CN105602974A - Construction method of drug-resistant Escherichia coli intergrase integration vector pUC19-attI-400-attC - Google Patents
Construction method of drug-resistant Escherichia coli intergrase integration vector pUC19-attI-400-attC Download PDFInfo
- Publication number
- CN105602974A CN105602974A CN201510681476.0A CN201510681476A CN105602974A CN 105602974 A CN105602974 A CN 105602974A CN 201510681476 A CN201510681476 A CN 201510681476A CN 105602974 A CN105602974 A CN 105602974A
- Authority
- CN
- China
- Prior art keywords
- attc
- atti
- puc19
- integrase
- escherichia coli
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a construction method of a drug-resistant Escherichia coli intergrase integration vector pUC19-attI-400-attC. The recombinant containing attI and attC recombinant sites is constructed, a 440bp DNA sequence exists between the attI and attC recombinant sites, the vector is small and only contains 3270bp, the attI and attC sites can be simultaneously cut, the attC site also can be individually cut, and the vector also contains more than 10 multiple cloning sites, so a user can conveniently select suitable restrictive endonuclease to research the action site of intergrase; and the vector has aminobenzyl resistance, is convenient to screen, can be used to carry out in vitro detection of the vector model of the integration activity of the drug-resistant bacterial intergrase, and also can be used to explore the integration mechanism of other bacterial integrons.
Description
Technical field
The present invention relates to genetic engineering field, be specifically related to a kind of drug resistance Escherichia coli integrase integration vectorThe construction method of pUC19-attI-400-attC.
Background technology
Under antibiotic selection pressure, bacterial resistance bacterial strain constantly increases, and wherein bacterium passes through geneHorizontal transfer to obtain exogenous drug resistant gene be that bacterium forms multidrug resistant a kind of important approach. IntegrateThe Plasmid of son-box gene System-mediated extremely closes because of the fast propagation that can explain drug resistant geneNote. Integron can be positioned at plasmid, chromosome or self and participate in shifting as a part of transposons,Integron is made up of 3 parts: 5 ' conservative end, 3 ' conservative end and variable region between the two. 5 'Conservative end is the basic structure of integron, comprises gene (intI), the integron weight of the integrase of encodingGroup site attI and integron variable region promoter (Pant). IntI belongs to tyrosine integrase family,The integration of catalysis box gene between integron recombination site attI and box gene recombination site attC and cuttingCut. AttC site is an incomplete inverted repeats, and contain one can be integrated enzyme identificationSpecificity integration site. The length in attC site is 57～141bp, and the conservative feature of its topnotch is twoThe core site of individual 7bp: core site GTTRRRY and the reverse core site claiming in contrastRYYYAAC. Variable region is the gene that inserts certain function of coding, as drug resistant gene, is called box gene (geneCassette), found at present to exceed the box gene of kind more than 80 including antibiotics resistance. Box gene is totalBe with 5 '-3 ' direction be integrated into integron, it can be obtained under the effect of upstream promoter PantTo express. Captive box gene 5 ' end is combined with the attI of integrase and 3 ' end and attC generationSpecificity is integrated.
JuliaE in 2009 etc. think that integrase is integrated with two kinds of mechanism. The 1st kind: integrase is from integratingIn son (donor), a box gene of excision, forms a covalently closed circle, and then it is inserted into another integrationThe attC site of son (acceptor); The 2nd kind: donor and the receptor plasmid of integrase restructuring, these plasmidsBe all the single cointegrate plasmid being formed by attI or attC site, they can be divided by integraseBecome two independent plasmids, a plasmid (acceptor) is caught and is obtained box gene by box, and another plasmid losesGo, it is as broad as long by sequencing that their last boxes of forming of these two kinds of mechanism catch product.Doctor Yang Zehua in 2008 does integron and catches the research of box gene efficiency regulatory mechanism, set up measure wholeZygote is caught the new method of box gene efficiency. Having got Wei in 2010 doctor has done integrons of bacteria and catches and showReach the research of drug resistance gene box regulatory mechanism, set up class 1 integron rapid gene localization method. BaseBecause integrating activity methods in vitro, sets up treatment tool enzyme phiC31 human immunodeficiency virus HIV-1Integrase external activity detection method is also set up, but bacterial drug resistance integrase active determination in vitro methodAlso not success. Bacterium, by the integrase of integron system, catches external drug resistant gene, makes bacterium toolThere are resistance and multi-drug resistant, cause the propagation of bacterium multi-drug resistant. Research shows that Escherichia coli I type is wholeThe recall rate of zygote is in rising trend, and bacterium integrase when integron is caught box gene plays very heavyThe effect of wanting, if therefore build a plasmid vector model, is used for bacterial detection drug resistance integrase externalThe activity of integrating, the method that can suppress for finding integrase activity lays the first stone.
