CN105622740A - Morus multicaulis ammonium transporter MmAMT.2 and application thereof - Google Patents

Morus multicaulis ammonium transporter MmAMT.2 and application thereof Download PDF

Info

Publication number
CN105622740A
CN105622740A CN201610203308.5A CN201610203308A CN105622740A CN 105622740 A CN105622740 A CN 105622740A CN 201610203308 A CN201610203308 A CN 201610203308A CN 105622740 A CN105622740 A CN 105622740A
Authority
CN
China
Prior art keywords
mmamt
gene
ammonium transporter
mulberry tree
plant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610203308.5A
Other languages
Chinese (zh)
Inventor
赵卫国
钱娇
尚亚君
周宏�
邓远良
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangsu University of Science and Technology
Original Assignee
Jiangsu University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu University of Science and Technology filed Critical Jiangsu University of Science and Technology
Priority to CN201610203308.5A priority Critical patent/CN105622740A/en
Publication of CN105622740A publication Critical patent/CN105622740A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants

Abstract

The invention relates to a Morus multicaulis ammonium transporter MmAMT.2 and application thereof. The sequences of the gene and protein are respectively disclosed as SEQ ID NO.1 and SEQ ID NO.2. The treatment is carried out under different nitrogen conditions. The plant is Morus multicaulis. The invention also provides expression analysis and application of the Morus multicaulis MmAMT.2 ammonium transporter under different nitrogen conditions on the premise of completing Morus multicaulis genome. The Morus multicaulis MmAMT.2 ammonium transporter can be used for regulating expression of the ammonium transporter gene in Morus multicaulis under different nitrogen conditions.

