CN105606582A - Alpha fetoprotein kit based on aptamer fluorescent probe AFP4 and detection method thereof - Google Patents
Alpha fetoprotein kit based on aptamer fluorescent probe AFP4 and detection method thereof Download PDFInfo
- Publication number
- CN105606582A CN105606582A CN201610175971.9A CN201610175971A CN105606582A CN 105606582 A CN105606582 A CN 105606582A CN 201610175971 A CN201610175971 A CN 201610175971A CN 105606582 A CN105606582 A CN 105606582A
- Authority
- CN
- China
- Prior art keywords
- fetoprotein
- alpha
- aptamer
- fluorescence probe
- fluorescence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6408—Fluorescence; Phosphorescence with measurement of decay time, time resolved fluorescence
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6486—Measuring fluorescence of biological material, e.g. DNA, RNA, cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- General Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Hematology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Urology & Nephrology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Food Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention relates to an alpha fetoprotein kit based on an aptamer fluorescent probe AFP4, a method for determining the alpha fetoprotein AFP concentration and compositions and ingredients of a determining reagent and belongs to the technical field of medical examination determination. The kit provided by the invention mainly comprises an erythrocyte lysis solution, a phosphate buffer PBS, an alpha fetoprotein AFP standard substance and an alpha fetoprotein AFP aptamer fluorescent probe. The concentration of the alpha fetoprotein AFP can be measured through blood sample splitting decomposition and mixing spawn raising treatment as well as fluorescence spectrophotometer detection. The alpha fetoprotein kit provided by the invention has the advantages of simple sample treatment, convenience in operation, short detection time, strong detection specificity, high sensitivity, high repeatability of detection results, and the like.
Description
Technical field
The invention belongs to medical test determination techniques field, particularly relate to the first based on aptamer fluorescence probe AFP4Fetoprotein kit and detection method thereof.
Background technology
Alpha-fetoprotein (AFP) is a kind of glycoprotein, and under normal circumstances, this albumen is mainly from embryo's liver cell, tireAfter youngster's birth, approximately two weeks alpha-fetoproteins disappear from blood, and therefore in normal human serum, the content of alpha-fetoprotein is still micro-less than 20Grams per liter. Alpha-fetoprotein AFP in puerpera's amniotic fluid or Maternal plasma can be used for fetus prenatal monitoring. As at neural-tube defect, backboneSplit, when anencephalus etc., AFP can be entered amniotic fluid and be caused its content in amniotic fluid significantly to raise by the nerve channel of opening. Fetus existsThe birth defects such as death in uterine cavity, teratoma also can have AFP in amniotic fluid to increase. AFP can enter parent blood circulation through amniotic fluid part.At the parent of 85% spina bifida and anencephalus, plasma A FP is pregnant 16-18 week visible rising and have diagnostic value, but must with face, in order to avoid there is false-positive mistake in the combination of bed experience.
The method of detection alpha-fetoprotein has several, and the alpha-fetoprotein that radioimmunology records is greater than AFP5 00Micrograms per litre and continue 4 weeks persons, or alpha-fetoprotein 200～500 micrograms per litre, continue 8 weeks persons, get rid of other cause first tireThe factor that albumen increases as acute hepatitis, chronic hepatitis, posthepatitic cirrhosis, embryoma, alimentary tract cancer after, need again in conjunction with location inspectionLook into, as B ultrasonic, CT, magnetic resonance (MRI) and hepatic angiography etc. can be made diagnosis. But, normal conceived women, minority liverIn the situations such as scorching and cirrhosis, gonad malignant tumour, alpha-fetoprotein also can raise, but that the amplitude raising is not so good as liver cancer is high like that.Patient with liver cirrhosis serum alpha-fetoprotein concentration is many between 25～200 micrograms per litre, generally in 2 months, transfers with the good of the state of an illnessDecline, majority can period of greater than two months; Raise with transaminase, after transaminase declines, alpha-fetoprotein also declines thereupon, blood simultaneouslyNormal and the transaminase of clear alpha-fetoprotein concentration is parallel relation. If alpha-fetoprotein concentration, more than 500 micrograms per litre, turns though haveAmmonia enzyme raises, but the possibility of liver cancer is large, and transaminase declines or be stable, and alpha-fetoprotein rises, and also should highly suspect liver cancer.
Alpha-fetoprotein just raising for 8 months before symptom appears in liver cancer, now most of hepatocarcinoma patients are still without brightAobvious symptom, tumour is also less, this part patient after operative treatment, prognosis can be improved significantly, therefore cirrhosis, Chronic LiverIn scorching patient, family, there is the people of liver cancer patient to detect once half a year.
Do not have at present can Direct Recognition alpha-fetoprotein antibody and other molecular probe. Therefore designing one highly setsThe molecular probe of alpha-fetoprotein, and set up simple and quick and cheap detection method based on this and will improve liver cancer and fetus congenitalDisease equal disease that alpha-fetoprotein is relevant monitoring.