Summary of the invention
For addressing the above problem, the invention provides a kind of drug resistance Escherichia coli integrase integration vectorThe construction method of pUC19-attI-400-attC, this carrier contain attI and attC recombination site andThe recombinant vector of interval 440bpDNA sequence between attI and attC site, can be used for studying drug resistanceEscherichia coli integron is caught process, efficiency, the mechanism of external drug resistant gene.
For achieving the above object, the technical scheme that the present invention takes is:
The construction method of drug resistance Escherichia coli integrase integration vector pUC19-attI-400-attC, comprisesFollowing steps:
S1, taking 440DNA as template, carry out pcr amplification with following primer, obtain 440bpinsertion;
F：CGGGATCCAGGGCGAGGAGCTGTTCACC；
R：ACGCGTCGACGTTGTGGCTGTTGTAGTTG；
S2, taking NCBI report attI and attC sequence as template, design Auele Specific Primer also adds and carriesBody PUC19 has identical restriction enzyme site and protectiveness base, utilizes the restructuring of round pcr amplification integrase geneSite attI and box gene genetic recombination site attC sequence fragment, then by recombination site attI and attCSequence clone is to carrier PUC19;
S3, adopt DNAGelExtractionKit to carry out purifying the PCR product of step S1 gainedUse BamHISalI37 DEG C of enzyme to cut 1h with pUC19 carrier afterwards, it is as follows that enzyme is cut system:
PCR product 43 μ L, carrier 10 μ L, 10Xbuffer5 μ L, 10Xbuffer5 μ L, BamHI1μL、BamHI1μL、SalI1μL、SalI1μL、ddH2O33μL；
S4, by the enzyme of gained cut product adopt DNAGelExtractionKit carry out using after purifyingPromegaT4DNALigase room temperature connects 2h, transforms DH5alpha competence, obtains drug resistance large intestineBacillus integrase integration vector pUC19-attI-400-attC; Linked system is as follows;
DNA fragmentation 3.5 μ L, carrier 1 μ L, T4DNALigase0.5Ml, 10Xligasebuffer1μL。
Wherein, the PCR reaction system in described step S1 is:
10×PCRBuffer2.5μL；dNTP(2.5mM)1.6μL；primersF(5P)
1μL；primersR(5P)1μL；Taq(5U/μL)0.125μL；ddH2016.775μL；DNA2μL。
Wherein, described attI carries out pcr amplification by following Auele Specific Primer:
F：AATTC
tgatgttatggagcagcaacgatgttacgcagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaggcatcGAGCT
R：C
GATGCCTAACTTTGTTTTAGGGCGACTGCCCTGCTGCGTAACATCGTTGCTGCTGCGTAACATCGTTGCTGCTCCATAACATCAC。
Wherein, described attC carries out pcr amplification by following Auele Specific Primer:
F：G
gcctaacccttccatcgagggggacgtccaagggctggcgcccttggccgcccctcatgtcaaacgttaggtA
R；AGCTT
ACCTAACGTTTGACATGAGGGGCGGCCAAGGGCGCCAGCCCTTGGACGTCCCCCTCGATGGAAGGGTTAGGCCTGCA。
Wherein, described attI/attC fragment is used following system annealing: fragment F (100 μ M) 4.5μ L; Fragment R (100 μ M) 4.5 μ L; 10Xannealingbuffer1 μ L.
The present invention has following beneficial effect:
Build and contained attI and attC recombination site and interval between attI and attC siteThe recombinant vector of 440bpDNA sequence, carrier essence is little, only has 3270bp, can cut attI simultaneouslyWith attC site, also can cut separately attC site, carrier itself also contains more than 10 kind of polyclone positionPoint, is convenient to user and selects applicable restriction enzyme to study the action site of integrase, and it is with ammoniaBenzyl resistance, is convenient to screening, can be used for the active carrier model that vitro detection bacterial drug resistance integrase is integrated,Also can be used for exploring the integrated mechanism of other integrons of bacterias.