Description

Mulberry tree ammonium transporter MmAMT2 and application thereof
Technical field
The invention belongs to plant genetic engineering field, it relates to a kind of mulberry tree ammonium transporter MmAMT.2 gene clone and its Expression and Application when different nitrogen.
Background technology
In all essential nutrient elements of crop, nitrogen element is the element that crop absorbed dose from soil is maximum, is limiting plant growth and the primary factor forming output. The main nitrogen prime form that in soil, plant utilizes is ammonium nitrogen (NH4 +) and nitric nitrogen (NO3 -). The inefficient phenomenon of Nitrogen utility generally exists in plant growing process, cause using in a large number of nitrogenous fertilizer, cause huge environmental influence, need to from further investigation plant nitrogen mechanism of absorption, plant variety could be improved, it is to increase Nitrogen absorption efficiency from TX The molecular biological pathways.
Mulberry tree is happiness ammonium plant, and research shows, deposits in case at ammonium nitrogen and nitric nitrogen simultaneously, and ammonium nitrogen is shown obvious preference by plant. At present, ammonium transporter (ammoniumtransporters, the AMT) gene of the plant such as Arabidopis thaliana, paddy rice is carried out the many of expression analysis and function research both at home and abroad, and very few in the research of mulberry tree this respect. AMT is positioned on cytolemma, by with the H with its coupling+Inside and outside the cytoplasmic membrane that-ATPase provides, chemosmosis gradient carrys out mediated plant to running in the absorption of ammonium nitrogen and body. Plant ammonium transporter family can be divided into two big class: AMT1 and AMT2. According to absorption dynamics analysis, ammonium transporter can be divided into again high affine system (highaffinitytransportersystem, HATs) and low affine system (lowaffinitytransportersystem, LATs). The AMT1 wherein studied by concentrated report mostly belongs to HTTs, but going deep into along with research, the meaning ever more important of AMT2 family. Overlapped, repetition or complementary functionally may be there is between AMT1 and AMT2 member. At present isolation identification ammonium transporter in the various plants such as paddy rice, tomato, Root or stem of Littleleaf Indianmulberry, swede type rape, wherein with paddy rice identifies the AMT most species with ammonium transport function, reach 12 kind. Wherein 4 kinds of AMT genes belong to AMT1, and remaining 8 kinds belong to AMT2. In each plant, AMT1 and AMT2 proportion differs. AMT is positioned on cytolemma, and to the absorption of ammonium and ammonium, the transhipment between cell is the need energy active transport processes of AMT mediation to plant.
Lacking in environment at nitrogen element, plant strengthens the expression of specific ammonium transporter gene, is one of plant important inherent mechanism of adapting to nitrogen element stressful environmental. Nitric nitrogen is also affect one of ammonium transporter gene expression factor. Research shows, AtAMT1.1 expresses and does quick feedback regulation with the change in concentration of nitric nitrogen in environment, and when in soil, nitrate nitrogen content seriously lacks, the expression of AtAMT1.1 obviously increases. In plant materials, expression between AMT also can influence each other, after a certain AMT afunction, and the disadvantageous effect that plant is caused after protein function lacks by plant by regulating the expression of some other ammonium transporter gene to make up.
When different nitrogen, the transcriptional level of AMT gene all changes. Nitrogenous source different concns of the same race, concentration different nitrogen sources of the same race, has certain influence to plant growth and development. Research finds when scarce nitrogen, and in plant materials, the expression of AMT gene has increase in various degree, alleviates and lacks nitrogen to the impact of plant, maintains and grow normally.
China is the origin center of mulberry tree, and germ plasm resource is very abundant. Through the effort of mulberry tree germ plasm resource and breeder decades, the present whole nation Collection and conservation have nearly 3000 parts of mulberry tree germ plasm resources, wherein many resources all have fruit value, pharmaceutical use, economic worth etc.
Summary of the invention
The technical problem solved: the present invention provides a kind of mulberry tree ammonium transporter MmAMT.2 and application thereof, it is possible to for the expression regulation of the ammonium transporter gene in mulberry tree when different nitrogen.
Technical scheme: mulberry tree ammonium transporter MmAMT.2, sequence is as shown in SEQIDNO.2.
The gene of coding mulberry tree ammonium transporter MmAMT.2, sequence is as shown in SEQIDNO.1.