Aptamer is that the novel identification of a class that developed recently gets up divides, and referring to can high specific and high-affinity groundThe strand nucleic acid molecule of territory target molecule knot. Aptamer can pass through part index concentration phyletic evolution technology(SystematicEvolutionofLigandsbyExponentialEnrichment, SELEX) screens acquisition.SELEX technology refers to that applied chemistry method synthesizes jumbo random oligonucleotide (by the fixed sequence program at two ends and middle randomSequence composition) library, by apply selection pressure (in conjunction with target, the mistake of elutriation and target high special binding fragmentJourney), and in conjunction with Amplification Technologies, through the too much circulation selective enrichment of wheel, obtain the widow of being combined with target material high specialNucleic acid molecule, can be that RNA can be also DNA, and length is generally 25 ~ 60 nucleotides. Aptamer mainly passes throughGeneration adaptability is folding, interacts with target molecule by hydrogen bond, hydrophobic sedimentation, Van der Waals force, and inserts or is coated withTarget molecule forms stable three-D space structure. Aptamer is not or not the time that target molecule is combined, and aptamer is in more openStructure, 5' and 3' two ends are mutually free. In the time that target molecule is combined, target molecule induction aptamer structure changes, nucleic acidFit 5' end and 3' end all will participate in mutual with target molecule specific region (being similar to the antigen site of being combined with antibody)Effect, causes 5' and 3' two ends mutually close. This feature makes aptamer be suitable for molecular beacon probe design. Wherein a kind ofMolecular beacon design has utilized fluorescent dye pyrene molecule. When an excitation state pyrene molecule and another ground state pyrene molecule closely meet withWhen chance, can form excitation state dimer, can discharge a photon in the position longer than pyrene monomer wavelength. Pyrene excitation state twoAggressiveness emission peak is 480 to 500nm, and the emission peak of pyrene monomer is between 370 to 400nm. In addition, pyrene molecule is glimmeringThe light life-span is longer than the life-span of the non-specific fluorescence excitation in biological sample, can be after non-specific fluorescence excitation disappear when detection,Collect again the dimeric fluorescence signal of excitation state, greatly improve the specificity and the sensitivity that detect. The core of identification alpha-fetoproteinThe fit Clinical detection that can be applied to alpha-fetoprotein of acid, improves detection efficiency, reduces testing cost.
Aptamer is combined presented hypersensitivity and high specific with target material, it is had in medical diagnosis on diseaseGood application prospect, although ripe clinical practice report is less at present, the research of applying fit detection target proteinBe on the increase, the detection new technology based on fit also constantly occurs. Aptamer is because the chemical antibody characteristic of its uniqueness becomesA new generation is for molecular medicine or the targeting vector of specific protein, and for detection of the target molecule material of its specific recognition.But at present the AFP diagnostic reagent that is directed to based on aptamer also lacks very much, and be directed to AFPThe exploitation of aptamer fluorescence probe detection kit there is not yet report.
Summary of the invention
The object of the invention is, behaviour a lot of for existing easy generation operating technology error, not good enough, the disturbing factor of repeatabilityMake loaded down with trivial details, the high deficiency of testing cost, a kind of AFP kit and inspection thereof based on aptamer fluorescence probe is providedSurvey method.
The solution of the present invention is by such realization:
Based on a fetoprotein reagent for aptamer fluorescence probe, it is characterized in that, main component comprises: containing NH4Cl、Tris、EDTA-Na2Erythrocyte cracked liquid; Containing MgCl20.2M phosphate buffer; Alpha-fetoprotein standard items; Alpha-fetoprotein coreThe fit fluorescence probe of acid; Described alpha-fetoprotein aptamer fluorescence probe is 5' and 3' two ends mark fluorescent pyrene molecule monomer respectivelyNucleotide single-chain, this nucleotide single-chain sequence is: ggatgcggtaacggtacgtacctgtatagtgtgacatcctGtctccaaccacctgctgacgtgc. This sequence called after AFP4.
Above-described a kind of fetoprotein reagent based on aptamer fluorescence probe, described containing NH4Cl、Tris、EDTA-Na2Erythrocyte cracked liquid for containing 1 ~ 280mmol/LNH4Cl,1~34mmol/LTris,1~2mmol/LEDTA-Na2, pH7.0 ~ 7.2; Described containing MgCl20.2M phosphate buffer for containing 1 ~ 10mmol/LMgCl2。
Arbitrary described a kind of fetoprotein reagent based on aptamer fluorescence probe, is characterized in that institute aboveState containing NH4Cl、Tris、EDTA-Na2Erythrocyte cracked liquid, containing MgCl20.2M phosphate buffer, alpha-fetoprotein standard items,Alpha-fetoprotein aptamer fluorescence probe be prepare the liquid reagent of direct use or use before need the dry powder that is dissolved in waterState.
Above-described a kind of fetoprotein reagent based on aptamer fluorescence probe, is characterized in that this reagentBox is for detection of the alpha-fetoprotein concentration in anticoagulant heparin whole blood or peripheral blood.
A kind ofly detect alpha-fetoprotein in order to upper arbitrary described fetoprotein reagent based on aptamer fluorescence probeThe method of concentration, is characterized in that, method step comprises:
(1) blood sample cracking: by blood sample with containing NH4Cl、Tris、EDTA-Na2Erythrocyte cracked liquid to press 1:0.5 ~ 5 volume ratio mixedEven, leave standstill 5 ~ 30min, the more centrifugal 5 ~ 10min of middling speed, collect supernatant;
(2) mixing ovum educates: mix ovum and educate: get the use of supernatant that 20 ~ 100 μ l step 1) obtain and 30 ~ 50ul containing MgCl2's0.2M phosphate buffer, dissolves the alpha-fetoprotein aptamer fluorescence probe reagent that alpha-fetoprotein aptamer fluorescence probe obtainsMix, under room temperature, ovum is educated 5 ~ 15min, makes the abundant combination of alpha-fetoprotein aptamer fluorescence probe and blood sample, obtains test fluid;
(3) fluoroscopic examination: fluorescence detector detecting step 2) the test fluid 50ul that obtains, after fluorescence detector fluorescence excitation,Read after fluorescence excitation in 20 to 100ns time periods wavelength at the fluorescent value of 480 ~ 500nm;
(4) result is calculated: use biomedical mapping software, and the calibration curve made from reference to alpha-fetoprotein standard sample, in conjunction withThe fluorescent value detecting in step 3) calculates the concentration of alpha-fetoprotein in blood sample.