Brief description of the drawings
Fig. 1 is the flow chart of the embodiment of the present invention.
Fig. 2 is the drug resistance Escherichia coli integrase integration vector in the embodiment of the present inventionThe structure chart of pUC19-attI-400-attC.
Detailed description of the invention
In order to make objects and advantages of the present invention clearer, below in conjunction with embodiment, the present invention is carried outFurther describe. Should be appreciated that specific embodiment described herein is only in order to explain the present invention,Be not intended to limit the present invention.
As shown in Figure 1-2, drug resistance Escherichia coli integrase integration vector pUC19-attI-400-attCConstruction method, comprise the steps:
S1, taking 440DNA as template, carry out pcr amplification with following primer, obtain 440bpinsertion;
F：CGGGATCCAGGGCGAGGAGCTGTTCACC；
R：ACGCGTCGACGTTGTGGCTGTTGTAGTTG；
PCR reaction system is:
10×PCRBuffer2.5μL；dNTP(2.5mM)1.6μL；primersF(5P)
1μL；primersR(5P)1μL；Taq(5U/μL)0.125μL；ddH2O16.775μL；DNA2μL；
S2, taking NCBI report attI and attC sequence as template, design Auele Specific Primer also adds and carriesBody PUC19 has identical restriction enzyme site and protectiveness base, utilizes the restructuring of round pcr amplification integrase geneSite attI and box gene genetic recombination site attC sequence fragment, then by recombination site attI and attCSequence clone is to carrier PUC19;
AttI carries out pcr amplification by following Auele Specific Primer:
F：AATTC
tgatgttatggagcagcaacgatgttacgcagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaggcatcGAGCT
R：C
GATGCCTAACTTTGTTTTAGGGCGACTGCCCTGCTGCGTAACATCGTTGCTGCTGCGTAACATCGTTGCTGCTCCATAACATCAC；
AttC carries out pcr amplification by following Auele Specific Primer:
F：G
gcctaacccttccatcgagggggacgtccaagggctggcgcccttggccgcccctcatgtcaaacgttaggtA
R；AGCTT
ACCTAACGTTTGACATGAGGGGCGGCCAAGGGCGCCAGCCCTTGGACGTCCCCCTCGATGGAAGGGTTAGGCCTGCA；
S3, adopt DNAGelExtractionKit to carry out purifying the PCR product of step S1 gainedUse BamHISalI37 DEG C of enzyme to cut 1h with pUC19 carrier afterwards, it is as follows that enzyme is cut system:
PGR product 43 μ L, carrier 10 μ L, 10Xbuffer5 μ L, 10Xbuffer5 μ L, BamHI1μL、BamHI1μL、SalI1μL、SalI1μL、ddH2O33μL；
S4, by the enzyme of gained cut product adopt DNAGelExtractionKit carry out using after purifyingPromegaT4DNALigase room temperature connects 2h, transforms DH5alpha competence, obtains drug resistance large intestineBacillus integrase integration vector pUC19-attI-400-attC; Linked system is as follows;
DNA fragmentation 3.5 μ L, carrier 1 μ L, T4DNALigase0.5Ml, 10Xligasebuffer1μL。
Described attI/attC fragment is used following system annealing: fragment F (100 μ M) 4.5 μ L; SheetSection R (100 μ M) 4.5 μ L; 10Xannealingbuffer1 μ L.
Whether this concrete enforcement by the following method checking carrier builds successful:
(1) can carry out PCR method inspection by the primer order of the complete attI+440bp+attC fragment of amplification;
(2) can check with restriction enzyme.
This is concrete implements to have built and contains attI and attC recombination site and between attI and attC siteThe recombinant vector of interval 440bpDNA sequence, carrier essence is little, only has 3270bp, can cut simultaneouslyAttI and attC site, also can cut separately attC site, and carrier itself also contains many grams of kinds more than 10Grand site, is convenient to user and selects applicable restriction enzyme to study the action site of integrase, its bandThere is ammonia benzyl resistance, be convenient to screening, can be used for the active carrier that vitro detection bacterial drug resistance integrase is integratedModel, also can be used for exploring the integrated mechanism of other integrons of bacterias
The above is only the preferred embodiment of the present invention, it should be pointed out that common for the artTechnical staff, under the premise without departing from the principles of the invention, can also make some improvements and modifications,These improvements and modifications also should be considered as protection scope of the present invention.