The application of above-mentioned mulberry tree ammonium transporter MmAMT.2 in different nitrogen condition.
Described different nitrogen condition is 200 ��Ms of KNO3��2mMKNO3��20mMKNO3Process, 100 ��Ms of (NH4)2SO4��1mM(NH4)2SO4��10mM(NH4)2SO4Process, 20mMKNO3Process, 10mM (NH4)2SO4Process and 10mMNH4NO3Process.
Described plant is mulberry tree (Morusmulticaulis).
The gene of above-mentioned coding mulberry tree ammonium transporter MmAMT.2 is expressing the application in mark as plant different nitrogen condition.
Useful effect: nitrogen element is one of important nutritive element in plant growth and development process. The main nitrogen prime form that plant absorbs from soil is ammonium nitrogen and nitric nitrogen. In plant materials, nitrogen metabolism is based on ammonium nitrogen, and ammonium nitrogen directly, is transformed into amino acid after can being absorbed, and then synthetic protein, maintains plant normal activities. In the process of growth of plant, changing mechanism greatly to adapt to ammonium concentration, plant development defines ammonium transporter family. This protein family is divided into again two big class: AMT1 and AMT2. In scarce nitrogen situation, the expression of AMT gene, in increasing in various degree, cooperates mutually, the common normal operation maintaining plant part nitrogen metabolism. Research finds, when different nitrogen, the AMT changes in gene expression in plant materials is also comparatively obvious. Mulberry tree ammonium transporter MmAMT.2 of the present invention, improves mulberry tree genome and provides mulberry tree ammonium transporter in the expression analysis of different nitrogen condition and application simultaneously, it is possible to for the expression regulation of the ammonium transporter gene in mulberry tree when different nitrogen.
Accompanying drawing explanation
Fig. 1 is the pcr amplification result figure of mulberry tree ammonium transporter MmAMT.2 gene: M.2000bpDNA molecule marker 1.RT-PCR product;
Fig. 2 is the pcr amplification result figure of mulberry tree ammonium transporter MmAMT.2 gene: M.2000bpDNA molecule marker; 1PCR amplified production;
Fig. 3 is 3 '-RACE amplification figure of mulberry tree ammonium transporter MmAMT.2 gene: M.2000bpDNA molecule marker 1.RT-PCR product;
Fig. 4 is the aminoacid sequence conserved regions forecasting software sectional drawing that mulberry tree ammonium transporter MmAMT.2 gene is derived;
Fig. 5 is that quantitative RT-PCR detection MmAM2 gene is at 200 ��Ms of KNO3Relative expression quantity figure in the lower mulberry sapling tender leaf of process; Comparison, processes 6 hours, processes 12 hours, process 1 day, process 2 days, process 3 days; Often organizing on the left of data is 200 ��Ms of KNO3Experiment result, right side is control group;
Fig. 6 is that quantitative RT-PCR detection MmAMT.2 gene is at 2mMKNO3Relative expression quantity figure in the lower mulberry sapling tender leaf of process; Comparison, processes 6 hours, processes 12 hours, process 1 day, process 2 days, process 3 days; Often organizing on the left of data is 2mMKNO3Experiment result, right side is control group;
Fig. 7 is that quantitative RT-PCR detection MmAMT.2 gene is at 20mMKNO3Relative expression quantity figure in the lower mulberry sapling tender leaf of process; Comparison, processes 6 hours, processes 12 hours, process 1 day, process 2 days, process 3 days; Often organizing on the left of data is 20mMKNO3Experiment result, right side is control group;
Fig. 8 is that quantitative RT-PCR detection MmAMT.2 gene is at 100 ��Ms of (NH4)2SO4Relative expression quantity figure in the lower mulberry sapling tender leaf of process; Comparison, processes 6 hours, processes 12 hours, process 1 day, process 2 days, process 3 days; Often organizing on the left of data is 100 ��Ms of (NH4)2SO4Experiment result, right side is control group;
Fig. 9 is that quantitative RT-PCR detection MmAM glue-2 gene is at 1mM (NH4)2SO4Relative expression quantity figure in the lower mulberry sapling tender leaf of process; Comparison, processes 6 hours, processes 12 hours, process 1 day, process 2 days, process 3 days; Often organizing on the left of data is 1mM (NH4)2SO4Experiment result, right side is control group;
Figure 10 is that quantitative RT-PCR detection MmAMT.2 gene is at 10mM (NH4)2SO4Relative expression quantity figure in the lower mulberry sapling tender leaf of process; Comparison, processes 6 hours, processes 12 hours, process 1 day, process 2 days, process 3 days; Often organizing on the left of data is 10mM (NH4)2SO4Experiment result, right side is control group;