Above-described biomedical software is Sigmaplot software, in buying on the market.
It is above-described that a kind of to use fetoprotein reagent based on aptamer fluorescence probe to detect alpha-fetoprotein denseThe method of degree, is characterized in that, in described alpha-fetoprotein aptamer fluorescence probe reagent, alpha-fetoprotein aptamer fluorescence is visitedPin concentration is 200 ~ 400nmol/L, and its characteristic is also, described alpha-fetoprotein aptamer fluorescence probe is 5' and 3' two endsThe nucleotide single-chain of mark fluorescent pyrene molecule monomer respectively, this nucleotide single-chain sequence is: ggatgcggtaacggtacgtacctgtatagtgtgacatcctgtctccaaccacctgctgacgtgc。
Alpha-fetoprotein aptamer fluorescence probe is not or not the time that alpha-fetoprotein is combined, and aptamer is in more open knotStructure, the pyrene molecule monomer at 5' and 3' two ends is mutually free, and after fluorescence excitation, emission wavelength is between 370 ~ 400nm; First tireProtein nucleic acid is fit fluorescence probe is in the time that alpha-fetoprotein is combined, and alpha-fetoprotein induces its recurring structure to change, aptamer 5' andThe pyrene molecule monomer at 3' two ends is mutually close, forms excitation state dimer, and after fluorescence excitation, excitation state dimer emission wavelength existsBetween 480 to 500nm.
It is above-described that a kind of to use fetoprotein reagent based on aptamer fluorescence probe to detect alpha-fetoprotein denseThe method of degree, is characterized in that, described blood sample is anticoagulant heparin whole blood or peripheral blood, described containing NH4Cl、Tris、EDTA-Na2Erythrocyte cracked liquid for containing 1 ~ 280mmol/LNH4Cl,1~34mmol/LTris,1~2mmol/LEDTA-Na2,pH7.0 ~ 7.2; Described containing MgCl20.2M phosphate buffer for containing 1 ~ 10mmol/LMgCl2; Described fluorescence detector is toolThe fluorimetric fluorescence detector of free resolution.
It is above-described that a kind of to use fetoprotein reagent based on aptamer fluorescence probe to detect alpha-fetoprotein denseThe method of degree, is characterized in that, this detection method is for detection of the alpha-fetoprotein concentration in anticoagulant heparin whole blood or peripheral blood.
Principle of the present invention is: when not with alpha-fetoprotein, aptamer is in more open structure, 5' and 3' twoThe pyrene molecule monomer of end is mutually free, and fluorescent emission wavelength is between 370 to 400nm; In the time that alpha-fetoprotein is combined, firstFetoprotein induction aptamer structure changes, and the pyrene molecule monomer at the 5' of aptamer and 3' two ends is mutually close, formsDimer, pyrene excited state emission wavelength dimer is between 480 to 500nm. Pyrene excitation state dimer fluorescence lifetime has lengthReach 100ns, longer than the biological sample autofluorescence life-span (being about 5ns), by detecting alpha-fetoprotein aptamer probe and sampleThe mixed fluorescence intensity of product and fluorescence lifetime, the concentration of alpha-fetoprotein in calculation sample.
Substantive distinguishing features of the present invention and marked improvement are:
(1) detect simple to operate fast, without complex sample processing with separate, aptamer probe is directly added after crackingBlood sample liquid, with the fluorescent value that just can detect 480 ~ 500nm place in the sepectrophotofluorometer short time;
(2) this kit and detection method thereof have highly sensitively, and testing result repeatability is high, sample detection error 0.01 ~Between 0.1%, high specificity, alpha-fetoprotein aptamer fluorescence probe is not or not the time that alpha-fetoprotein is combined, and aptamer is in comparingLoose structure, the pyrene molecule monomer at 5' and 3' two ends is mutually free, after fluorescence excitation emission wavelength 370 ~ 400nm itBetween; When it is combined with alpha-fetoprotein, alpha-fetoprotein induces it to change, the pyrene molecule monomer phase at aptamer 5' and 3' two endsClose mutually, form dimer, after fluorescence excitation, dimer emission wavelength is between 480 ~ 500nm.
(3) reagent used can make to prepare the liquid reagent that can directly use or use before use after being dissolved in waterDry powder, detecting reagent can storage at normal temperature, convenient transportation.
Detailed description of the invention
Below in conjunction with table 1 and embodiment, the AFP kit that the present invention is based on aptamer fluorescence probe is describedAnd detection method.