Claims (5)
1. the construction method of drug resistance Escherichia coli integrase integration vector pUC19-attl-400-attC,It is characterized in that, comprise the steps:
S1, taking 440DNA as template, carry out pcr amplification with following primer, obtain 440bpinsertion;
F：CGGGATCCAGGGCGAGGAGCTGTTCACC；
R：ACGCGTCGACGTTGTGGCTGTTGTAGTTG；
S2, taking NCBI report attI and attC sequence as template, design Auele Specific Primer also adds and carriesBody PUC19 has identical restriction enzyme site and protectiveness base, utilizes the restructuring of round pcr amplification integrase geneSite attI and box gene genetic recombination site attC sequence fragment, then by recombination site attI and attCSequence clone is to carrier PUC19;
S3, adopt DNAGelExtractionKit to carry out purifying the PCR product of step S1 gainedUse BamHlSall37 DEG C of C enzyme to cut 1h with pUC19 carrier afterwards, it is as follows that enzyme is cut system:
PCR product 43 μ L, carrier 10 μ L, 10Xbuffer5 μ L, 10Xbuffer5 μ L, BamHl1μL、BamHl1μL、Sall1μL、Sall1μL、ddH2O33μL；
S4, by the enzyme of gained cut product adopt DNAGelExtractionKit carry out using after purifyingPromegaT4DNALigase room temperature connects 2h, transforms DH5alpha competence, obtains drug resistance large intestineBacillus integrase integration vector pUC19-attI-400-attC; Linked system is as follows;
DNA fragmentation 3.5 μ L, carrier 1 μ L, T4DNALigase0.5MI, 10Xligasebuffer1μL。
2. drug resistance Escherichia coli integrase integration vector according to claim 1
The construction method of pUC19-attI-400-attC, is characterized in that, the PCR reaction in described step S1System is:
10×PCRBuffer2.5μL；dNTP(2.5mM)1.6μL；primersF(5P)1μL；primersR(5P)1μL；Taq(5U/μL)0.125μL；ddH2016.775μL； DNA2μL。
3. drug resistance Escherichia coli integrase integration vector according to claim 1
The construction method of pUC19-attI-400-attC, is characterized in that, described attI is by following specificityPrimer carries out pcr amplification:
F：AATTC
tgatgttatggagcagcaacgatgttacgcagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaggcatcGAGCT
R：C
GATGCCTAACTTTGTTTTAGGGCGACTGCCCTGCTGCGTAACATCGTTGCTGCTGCGTAACATCGTTGCTGCTCCATAACATCAC。
4. drug resistance Escherichia coli integrase integration vector according to claim 1
The construction method of pUC19-attI-400-attC, is characterized in that, described attC is by following specificityPrimer carries out pcr amplification:
F：G
gcctaacccttccatcgagggggacgtccaagggctggcgcccttggccgcccctcatgtcaaacgttaggtA
R；AGCTT
ACCTAACGTTTGACATGAGGGGCGGCCAAGGGCGCCAGCCCTTGGACGTCCCCCTCGATGGAAGGGTTAGGCCTGCA。
5. drug resistance Escherichia coli integrase integration vector according to claim 1
The construction method of pUC19-attI-400-attC, is characterized in that, described attI/attC fragment use withLower system annealing:
Fragment F (100 μ M) 4.5 μ L; Fragment R (100 μ M) 4.5 μ L; 10Xannealingbuffer1μL。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510681476.0A CN105602974A (en) | 2015-10-13 | 2015-10-13 | Construction method of drug-resistant Escherichia coli intergrase integration vector pUC19-attI-400-attC |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510681476.0A CN105602974A (en) | 2015-10-13 | 2015-10-13 | Construction method of drug-resistant Escherichia coli intergrase integration vector pUC19-attI-400-attC |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105602974A true CN105602974A (en) | 2016-05-25 |
Family
ID=55983317
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510681476.0A Pending CN105602974A (en) | 2015-10-13 | 2015-10-13 | Construction method of drug-resistant Escherichia coli intergrase integration vector pUC19-attI-400-attC |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105602974A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108018334B (en) * | 2018-01-25 | 2021-07-16 | 河套学院 | Method for determining drug-resistant escherichia coli integrase activity |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517318A (en) * | 2008-03-18 | 2012-06-27 | 复旦大学附属华山医院 | Gene recombination method utilizing integrating subsystem to carry out point fixing and orientation |