Figure 11 is that quantitative RT-PCR detection MmAMT.2 gene is at 20mMKNO3Process, 10mM (NH4)2SO4Process and 10mMNH4NO3Relative expression quantity figure in the lower mulberry sapling tender leaf of process; 10mM (NH4)2SO4Process 4 days, 20mMKNO3Process 4 days and 10mMNH4NO3Process 4 days; Often organizing on the left of data is respectively experiment result, and right side is respective control group.
Embodiment
The clone of embodiment 1 mulberry tree ammonium transporter MmAMT.2 gene
Supply examination mulberry tree breed to be that Morus multicaulis kind (Morusmulticaulis) educates 71-1 seedling, it is stored in country of Can Ye institute of the Chinese Academy of Agricultural Sciences and plants mulberry tree garden, matter Zhenjiang. Utilizing the ESTs sequence comprising mulberry tree ammonium transporter MmAMT.2 gene cDNA fragment obtained, design primer, and verified, primer sequence is as follows:
MmAMT.2-F:5'-CCTTGTGATCCTCTACGC-3';
MmAMT.2-R:5'-GACAAAAGCCATCCAAGC-3';
MmAMT.2-S:5'-ATGGCGCTCCCAGAGGCC-3';
MmAMT.2-A:5'-ACGGCGGCGAAGGCATAGAG-3';
According to the gene intermediate segment result cloned and verify, the upstream specific primer of the required goal gene of design 3'RACE amplification, primer sequence is as follows:
GSP1:5'-GCCAGAACTTCCTCATCAACC-3';
GSP2:5'-TGGCGACGCTGGTCTACT-3';
The general primer of 3'RACE is:
Outside 3': 5'-GCTGTCAACGATACGCTACGTAACG-3';
3' joint: 5'-GCTGTCAACGATACGCTACGTAACGGCATGACAGTGTTTTTTTTTTTTTTTTT T-3';
Carry out the primer of quantitative fluorescence analysis according to the full length gene sequences Design obtained, primer sequence is as follows:
QMmAMT.2-F:5'-CGGTCAACTCGGCCTTCA-3';
QMmAMT.2-R:5'-AAACGGCACGGTCTCCCT-3';
According to the upstream and downstream primer of ��-actin gene (GeneBank accession number: DQ785808) the sequences Design reference gene of stably express in mulberry tree searched on NCBI,
Upstream primer sequence ��-actin-F is 5'-AGCAACTGGGATGACATGGAGA-3',
Downstream primer sequence ��-actin-R is 5'-CGACCACTGGCGTAAAGGGA-3'.
The clone of cDNA fragment in the middle of mulberry tree ammonium transporter MmAMT.2 gene
Get Morus multicaulis and educate 71-1 Graft top spire, extract mulberry tree total serum IgE with RNA test kit. First prepare RNAiso extract in centrifuge tube, mulberry tree tender leaf is carried out liquid nitrogen grinding powdered, powder is put into the centrifuge tube of extract, ice chest is put 30min, then 4 DEG C, 12000rpm, centrifugal 5min, extracts supernatant 700-800 �� L, to new centrifuge tube, then add 200 �� L chloroforms, concussion 1min, mixed even ice ice chest places 6-10min, then 4 DEG C, 12000rpm, 20min are centrifugal, draw supernatant 300 �� L in another centrifuge tube. Add the Virahol of equal-volume precooling, mixed even after leave standstill on ice 10-15min, 13000rpm, 4 DEG C remove centrifugal 20min, except supernatant, slowly add 75% ethanol of 1mL precooling, 4 DEG C, the centrifugal 5min of 13000rpm, abandons supernatant. Then drying at room temperature precipitation 2-5min. Finally add appropriate ddH2O, flick tube wall, fully to dissolve RNA.
RNA self can not as the template of PCR reaction, and palpus is existing is cDNA by its reverse transcription. To extract total serum IgE 9 �� L as template, oligo (dT)184 �� L are that primer carries out reverse transcription, after 70 DEG C of insulation 10min, then more than 2min on ice is put into rapidly, the centrifugal several seconds, template ribonucleic acid/oligo (dT) 18 denaturing soln of above-mentioned 13 �� L adds 5 �� M/MLV damping fluid 4 �� L, 10mMdNTP mixture 1 �� L, 40U/ �� LRNaseInhibitor1uL, 200U/uLRtaseM-MLV (RnaseH-) 1 �� L, cumulative volume 20 �� L. After centrifugal, at 42 DEG C of 1h, cooled on ice after 70 DEG C of 15min, obtains cDNA the 1st chain, and-20 DEG C save backup.
Taking cDNA the 1st chain that synthesizes as template, utilizing the MmAMT.2 F and MmAMT.2 R of above-mentioned design respectively, MmAMT.2 S and MmAMT.2 A is that primer carries out RT-PCR amplification. Pcr amplification program is: 94 DEG C of denaturation 5min; 94 DEG C of 30s, 58 DEG C of 40s, 72 DEG C of 50s, circulate 35 times; 72 DEG C extend 10min; 4 DEG C of preservations. The RT-PCR product respectively getting 5 �� L carries out the size of agarose gel electrophoresis testing goal fragment, and whether testing goal clip size is consistent (Fig. 1,2) with prediction size. After condition is consistent, 1% sepharose made of TAE damping fluid, respectively gets 40 �� LRT-PCR products and carries out electrophoresis, and the glue adopting TaKaRa company AgaroseGelDNAPurificationKit test kit to carry out object fragment reclaims and purifying. Glue reclaims product by DNA ligase and pMDTM18-T carrier connects. Connect product and it is transformed into host's bacterium E.coliTOP10 bacterial strain competent cell, coat on the LB solid plate containing X-Gal, IPTG, Amp. Choosing to get after single bacterium colony hickie is cultivated send sample check order, sequencing result blast analysis and with EST original series comparison.
