows:
(1) adhesion protein AIP2 is diluted to concentration respectively with sterile PBS solution is 55 μ g/mL, GST dilute as compareing It releases to same concentrations, 4 DEG C save backup.
(2) listeria monocytogenes culture is to mid-log phase, 8000r/min, after being centrifuged 5min under the conditions of 4 DEG C, collects Thallus, sterile PBS are washed 3 times, thallus are resuspended with GST dilution, adhesion protein AIP2 dilution respectively, is diluted to bacterial concentration It is 106CFU/mL handles 2h in 37 DEG C of Bacteria Culture oscillators.
(3) equivalent inoculation adhesion protein processes and the listeria monocytogenes of GST processing, Escherichia coli respectively It is respectively 1 μ g/mL benzyl penicillin, 1 μ g/mL cephalosporin, 2 μ g/mL that concentration, which is added, in 2mL in O157:H7 and salmonella typhimurium The LB liquid medium of kanamycins or 2 μ g/mL chloramphenicol cultivates 6h in 37 DEG C of isothermal vibration incubators, carries out viable bacteria It counts.As a result see Fig. 3.
As shown in figure 3, adhesion protein treated microorganism receives inhibition more outstanding, bacterium under antibiotic effect Volume density is commonly the 1/10 of control group hereinafter, it can be seen that bifidobacterium longum protein of the present invention has definite, significant suppression Bacterium synergistic effect.
The embodiments of the present invention have been described in detail above, but content is only the preferred embodiment of the present invention, It is not intended to limit the invention.All any modifications, equivalent replacements, and improvements etc. done in application range of the invention, should all It is included within protection scope of the present invention.

Claims (1)

1. it is quick to antibiotic that amino acid sequence protein as shown in SEQ ID NO:1 is used to prepare promotion salmonella typhimurium The application of the drug of perception；Wherein, the antibiotic is beta-lactam antibiotic or aminoglycoside antibiotics or amide alcohol Class antibiotic.
CN201610107536.2A 2016-02-26 2016-02-26 A kind of bifidobacterium longum protein is used to be promoted the application of salmonella typhimurium Antibiotic Sensitivity Expired - Fee Related CN105641682B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610107536.2A CN105641682B (en) 2016-02-26 2016-02-26 A kind of bifidobacterium longum protein is used to be promoted the application of salmonella typhimurium Antibiotic Sensitivity

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610107536.2A CN105641682B (en) 2016-02-26 2016-02-26 A kind of bifidobacterium longum protein is used to be promoted the application of salmonella typhimurium Antibiotic Sensitivity

Publications (2)

Publication Number Publication Date
CN105641682A CN105641682A (en) 2016-06-08
CN105641682B true CN105641682B (en) 2019-02-01

Family

ID=56488884

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610107536.2A Expired - Fee Related CN105641682B (en) 2016-02-26 2016-02-26 A kind of bifidobacterium longum protein is used to be promoted the application of salmonella typhimurium Antibiotic Sensitivity

Country Status (1)

Country Link
CN (1) CN105641682B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109628343B (en) * 2018-12-26 2022-02-18 嘉兴益诺康生物科技有限公司 Bifidobacterium breve YH68 and application thereof in product for reducing infection risk of salmonella typhimurium

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102206599A (en) * 2011-04-11 2011-10-05 天津科技大学 Oxygen-resistant acid-resistant Bifidobacterium longum
CN103911337A (en) * 2013-01-09 2014-07-09 中国海洋大学 High adhesion clostridium butyricum and its preparation method

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102206599A (en) * 2011-04-11 2011-10-05 天津科技大学 Oxygen-resistant acid-resistant Bifidobacterium longum
CN103911337A (en) * 2013-01-09 2014-07-09 中国海洋大学 High adhesion clostridium butyricum and its preparation method

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Multiresistance to antibiotics of Salmonella enterica serovar Typhimurium strains producing extended spectrum beta-lactamases (ESBLs).;Coculescu BI等;《J Med Life.》;20141231;第7卷(第2期);第80-82页 *

Also Published As

Publication number Publication date
CN105641682A (en) 2016-06-08

Similar Documents

Publication Publication Date Title
Leboy et al. The chromosomal site specifying a ribosomal protein in Escherichia coli
CN110016451A (en) One plant of Bei Laisi bacillus, its probiotics and preparation method thereof
CN108707565B (en) Bifidobacterium bifidum and application thereof
CN107568434A (en) Bei Laisi bacillus produces the preparation method and applications of protease fermented liquid
CN106282279A (en) A kind of canine recombinant interferon-ALPHA standard substance, its preparation method and titration method
CN101721693B (en) Improved recombinant bacillus calmetter Guerin (BCG)
CN105641682B (en) A kind of bifidobacterium longum protein is used to be promoted the application of salmonella typhimurium Antibiotic Sensitivity
CN102198265B (en) Method for degrading streptococcus suis biofilm by applying phage lyase
CN105669843B (en) A kind of bifidobacterium longum protein, preparation method and medical usage
CN108396030A (en) Litopenaeus vannamei antibacterial peptide gene Lv-BigPEN and its recombinant protein and application
CN105688186B (en) A kind of bifidobacterium longum protein is used to be promoted the application of listeria monocytogenes Antibiotic Sensitivity
CN104877011A (en) Protein transduction domain derived from fish nervous necrosis virus as well as preparation method and use of protein transduction domain
CN110295134A (en) A kind of building and its application of surface display c-type perfringens alpha, β toxin protein recombinant plant lactobacillus
CN104726429A (en) Bacteriophage lysin with improved antibacterial effect
CN107596361A (en) Subunit vaccine of bovine A-type clostridium perfringens and preparation method and application thereof
CN104131021A (en) Antibacterial peptide coexpression vector, construction and expression method thereof
CN106755336A (en) A kind of application of Klebsiella Pneumoniae specific gene
Jones et al. The L‐phase of Erwinia carotovora var. atroseptica and its possible association with plant tissue
CN105646679A (en) Bifidobacterium longum protein as well as preparation method and application thereof
CN113717905B (en) Strain RD4 and application thereof
CN108251546A (en) A kind of Forecasting Methodology of lactobacillus plantarum endogenous signal peptides and its application
CN108441458B (en) Genetically engineered bacillus amyloliquefaciens capable of effectively preventing and treating gray mold as well as preparation method and application thereof
CN114181867A (en) Lactobacillus plantarum and product and application thereof
CN113430220A (en) Synthesis method, construction method and application of genetic engineering bacteria for expressing soluble feline omega interferon
CN113621055A (en) Antibacterial and antiviral porcine hemoglobin beta chain C-terminal fragment, bacillus subtilis for expressing fragment, preparation and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20190201