Kit reagent in table 1. embodiment becomes to be grouped into
Embodiment 1
After preparing according to the required reagent composition dissolving of embodiment in table 11, be distributed into bottle, carry out freeze drying, make dry powder examinationAgent; Before use, add ultra-pure water, after redissolving, use. 3 of each sample settings are parallel, and detecting step is as follows:
(1) blood sample cracking: by anticoagulant heparin whole blood, erythrocyte cracked liquid by volume 1:0.5 mix, leave standstill 30min, then middling speedCentrifugal 7min, collects supernatant;
(2) mixing ovum educates: that gets upper cleer and peaceful 45ul that 20 μ l step 1) obtain dissolves alpha-fetoprotein core with 0.2M phosphate bufferThe alpha-fetoprotein aptamer fluorescence probe reagent mix that the fit fluorescence probe of acid obtains, under room temperature, ovum is educated 5min, is testedLiquid;
(3) fluoroscopic examination: fluorescence detector detecting step 2) the test fluid 50ul that obtains, after fluorescence detector fluorescence excitation,Read after fluorescence excitation in 20 to 100ns time periods wavelength at the fluorescent value of 480 ~ 500nm;
(4) result is calculated: use biomedical mapping software, and the calibration curve made from reference to alpha-fetoprotein standard sample, in conjunction withThe fluorescent value detecting in step 3) calculates the concentration of alpha-fetoprotein in blood sample.
3 parallel determination errors of sample are 0.15 ± 0.01%.
Embodiment 2
After preparing according to the required reagent composition dissolving of embodiment in table 12, be distributed into bottle, carry out freeze drying, make dry powder examinationAgent; Before use, add ultra-pure water, after redissolving, use. 3 of each sample settings are parallel, and detecting step is as follows:
(1) blood sample cracking: by peripheral blood, erythrocyte cracked liquid by volume 1:2.5 mix, leave standstill 5min, then middling speed is centrifugal6min, collects supernatant;
(2) mixing ovum educates: get upper cleer and peaceful 30ul's that 50 μ l step 1) obtain
The alpha-fetoprotein aptamer fluorescence spy obtaining with 0.2M phosphate buffer dissolving alpha-fetoprotein aptamer fluorescence probePin reagent mix, under room temperature, ovum is educated 6min, obtains test fluid;
(3) fluoroscopic examination: fluorescence detector detecting step 2) the test fluid 50ul that obtains, after fluorescence detector fluorescence excitation,Read after fluorescence excitation in 20 to 100ns time periods wavelength at the fluorescent value of 480 ~ 500nm;
(4) result is calculated: use biomedical mapping software, and the calibration curve made from reference to alpha-fetoprotein standard sample, in conjunction withThe fluorescent value detecting in step 3) calculates the concentration of alpha-fetoprotein in blood sample. 3 parallel determination errors of sample are 0.02±0.01%。
Embodiment 3
After preparing according to the required reagent composition dissolving of embodiment in table 13, be distributed into bottle, carry out freeze drying, make dry powder examinationAgent; Before use, add ultra-pure water, after redissolving, use. 3 of each sample settings are parallel, and detecting step is as follows:
(1) blood sample cracking: by peripheral blood, erythrocyte cracked liquid by volume 1:3.5 mix, leave standstill 10min, then middling speed is centrifugal5min, collects supernatant;
(2) mixing ovum educates: get upper cleer and peaceful 45ul's that 75 μ l step 1) obtain
The alpha-fetoprotein aptamer fluorescence spy obtaining with 0.2M phosphate buffer dissolving alpha-fetoprotein aptamer fluorescence probePin reagent mix, under room temperature, ovum is educated 7min, obtains test fluid;
(3) fluoroscopic examination: fluorescence detector detecting step 2) the test fluid 50ul that obtains, after fluorescence detector fluorescence excitation,Read after fluorescence excitation in 20 to 100ns time periods wavelength at the fluorescent value of 480 ~ 500nm;
(4) result is calculated: use biomedical mapping software, and the calibration curve made from reference to alpha-fetoprotein standard sample, in conjunction withThe fluorescent value detecting in step 3) calculates the concentration of alpha-fetoprotein in blood sample.
3 parallel determination errors of sample are 0.04 ± 0.01%.
Embodiment 4
After preparing according to the required reagent composition dissolving of embodiment in table 14, be distributed into bottle, carry out freeze drying, make dry powder examinationAgent; Before use, add ultra-pure water, after redissolving, use. 3 of each sample settings are parallel, and detecting step is as follows:
(1) blood sample cracking: by anticoagulant heparin whole blood, erythrocyte cracked liquid by volume 1:0.5 mix, leave standstill 25min, then middling speedCentrifugal 8min, collects supernatant;
(2) mixing ovum educates: that gets upper cleer and peaceful 50ul that 100 μ l step 1) obtain dissolves alpha-fetoprotein core with 0.2M phosphate bufferThe alpha-fetoprotein aptamer fluorescence probe reagent mix that the fit fluorescence probe of acid obtains, under room temperature, ovum is educated 8min, is testedLiquid;
(3) fluoroscopic examination: fluorescence detector detecting step 2) the test fluid 50ul that obtains, after fluorescence detector fluorescence excitation,Read after fluorescence excitation in 20 to 100ns time periods wavelength at the fluorescent value of 480 ~ 500nm;
(4) result is calculated: use biomedical mapping software, and the calibration curve made from reference to alpha-fetoprotein standard sample, in conjunction withThe fluorescent value detecting in step 3) calculates the concentration of alpha-fetoprotein in blood sample.
3 parallel determination errors of sample are 0.05 ± 0.01%.