The amplification of mulberry tree ammonium transporter MmAMT.2 full length gene
Through homology comparison, cDNA fragment sequence according to the mulberry tree MmAMT.2 gene cloned and verify, finds that it does not have complete open reading frame. Sequences Design primer according to obtaining carries out 3'-RACE amplification.
Extract mulberry tree total serum IgE, obtain cDNA template strand according to specification sheets with 3' joint reverse transcription.
It is forward primer taking GSP1, for being reverse primer outside 3', carries out PCR reaction. PCR reaction system is as follows: 5 �� L10 �� Buffer, 0.5 �� LdNTP, 1 �� LcDNA template, each 1 �� L of primer, and 0.5 �� LrTaq enzyme, is finally tied to 50 �� L with aseptic double-distilled water added body. PCR response procedures is: 94 DEG C of denaturation 5min; 94 DEG C of 40s, 58 DEG C of 40s, 72 DEG C of 1min, circulate 40 times; 72 DEG C extend 10min; 4 DEG C of preservations.
The template that the PCR primer obtained is reacted as second time PCR is forward primer taking GSP2, is reverse primer outside 3', again carries out above-mentioned PCR reaction.
Testing goal clip size (Fig. 3), glue reclaims amplified production, by object fragment by DNA ligase and pMDTM18-T carrier connects. Connect product and it is transformed into host's bacterium E.coliTOP10 bacterial strain competent cell, coat on the LB solid plate containing X-Gal, IPTG, Amp. Choosing to get after single bacterium colony hickie is cultivated and send sample, complete order-checking by raw work biotechnology (Shanghai) company limited, sequencing result carries out blast analysis, and splicing obtains Gene Partial mRNA sequence.
Mulberry tree ammonium transporter MmAMT.2 gene order part mRNASEQIDNO.1:
GCGCTCCCAGAGGCCTATACGACGGTGTCGCCTGCCGTGCCCCCATGGCTAAACAAAGGCGACAACGCGTGGCAGATGACGGCGTCGGTGCTGGTGGGAATCCAGAGCATGCCGGGCCTGGTGATCCTCTACGCCAGCATAGTGAAAAAGAAGTGGGCGGTCAACTCGGCCTTCATGGCTCTCTATGCCTTCGCCGCCGTGCTCATCTGCTGGGTTCTCATCGGATACCGAATAGCGTTCGGCGACGAGCTCCTCCCATTCTGGGGCAAAGGCGCCGTGTCCCTCGGCCAGAACTTCCTCATCAACCGGGCCAAAATCCCCGAGAGCGTCCGTCGAAACGACGACGGCTCCATCGAGAGGGAGACCGTGCCGTTTTACCCGATGGCGACGCTGGTCTACTTCCAGTTCACTTTTGCGGCGATCACGGTGATTTTACTAGCCGGGTCGGTTCTTGGGAGGATGAGCATCAAGGCTTGGATGGCTTTTGTCCCTCTTTGGTTGCTGTTTTCTTATACGGTTGGAGCTTTCAGTTTGTGGGGTGGAGGGTTTCTTTACCATTGGGGAGTTATTGACTACTCCGGCGGATATGTTATTCATCTCTCTTCTGGAATCTCCGGTTTCACAGCTGCTTATTGGGTAGGTCCACGGCTGAAGAGCGACAGGGAAAGATTCCCTCCAAACAACGTGCTTCTCATGCTGGCGGGCGCCGGCCTGCTGTGGATGGGGTGGTCAGGCTTCAACGGAGGGGCGCCATATGCTGCCAACATTGACTCCTCAATTGCGGTGTTGAACACCAACATCTGCGCTGCCACTAGCCTCCTCATGTGGACTACTCTCGACGTTATATTCTTTGGGAAACCGTCGGTGATCGGAGCCGTCCAGGGAATGATGACCGGACTCGCATGCATCACACCCGGGGCAGGATTGGTGCAATCGTGGGCGGCTATAGTGTATGGAATAGTTTCTGGTAGCATTCCGTGGGTGTCAATGATGGTGCTTCACAAAAAGTCTAGTCTATTTCAAAAGGTGGATGACACCCTCGGAGTATTCCACACACACGCGGTGGCCGGACTATTGGGCGGCCTTATGACGGGTCTGTTTGCGGAGCCAGAGCTTTGTCGGCTCATACTACCTAGATCCGATTCGAGAGGAGCATTCTACGGTGGAACAGGCGGGGTCCAGTTCTTGAAACAAATGGCGGCCGCCACGTTTGTCATCGGGTGGAACATAGTGTCCACAACAATCATACTTCTTTTCATAAGGCTATTCATTCCACTGAGGATGCCGGACAATCAGTTGATGATCGGAGATGACGCCGTCCACGGAGAAAAGGCCTATGCGCTGTGGGGAGACGGCGAAAAGTACGACCCGACGAGGCATAATAGCTGGAATATGCCAACGTACGGTGAAGAAGTTGCGCCTTCTCCTTATATTACTGGTGCAAGAGGTGTGACTATCAACCTT
For initiator codon;For terminator codon
The bioinformatic analysis of mulberry tree ammonium transporter MmAMT.2 gene
Utilize online tool PSORT, according to the document reported, goal gene carried out the prediction of nuclear localization sequence and the analysis (Fig. 4) of relevant conservative gene sequence; Use the Blast instrument of NCBI that it carries out Homology search and comparison, and download part homologous amino acid sequence; Utilize ClustalX software that the aminoacid sequence of the aminoacid sequence of genes encoding and mulberry tree ammonium transporter MmAMT.2 gene associated protein is carried out homology comparison; DNAStar software and on-line analysis (http://www.expasy.org) is utilized more comprehensively to be analyzed by mulberry tree ammonium transporter MmAMT.2 gene, such as: the amino acid of this coded by said gene and ORF prediction, the iso-electric point of DNA encoding the protein and the prediction etc. of molecular mass; Then, with MEGA4.1 software building evolutionary tree, and study the relation of associated protein.
Mulberry tree ammonium transporter MmAMT.2 protein sequence total length SEQIDNO.2:
MALPEAYTTVSPAVPPWLNKGDNAWQMTASVLVGIQSMPGLVILYASIVKKKWAVNSAFMALYAFAAVLICWVLIGYRIAFGDELLPFWGKGAVSLGQNFLINRAKIPESVRRNDDGSIERETVPFYPMATLVYFQFTFAAITVILLAGSVLGRMSIKAWMAFVPLWLLFSYTVGAFSLWGGGFLYHWGVIDYSGGYVIHLSSGISGFTAAYWVGPRLKSDRERFPPNNVLLMLAGAGLLWMGWSGFNGGAPYAANIDSSIAVLNTNICAATSLLMWTTLDVIFFGKPSVIGAVQGMMTGLACITPGAGLVQSWAAIVYGIVSGSIPWVSMMVLHKKSSLFQKVDDTLGVFHTHAVAGLLGGLMTGLFAEPELCRLILPRSDSRGAFYGGTGGVQFLKQMAAATFVIGWNIVSTTIILLFIRLFIPLRMPDNQLMIGDDAVHGEKAYALWGDGEKYDPTRHNSWNMPTYGEEVAPSPYITGARGVTINL