| EP2634256A1 (en) * | 2012-03-01 | 2013-09-04 | Institut Pasteur | De novo integron recombination sites and uses thereof |
| CN104878037A (en) * | 2015-05-18 | 2015-09-02 | 王冬国 | Integron In1085 |
-
2015
- 2015-10-13 CN CN201510681476.0A patent/CN105602974A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102517318A (en) * | 2008-03-18 | 2012-06-27 | 复旦大学附属华山医院 | Gene recombination method utilizing integrating subsystem to carry out point fixing and orientation |
| EP2634256A1 (en) * | 2012-03-01 | 2013-09-04 | Institut Pasteur | De novo integron recombination sites and uses thereof |
| CN104878037A (en) * | 2015-05-18 | 2015-09-02 | 王冬国 | Integron In1085 |
Non-Patent Citations (2)
| Title |
|---|
| 林居纯 等: "食品动物源大肠杆菌多重耐药菌株整合子-基因盒的分子特征", 《畜牧兽医学报》 * |
| 范建华 等: "禽源大肠杆菌多重耐药性与Ⅰ类整合子的关系", 《江苏农业科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108018334B (en) * | 2018-01-25 | 2021-07-16 | 河套学院 | Method for determining drug-resistant escherichia coli integrase activity |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jiang et al. | CRISPR-Cas: new tools for genetic manipulations from bacterial immunity systems | |
| Song et al. | CRISPR-Cas9D10A nickase-assisted genome editing in Lactobacillus casei | |
| Francis et al. | Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon | |
| Smalla et al. | Exogenous isolation of antibiotic resistance plasmids from piggery manure slurries reveals a high prevalence and diversity of IncQ-like plasmids | |
| Stokes et al. | Class 1 integrons potentially predating the association with Tn 402-like transposition genes are present in a sediment microbial community | |
| Azor et al. | Universal in vitro antifungal resistance of genetic clades of the Fusarium solani species complex | |
| Wang et al. | Eliminating mcr-1-harbouring plasmids in clinical isolates using the CRISPR/Cas9 system | |
| Wensing et al. | A CRISPR interference platform for efficient genetic repression in Candida albicans | |
| CN107142272A (en) | A kind of method for controlling plasmid replication in Escherichia coli | |
| CN106554969A (en) | Mutiple Targets CRISPR/Cas9 expression vectors based on bacteriostasis and sterilization | |
| Piano et al. | Recombination-dependent concatemeric viral DNA replication | |
| Tidjani et al. | Massive gene flux drives genome diversity between sympatric Streptomyces conspecifics | |
| CN106995813A (en) | Genome large fragment Direct Cloning and DNA polymoleculars assembling new technology | |
| McKay et al. | Genetic and morphological characterization of Cladobotryum species causing cobweb disease of mushrooms | |
| JP2014513530A5 (en) | ||
| JP2014513532A5 (en) | ||
| Kwong et al. | Staphylococcus aureus multiresistance plasmid pSK41: analysis of the replication region, initiator protein binding and antisense RNA regulation | |
| Ventura et al. | Molecular characterization of hsp20, encoding a small heat shock protein of Bifidobacterium breve UCC2003 | |
| Wang et al. | Mitochondrial genome polymorphisms in the human pathogenic fungus Cryptococcus neoformans | |
| Licandro-Seraut et al. | Development of an efficient in vivo system (Pjunc-TpaseIS 1223) for random transposon mutagenesis of Lactobacillus casei | |
| Bardaji et al. | Plasmid replicons from Pseudomonas are natural chimeras of functional, exchangeable modules | |
| CN105602974A (en) | Construction method of drug-resistant Escherichia coli intergrase integration vector pUC19-attI-400-attC | |
| Lunde et al. | Prevalence, diversity and transferability of the Tn 916-Tn 1545 family ICE in oral streptococci | |
| Suzzi | From wild strain to domesticated strain: the philosophy of microbial diversity in foods | |
| CN104388456A (en) | Construction method of vector capable of simultaneously expressing two sgRNAs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160525 |