Embodiment 5
After preparing according to the required reagent composition dissolving of embodiment in table 15, be distributed into bottle, carry out freeze drying, make dry powder examinationAgent; Before use, add ultra-pure water, after redissolving, use. 3 of each sample settings are parallel, and detecting step is as follows:
(1) blood sample cracking: by anticoagulant heparin whole blood, erythrocyte cracked liquid by volume 1:1.0 mix, leave standstill 20min, then middling speedCentrifugal 9min, collects supernatant;
(2) mixing ovum educates: that gets upper cleer and peaceful 30ul that 80 μ l step 1) obtain dissolves alpha-fetoprotein core with 0.2M phosphate bufferThe alpha-fetoprotein aptamer fluorescence probe reagent mix that the fit fluorescence probe of acid obtains, under room temperature, ovum is educated 9min, is testedLiquid;
(3) fluoroscopic examination: fluorescence detector detecting step 2) the test fluid 50ul that obtains, after fluorescence detector fluorescence excitation,Read after fluorescence excitation in 20 to 100ns time periods wavelength at the fluorescent value of 480 ~ 500nm;
(4) result is calculated: use biomedical mapping software, and the calibration curve made from reference to alpha-fetoprotein standard sample, in conjunction withThe fluorescent value detecting in step 3) calculates the concentration of alpha-fetoprotein in blood sample.
3 parallel determination errors of sample are 0.03 ± 0.01%.
Embodiment 6
After preparing according to the required reagent composition dissolving of embodiment in table 16, be distributed into bottle, carry out freeze drying, make dry powder examinationAgent; Before use, add ultra-pure water, after redissolving, use. 3 of each sample settings are parallel, and detecting step is as follows:
(1) blood sample cracking: by anticoagulant heparin whole blood, erythrocyte cracked liquid by volume 1:4.5 mix, leave standstill 15min, then middling speedCentrifugal 10min, collects supernatant;
(2) mixing ovum educates: that gets upper cleer and peaceful 40ul that 30 μ l step 1) obtain dissolves alpha-fetoprotein core with 0.2M phosphate bufferThe alpha-fetoprotein aptamer fluorescence probe reagent mix that the fit fluorescence probe of acid obtains, under room temperature, ovum is educated 10min, is testedLiquid;
(3) fluoroscopic examination: fluorescence detector detecting step 2) the test fluid 50ul that obtains, after fluorescence detector fluorescence excitation,Read after fluorescence excitation in 20 to 100ns time periods wavelength at the fluorescent value of 480 ~ 500nm;
(4) result is calculated: use biomedical mapping software, and the calibration curve made from reference to alpha-fetoprotein standard sample, in conjunction withThe fluorescent value detecting in step 3) calculates the concentration of alpha-fetoprotein in blood sample.
3 parallel determination errors of sample are 0.08 ± 0.01%.
Embodiment 7
After preparing according to the required reagent composition dissolving of embodiment in table 17, be distributed into bottle, carry out freeze drying, make dry powder examinationAgent; Before use, add ultra-pure water, after redissolving, use. 3 of each sample settings are parallel, and detecting step is as follows:
(1) blood sample cracking: by peripheral blood, erythrocyte cracked liquid by volume 1:3.0 mix, leave standstill 18min, then middling speed is centrifugal8min, collects supernatant;
(2) mixing ovum educates: that gets upper cleer and peaceful 20ul that 50 μ l step 1) obtain dissolves alpha-fetoprotein core with 0.2M phosphate bufferThe alpha-fetoprotein aptamer fluorescence probe reagent mix that the fit fluorescence probe of acid obtains, under room temperature, ovum is educated 12min, is testedLiquid;
(3) fluoroscopic examination: fluorescence detector detecting step 2) the test fluid 50ul that obtains, after fluorescence detector fluorescence excitation,Read after fluorescence excitation in 20 to 100ns time periods wavelength at the fluorescent value of 480 ~ 500nm;
(4) result is calculated: use biomedical mapping software, and the calibration curve made from reference to alpha-fetoprotein standard sample, in conjunction withThe fluorescent value detecting in step 3) calculates the concentration of alpha-fetoprotein in blood sample.
3 parallel determination errors of sample are 0.1 ± 0.01%.
Embodiment 8
After preparing according to the required reagent composition dissolving of embodiment in table 18, be distributed into bottle, carry out freeze drying, make dry powder examinationAgent; Before use, add ultra-pure water, after redissolving, use. 3 of each sample settings are parallel, and detecting step is as follows:
(1) blood sample cracking: by peripheral blood, erythrocyte cracked liquid by volume 1:2.0 mix, leave standstill 26min, then middling speed is centrifugal6min, collects supernatant;
(2) mixing ovum educates: that gets upper cleer and peaceful 25ul that 60 μ l step 1) obtain dissolves alpha-fetoprotein core with 0.2M phosphate bufferThe alpha-fetoprotein aptamer fluorescence probe reagent mix that the fit fluorescence probe of acid obtains, under room temperature, ovum is educated 13min, is testedLiquid;
(3) fluoroscopic examination: fluorescence detector detecting step 2) the test fluid 50ul that obtains, after fluorescence detector fluorescence excitation,Read after fluorescence excitation in 20 to 100ns time periods wavelength at the fluorescent value of 480 ~ 500nm;
(4) result is calculated: use biomedical mapping software, and the calibration curve made from reference to alpha-fetoprotein standard sample, in conjunction withThe fluorescent value detecting in step 3) calculates the concentration of alpha-fetoprotein in blood sample.