The expression pattern of mulberry tree ammonium transporter MmAMT.2 gene goal gene when different nitrogen
When the new tip for examination mulberry sapling grows to that about 20cm is long, mulberry sapling is carried out different nitrogen condition process respectively. Different nitrogen condition is 200 ��Ms of KNO3��2mMKNO3��20mMKNO3��100��M(NH4)2SO4��1mM(NH4)2SO4��10mM(NH4)2SO4��20mMKNO3��10mM(NH4)2SO4And 10mMNH4NO3. In whole treating processes, the temperature of all test seedlings, intensity of illumination, the abiotic condition such as photoperiod and humidity all remains unchanged. Timing Processing and observe the growth tendency of mulberry saplings, got comparison and the lower mulberry tree spire of various nitrogen element condition process respectively, dropped in liquid nitrogen rapidly with after aluminium-foil paper parcel every day, was put in the refrigerator of-80 DEG C preservation. In whole treating processes, the intensity of illumination of all Grafts, photoperiod and humidity all remain unchanged. Adopt the method for quantitative fluorescent PCR, using the actin gene (��-actin) of mulberry tree stably express as internal reference, measure the expression level of mulberry tree goal gene under stress conditions. All stress experiment all repeat 3 times.
Different concns KNO3Process: mulberry sapling concentration is 200 ��Ms, the KNO of 2mM, 20mM for trying3Solution processes respectively. Comparison mulberry sapling be positioned over same illumination box always, temperature 25 DEG C is constant, every day 12 h light, 12 h dark. The mulberry tree spire (1-3 leaf position) getting the process of different nitrogen condition when 6h, 12h, 1d, 2d and 3d is as experiment material.
Different concns (NH4)2SO4Process: mulberry sapling concentration is 100 ��Ms, (the NH of 1mM, 10mM for trying4)2SO4Solution processes respectively. Comparison mulberry sapling be positioned over same illumination box always, temperature 25 DEG C is constant, every day 12 h light, 12 h dark. The mulberry tree spire (1-3 leaf position) getting the process of different nitrogen condition when 6h, 12h, 1d, 2d and 3d is as experiment material.
Different nitrogen sources process: for try mulberry sapling concentration be 20mMKNO3��10mM(NH4)2SO4And 10mMNH4NO3Solution processes respectively. Comparison mulberry sapling be positioned over same illumination box always, temperature 25 DEG C is constant, every day 12 h light, 12 h dark. The mulberry tree spire (1-3 leaf position) getting the process of different nitrogen condition when 4d is as experiment material.
The lower MmAMT.2 relative expression quantity change display of different nitrogen condition process: different concns KNO3Under treatment condition, the overall trend of MmAMT.2 gene expression amount first rises, and drops to maximum, then declines (Fig. 5,6,7). 200 ��Ms of KNO3Under treatment condition, the expression amount fluctuation at MmAMT.2 gene initial stage is little, and the later stage increases die-off (Fig. 5) suddenly. 2mMKNO3Under treatment condition, the expression amount of MmAMT.2 gene continues to increase after maximum value and slowly declines (Fig. 6). 20mMKNO3Under treatment condition, the expression amount of MmAMT.2 gene sharply increased at the process initial stage, the later stage sharply reduce after fluctuation (Fig. 7). Different concns (NH4)2SO4Under treatment condition: 100 ��Ms of (NH4)2SO4Under treatment condition, the overall trend of MmAMT.2 gene expression amount stable rises (Fig. 8); 1mM (NH4)2SO4Under treatment condition, the overall trend of MmAMT.2 gene expression amount is rising of first fluctuating rapidly, after drop to relative minimum, and remain stable (Fig. 9); 10mM (NH4)2SO4Under treatment condition, the overall trend of MmAMT.2 gene expression amount is steady decrease (Figure 10). Under different nitrogen sources processes: 20mMKNO3Under treatment condition, the relative expression quantity of MmAMT.2 gene obviously increases; 10mM (NH4)2SO4Under treatment condition, the relative expression quantity reason of MmAMT.2 gene significantly reduces; 10mMNH4NO3Under treatment condition, the relative expression quantity of MmAMT.2 gene reduces (Figure 11) slightly. MmAMT.2 gene has obvious fluctuation status when different nitrogen, and this shows that MmAMT.2 may
Growing of mulberry and nitrogen metabolism play its function, when different nitrogen, brings out the expression of MmAMT.2 gene, plant reply different nitrogen condition is expressed. Analyzed by quantitative fluorescent PCR, utilize MmAMT.2 gene at different concns KNO3Process, different concns (NH4)2SO4Process and different nitrogen sources process lower overall express lifting situation, within the different process phases Relative gene expression amount index, and the conservative property of AMT.2 gene in plant, it is possible to this identify plant whether be in different nitrogen when.