3 parallel determination errors of sample are 0.02 ± 0.01%.
Embodiment 9
After preparing according to the required reagent composition dissolving of embodiment in table 19, be distributed into bottle, carry out freeze drying, make dry powder examinationAgent; Before use, add ultra-pure water, after redissolving, use. 3 of each sample settings are parallel, and detecting step is as follows:
(1) blood sample cracking: by peripheral blood, erythrocyte cracked liquid by volume 1:4.0 mix, leave standstill 8min, then middling speed is centrifugal7min, collects supernatant;
(2) mixing ovum educates: that gets upper cleer and peaceful 35ul that 40 μ l step 1) obtain dissolves alpha-fetoprotein core with 0.2M phosphate bufferThe alpha-fetoprotein aptamer fluorescence probe reagent mix that the fit fluorescence probe of acid obtains, under room temperature, ovum is educated 15min, is testedLiquid;
(3) fluoroscopic examination: fluorescence detector detecting step 2) the test fluid 50ul that obtains, after fluorescence detector fluorescence excitation,Read after fluorescence excitation in 20 to 100ns time periods wavelength at the fluorescent value of 480 ~ 500nm;
(4) result is calculated: use biomedical mapping software, and the calibration curve made from reference to alpha-fetoprotein standard sample, in conjunction withThe fluorescent value detecting in step 3) calculates the concentration of alpha-fetoprotein in blood sample.
3 parallel determination errors of sample are 0.01 ± 0.01%.
Sequence table
<110>Xu great Peng
<120>fetoprotein reagent and the detection method thereof based on aptamer fluorescence probe AFP4
<130>2016
<160>1
<170>PatentInversion3.3
<210>1
<211>39
<212>DNA
<213>artificial sequence
<400>1
ggatgcggtaacggtacgtacctgtatagtgtgacatcctgtctccaaccacctgctgacgtgc64
Claims (9)
1. the fetoprotein reagent based on aptamer fluorescence probe, is characterized in that, main component comprises: containNH4Cl、Tris、EDTA-Na2Erythrocyte cracked liquid; Containing MgCl20.2M phosphate buffer; Alpha-fetoprotein standard items; First tireProtein nucleic acid is fit fluorescence probe; Described alpha-fetoprotein aptamer fluorescence probe be 5' and 3' two ends respectively mark fluorescent pyrene divideThe nucleotide single-chain of sub-monomer, this nucleotide single-chain sequence is: ggatgcggtaacggtacgtacctgtatagtgtgacatcctgtctccaaccacctgctgacgtgc。
2. a kind of fetoprotein reagent based on aptamer fluorescence probe according to claim 1, is characterized in that,Described containing NH4Cl、Tris、EDTA-Na2Erythrocyte cracked liquid for containing 1～280mmol/LNH4Cl,1~34mmol/LTris,1~2mmol/LEDTA-Na2, pH7.0 ~ 7.2; Described containing MgCl20.2M phosphate buffer for containing 1 ~ 10mmol/LMgCl2。
3. a kind of fetoprotein reagent based on aptamer fluorescence probe according to claim 1 and 2, its feature existsIn, described containing NH4Cl、Tris、EDTA-Na2Erythrocyte cracked liquid, containing MgCl20.2M phosphate buffer, alpha-fetoprotein markAccurate product, alpha-fetoprotein aptamer fluorescence probe be prepare direct use liquid reagent or use before need to be dissolved in waterDry powder.
4. according to a kind of fetoprotein reagent based on aptamer fluorescence probe described in claim 1 ~ 3, its feature existsIn, this kit is for detection of the alpha-fetoprotein concentration in anticoagulant heparin whole blood or peripheral blood.
5. one kind is detected alpha-fetoprotein with the arbitrary described fetoprotein reagent based on aptamer fluorescence probe of right 1 ~ 3The method of concentration, is characterized in that, method step comprises:
(1) blood sample cracking: by blood sample with containing NH4Cl、Tris、EDTA-Na2Erythrocyte cracked liquid to press 1:0.5 ~ 5 volume ratio mixedEven, leave standstill 5 ~ 30min, the more centrifugal 5 ~ 10min of middling speed, collect supernatant;
(2) mixing ovum educates: get the use of supernatant that 20 ~ 100 μ l step 1) obtain and 30 ~ 50ul containing MgCl20.2M phosphoric acid slowRush liquid, dissolve the alpha-fetoprotein aptamer fluorescence probe reagent mix that alpha-fetoprotein aptamer fluorescence probe obtains, room temperatureLower ovum is educated 5 ~ 15min, makes the abundant combination of alpha-fetoprotein aptamer fluorescence probe and blood sample, obtains test fluid;
(3) fluoroscopic examination: fluorescence detector detecting step 2) the test fluid 50ul that obtains, after fluorescence detector fluorescence excitation,Read after fluorescence excitation in 20 to 100ns time periods wavelength at the fluorescent value of 480 ~ 500nm;
(4) result is calculated: use biomedical mapping software, and the calibration curve made from reference to alpha-fetoprotein standard sample, in conjunction withThe fluorescent value detecting in step 3) calculates the concentration of alpha-fetoprotein in blood sample.