Claims (6)

1. mulberry tree ammonium transporter MmAMT.2, it is characterised in that sequence is as shown in SEQIDNO.2.
2. encode the gene of mulberry tree ammonium transporter MmAMT.2 described in claim 1, it is characterised in that sequence is as shown in SEQIDNO.1.
3. mulberry tree ammonium transporter MmAMT.2 described in claim 1 is reaching the application in mark as plant different nitrogen condition following table.
4. application according to claim 3, it is characterised in that described different nitrogen condition is 200 ��Ms of KNO3��2mMKNO3��20mMKNO3Process, 100 ��Ms of (NH4)2SO4��1mM(NH4)2SO4��10mM(NH4)2SO4Process, 20mMKNO3Process, 10mM (NH4)2SO4Process and 10mMNH4NO3Process.
5. application according to claim 3, it is characterised in that described plant is mulberry tree (Morusmulticaulis).
6. the gene encoding mulberry tree ammonium transporter MmAMT.2 described in claim 2 is in the application reaching in mark as plant different nitrogen condition following table.
CN201610203308.5A 2016-04-01 2016-04-01 Morus multicaulis ammonium transporter MmAMT.2 and application thereof Pending CN105622740A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610203308.5A CN105622740A (en) 2016-04-01 2016-04-01 Morus multicaulis ammonium transporter MmAMT.2 and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610203308.5A CN105622740A (en) 2016-04-01 2016-04-01 Morus multicaulis ammonium transporter MmAMT.2 and application thereof