6. according to claim 5ly a kind ofly use the fetoprotein reagent based on aptamer fluorescence probe to detect first tireThe method of protein concentration, is characterized in that, alpha-fetoprotein aptamer in described alpha-fetoprotein aptamer fluorescence probe reagentFluorescence probe concentration is 200 ~ 400nmol/L, and described alpha-fetoprotein aptamer fluorescence probe is 5' and 3' two ends mark respectivelyThe nucleotide single-chain of fluorescence pyrene molecule monomer, this nucleotide single-chain sequence is: ggatgcggtaacggtacgtacctgtatagtgtgacatcctgtctccaaccacctgctgacgtgc。
7. according to claim 6ly a kind ofly use the fetoprotein reagent based on aptamer fluorescence probe to detect first tireThe method of protein concentration, is characterized in that, described alpha-fetoprotein aptamer fluorescence probe not in the time that alpha-fetoprotein is combined, coreAcid is fit in more open structure, and the pyrene molecule monomer at 5' and 3' two ends is mutually free, and after fluorescence excitation, emission wavelength existsBetween 370 ~ 400nm; Described alpha-fetoprotein aptamer fluorescence probe is in the time that alpha-fetoprotein is combined, and alpha-fetoprotein is induced itRecurring structure changes, and the pyrene molecule monomer at aptamer 5' and 3' two ends is mutually close, forms excitation state dimer, fluorescence excitationRear excitation state dimer emission wavelength is between 480 to 500nm.
8. according to claim 5ly a kind ofly use the fetoprotein reagent based on aptamer fluorescence probe to detect first tireThe method of protein concentration, is characterized in that, described blood sample is anticoagulant heparin whole blood or peripheral blood, described containing NH4Cl、Tris、EDTA-Na2Erythrocyte cracked liquid for containing 1 ~ 280mmol/LNH4Cl,1~34mmol/LTris,1~2mmol/LEDTA-Na2, pH7.0 ~ 7.2; Described containing MgCl20.2M phosphate buffer for containing 1 ~ 10mmol/LMgCl2; DescribedFluorescence detector is the fluorescence detector with time-resolved fluorometry.
9. use the fetoprotein reagent based on aptamer fluorescence probe to detect first according to a kind of described in claim 5 ~ 7The method of fetoprotein concentration, is characterized in that, this detection method is for detection of the first tire egg in anticoagulant heparin whole blood or peripheral bloodWhite concentration.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610175971.9A CN105606582A (en) | 2016-03-25 | 2016-03-25 | Alpha fetoprotein kit based on aptamer fluorescent probe AFP4 and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610175971.9A CN105606582A (en) | 2016-03-25 | 2016-03-25 | Alpha fetoprotein kit based on aptamer fluorescent probe AFP4 and detection method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105606582A true CN105606582A (en) | 2016-05-25 |
Family
ID=55986687
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610175971.9A Pending CN105606582A (en) | 2016-03-25 | 2016-03-25 | Alpha fetoprotein kit based on aptamer fluorescent probe AFP4 and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105606582A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106501533A (en) * | 2016-10-17 | 2017-03-15 | 柳州立洁科技有限公司 | Based on high-affinity analeptic aptamer EPO4 erythropoietin analeptic test kits and its detection method |
| CN106645054A (en) * | 2016-10-17 | 2017-05-10 | 柳州立洁科技有限公司 | INS4 insulin kit based on high-affinity aptamer fluorescent probe and detection method of kit |
| CN107144617A (en) * | 2017-05-11 | 2017-09-08 | 青岛大学 | A kind of preparation method of the fit electrochemical sensor of graphene oxide/alpha-fetoprotein |
| CN107941767A (en) * | 2017-11-23 | 2018-04-20 | 王颖皓 | Glutathione kit and its detection method based on nucleic acid aptamer fluorescence probe GSH2 |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101358241A (en) * | 2008-09-16 | 2009-02-04 | 山东亚大药业有限公司 | Method of prenatal gene screen for down's syndrome using nucleated erythrocyte and kit |
| CN101819206A (en) * | 2009-12-08 | 2010-09-01 | 广州市丰华生物工程有限公司 | AFP (Alpha-Fetoprotein) testing kit (time-resolved fluoroimmunoassay) for prenatal screening and preparation method thereof |
| CN102732606A (en) * | 2012-02-27 | 2012-10-17 | 南昌大学 | Liver cancer diagnostic kit based on nucleic acid aptamers |
| CN104131105A (en) * | 2014-08-11 | 2014-11-05 | 复旦大学附属中山医院 | Method for screening aptamer specifically bound with alpha-fetoprotein |
| CN104597246A (en) * | 2014-11-30 | 2015-05-06 | 陈燕婷 | Homocysteine kit based on aptamer fluorescence probe HCy2 and detection method thereof |
| EP2921857A1 (en) * | 2014-03-18 | 2015-09-23 | Medizinische Universität Wien | Soluble AXL receptor tyrosine kinase in the diagnosis of cancer |
| CN104931478A (en) * | 2015-06-11 | 2015-09-23 | 江南大学 | Method for super-sensitively detecting alpha fetalprotein based on surface enhanced raman scattering effect of silver nanoparticle tripolymer |
-
2016
- 2016-03-25 CN CN201610175971.9A patent/CN105606582A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101358241A (en) * | 2008-09-16 | 2009-02-04 | 山东亚大药业有限公司 | Method of prenatal gene screen for down's syndrome using nucleated erythrocyte and kit |
| CN101819206A (en) * | 2009-12-08 | 2010-09-01 | 广州市丰华生物工程有限公司 | AFP (Alpha-Fetoprotein) testing kit (time-resolved fluoroimmunoassay) for prenatal screening and preparation method thereof |
| CN102732606A (en) * | 2012-02-27 | 2012-10-17 | 南昌大学 | Liver cancer diagnostic kit based on nucleic acid aptamers |
| EP2921857A1 (en) * | 2014-03-18 | 2015-09-23 | Medizinische Universität Wien | Soluble AXL receptor tyrosine kinase in the diagnosis of cancer |
| CN104131105A (en) * | 2014-08-11 | 2014-11-05 | 复旦大学附属中山医院 | Method for screening aptamer specifically bound with alpha-fetoprotein |
| CN104597246A (en) * | 2014-11-30 | 2015-05-06 | 陈燕婷 | Homocysteine kit based on aptamer fluorescence probe HCy2 and detection method thereof |
| CN104931478A (en) * | 2015-06-11 | 2015-09-23 | 江南大学 | Method for super-sensitively detecting alpha fetalprotein based on surface enhanced raman scattering effect of silver nanoparticle tripolymer |
Non-Patent Citations (1)
| Title |
|---|
| CHAO-JYUN HUANG ET AL.: "An integrated microfluidic system for rapid screening of alpha-fetoprotein-specific aptamers", 《BIOSENSORS AND BIOELECTRONICS》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106501533A (en) * | 2016-10-17 | 2017-03-15 | 柳州立洁科技有限公司 | Based on high-affinity analeptic aptamer EPO4 erythropoietin analeptic test kits and its detection method |
| CN106645054A (en) * | 2016-10-17 | 2017-05-10 | 柳州立洁科技有限公司 | INS4 insulin kit based on high-affinity aptamer fluorescent probe and detection method of kit |
| CN107144617A (en) * | 2017-05-11 | 2017-09-08 | 青岛大学 | A kind of preparation method of the fit electrochemical sensor of graphene oxide/alpha-fetoprotein |
| CN107144617B (en) * | 2017-05-11 | 2019-10-01 | 青岛大学 | A kind of preparation method of graphene oxide/alpha-fetoprotein aptamer electrochemical sensor |
| CN107941767A (en) * | 2017-11-23 | 2018-04-20 | 王颖皓 | Glutathione kit and its detection method based on nucleic acid aptamer fluorescence probe GSH2 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lambrecht et al. | Prospects in non-invasive assessment of liver fibrosis: Liquid biopsy as the future gold standard? | |
| CN105606582A (en) | Alpha fetoprotein kit based on aptamer fluorescent probe AFP4 and detection method thereof | |
| Zhang et al. | Evaluation of the diagnostic value of alpha-l-fucosidase, alpha-fetoprotein and thymidine kinase 1 with ROC and logistic regression for hepatocellular carcinoma | |
| CN104597246B (en) | Homocysteine test kit and detection method thereof based on nucleic acid aptamer fluorescence probe HCy2 | |
| CN105603101A (en) | Application of system for detecting expression quantity of eight miRNAs in preparation of product for diagnosing or assisting in diagnosing hepatocellular carcinoma | |
| CN105785034B (en) | Fetoprotein reagent and its detection method based on nucleic acid aptamer fluorescence probe AFP3 | |
| CN105785033B (en) | Fetoprotein reagent and its detection method based on nucleic acid aptamer fluorescence probe AFP5 | |
| Krier et al. | The asymptomatic outpatient with abnormal liver function tests | |
| CN103122387B (en) | Rapid circulating tumor cell (CTCs) fluorescence PCR (Polymerase Chain Reaction) hypersensitivity detection kit and application thereof | |
| CN105651754A (en) | Nucleic acid aptamer fluorescent probe based alpha-fetoprotein AFP2 kit and detection method | |
| CN105651755A (en) | Nucleic acid aptamer fluorescent probe based alpha-fetoprotein AFP1 kit and detection method | |
| CN109580951A (en) | The kit and its application method of multispecific antibody joint-detection early liver cancer marker | |
| CN106970076A (en) | It is a kind of to be used for sxemiquantitative aptamer test strips that TNF α are detected and preparation method thereof | |
| CN101358973B (en) | Hepatocarcinoma early diagnosis kit based on ZnO nano-bar array | |
| CN104597008B (en) | Homocysteine kit based on aptamer fluorescent probe HCy3 and detection method thereof | |
| CN105044053B (en) | Glycosylated hemoglobin kit and its detection method based on nucleic acid aptamer fluorescence probe | |
| CN104597007B (en) | Homocysteine kit based on aptamer fluorescence probe HCy5 and detection method thereof | |
| Gruttadauria et al. | Early graft dysfunction following adult-to-adult living-related liver transplantation: predictive factors and outcomes | |
| CN106568750A (en) | GFAP detection method based on fluorescence resonance energy transfer method | |
| CN106645053A (en) | INS3 insulin kit based on high-sensitivity aptamer fluorescence probe and detecting method thereof | |
| CN104568867A (en) | Homocysteine (HCy) kit based on aptamer fluorescent probe, and detection method of HCy kit | |
| CN107907515A (en) | One kind detection glutathione probe reagent box and its detection method | |
| CN106645742A (en) | High-specificity aptamer fluorescent probe based insulin (INS1) reagent kit and detecting method thereof | |
| CN106645054A (en) | INS4 insulin kit based on high-affinity aptamer fluorescent probe and detection method of kit | |
| CN106525784A (en) | INS5 insulin kit based on aptamer fluorescent probe and detection method of INS5 insulin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160525 |