Publications (1)

Publication Number Publication Date
CN105622740A true CN105622740A (en) 2016-06-01

Family

ID=56038121

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610203308.5A Pending CN105622740A (en) 2016-04-01 2016-04-01 Morus multicaulis ammonium transporter MmAMT.2 and application thereof

Country Status (1)

Country Link
CN (1) CN105622740A (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995011978A1 (en) * 1993-10-28 1995-05-04 Institut Für Genbiologische Forschung Berlin Gmbh Dna sequences for ammonium transporter, plasmids, bacteria, yeasts, plant cells and plants containing the transporter
CN1737148A (en) * 2005-07-15 2006-02-22 南开大学 High affinity ammonium transport factor fuse gene and its use in transgenic plant
CN101346061A (en) * 2005-12-23 2009-01-14 阿凯迪亚生物科学公司 Promoter sequence obtained from rice and methods of use
CN101693892A (en) * 2009-09-25 2010-04-14 上海大学 Ammonia transport protein gene, protein coded by same and application thereof
CN101845088A (en) * 2010-06-04 2010-09-29 中国农业大学 Ammonium salt absorption-related protein and encoding gene and application thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995011978A1 (en) * 1993-10-28 1995-05-04 Institut Für Genbiologische Forschung Berlin Gmbh Dna sequences for ammonium transporter, plasmids, bacteria, yeasts, plant cells and plants containing the transporter
CN1737148A (en) * 2005-07-15 2006-02-22 南开大学 High affinity ammonium transport factor fuse gene and its use in transgenic plant
CN101346061A (en) * 2005-12-23 2009-01-14 阿凯迪亚生物科学公司 Promoter sequence obtained from rice and methods of use
CN101693892A (en) * 2009-09-25 2010-04-14 上海大学 Ammonia transport protein gene, protein coded by same and application thereof
CN101845088A (en) * 2010-06-04 2010-09-29 中国农业大学 Ammonium salt absorption-related protein and encoding gene and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HE N 等: "Morus notabilis Ammonium transporter 2 partial mRNA", 《GENBANK DATABASE》 *
SOHELNKAMP 等: "Characterization of Arabidopsis AtAMT2, a High-Affinity Ammonium Transporter of the Plasma Membrane", 《PLANT PHYSIOL》 *
SOHLENKAMP 等: "Characterization of Arabidopsis AtAMT2, a novel ammonium transporter in plants", 《FEBS LETTERS》 *
李园枚 等: "植物铵转运蛋白研究进展", 《广东农业科学》 *

Similar Documents

Publication Publication Date Title
Hu et al. Transgenic expression of plastidic glutamine synthetase increases nitrogen uptake and yield in wheat
Beatty et al. Transcriptome analysis of nitrogen‐efficient rice over‐expressing alanine aminotransferase
Kaur et al. Biochemical aspects of nitrogen use efficiency: An overview
CN104302773A (en) Methods of increasing tolerance to heat stress and amino acid content of plants
CN106119262A (en) Improve Oryza sativa L. nitrogen use efficiency and the gene OsPTR10 of yield and purposes
Lebedev et al. Genetic engineering and genome editing for improving nitrogen use efficiency in plants
CN105367644A (en) Plant stress tolerance associated transcription factor, encoding gene of plant stress tolerance associated transcription factor, and application of encoding gene
CN103451192A (en) Populus deltoidesx populus nigra PdMYB2 gene and application thereof
CN103305532B (en) Soybean 90kDa heat shock protein family encoding gene and application thereof
Beatty et al. Improving nitrogen use efficient in crop plants using biotechnology approaches
CN103012574A (en) Low-phosphor stress response regulatory factor ZmPHR1, gene for coding the protein and application
Chen et al. Encoded C4 homologue enzymes genes function under abiotic stresses in C3 plant
CN100513421C (en) Plant inverse-resistant zinc finger protein, coding gene and application thereof
CN101812434B (en) Invertase and application of encoding gene thereof
CN105622740A (en) Morus multicaulis ammonium transporter MmAMT.2 and application thereof
CN101812433B (en) Use of hevea brasiliensis invertase and coding gene thereof
CN102731638B (en) Hevea brasiliensis latex small G-protein Rop family protein and coding gene thereof
CN103992397B (en) Semen Maydis phosphorus transporter albumen upstream regulatory factor ZmPHO2;H1 and encoding gene thereof
CN102731639B (en) Small G protein Rop (Rho-related GTPase from plant) family protein of Hevea brasiliensis latex and coding gene thereof
CN108118063B (en) Mulberry potassium ion channel related gene MaKCO5 and application thereof
WO2021138660A1 (en) Utilization of nitrate transport proteins to enhance plant growth
Ma et al. An R2R3-MYB transcription factor CmMYB42 improves low-nitrogen stress tolerance in Chrysanthemum
CN104745543A (en) Ent-kaurene oxidase MmKO of morus multicaulis and application of ent-kaurene oxidase MmKO
CN105543260A (en) Application of HbCS4 gene in improvement of growth rate of prokaryotic expression bacteria and study of latex producing ability of rubber tree
CN105801678B (en) Mulberry tree nitrate transport protein MmNRT1 and its application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20160601

RJ01 Rejection of invention patent application after publication