CN105586393A - Rapid detection kit for mycobacterium tuberculosis and use method of rapid detection kit - Google Patents
Rapid detection kit for mycobacterium tuberculosis and use method of rapid detection kit Download PDFInfo
- Publication number
- CN105586393A CN105586393A CN201410639698.1A CN201410639698A CN105586393A CN 105586393 A CN105586393 A CN 105586393A CN 201410639698 A CN201410639698 A CN 201410639698A CN 105586393 A CN105586393 A CN 105586393A
- Authority
- CN
- China
- Prior art keywords
- detection kit
- mycobacterium tuberculosis
- bip
- fip
- derivatives
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a rapid detection kit for mycobacterium tuberculosis. The rapid detection kit is characterized in that repetitive sequences of the mycobacterium tuberculosis are taken as target genes, and three pairs of primers, namely, inner primers FIP/BIP and outer primers F3/B3 are designed by adopting a loop-mediated isothermal amplification technology. The rapid detection kit for mycobacterium tuberculosis is high in detection sensitivity and strong in specificity, and has the minimum detection quantity being 1-10 bacteria/mL.
Description
Technical field
Content of the present invention is Much's bacillus quick detection kit and using method thereof, belongs in vitro diagnostic reagent field.
Background technology
Add up: global 1/3 population (approximately 2,000,000,000) has infected tulase global existing tuberculosis patient 2,000 ten thousand, the annual about 800-1000 ten thousand of newly detected cases according to the World Health Organization. Wherein 95% in developing country, and the between twenty and fifty patient in 15-50 year accounts for 75% of morbidity number. If do not taken immediate steps, estimating will have 300,000,000 people to infect tubercle bacillus in 10 years from now on, and tuberculosis death at present reaches all-time high, and the whole world has 8000 people to die from tuberculosis every day; Have every year 3000000 people to die from tuberculosis, wherein 98% tuberculosis death occurs in developing country, and therefore tuberculosis has become one of infectious disease of serious harm human health.
Tuberculosis due to m tuberculosis infection is one of human infectious disease the most general in the world today, its incidence of disease, case fatality rate are in rising trend in the world, the public health problem of serious harm human health. in recent years, China is lungy popular very serious, epidemic situation declines slowly, there is the trend of rise in some area, and these situations have caused the great attention of Chinese scholar. Therefore, China's one of infectious disease using tuberculosis as keypoint control. But early detection lungy mainly depends on laboratory diagnosis technology. Along with the development of Protocols in Molecular Biology, the new technology of tuberculosis molecule epidemic disease-ology research, drug resistance research is also progressively set up. The application of Protocols in Molecular Biology in tuberculosis research field, make people can to Much's bacillus carry out more responsive, special, detect and identify fast and accurately.
The nineties in 20th century, KaryMillis has invented round pcr (polymerase chain reaction). As revolutionary a breakthrough of biology field, in the century in the past, the development of the detection technique based on nucleic acid taking polymerase chain reaction (PCR) as representative rapidly, for the accurate detection diagnosis of other pathogen provides possibility, meanwhile, round pcr has also been brought into play important effect in the field such as medical science, the science of law. Through the improvement of decades, PCR method develops into quantitatively from qualitative, can, in several hours, start amplification to billions of specific nucleic acid fragments, and specificity also be greatly improved from several copies or individual cells. But from the birth of round pcr, it cannot break away from the limitation that relies on superior instrument and equipment all the time, makes taking PCR as basic nucleic acid amplification detection technique promotion and application more widely.
The nineties, nucleic acid isothermal amplification technique did not continue to bring out development, comprised amplification technique (NASBA), self-sustained sequence replication (3SR), strand displacement amplification (SDA) and the loop-mediated isothermal amplification technique etc. of nucleotide sequence. Wherein loop-mediated isothermal amplification technique, because it has the advantages such as sensitivity, specificity is higher, the reaction time is short, has obtained admitting more and more widely and applying.
Based on this strong demand, obtain in recent years swift and violent development taking nucleic acid isothermal amplification technique (LAMP) as basic detection technique. The temperature technique that waits of number of mechanisms is not only born, and some technology is quite ripe, has completed the transition from laboratory to practical application, just progressively finds broad application in fields such as molecular biology, medical science, the science of law. Particularly, at clinical and on-the-spot (point-of-care) quick diagnosis technical elements, nucleic acid isothermal amplification technique has shown the superiority that it is outstanding. What is more important, nucleic acid isothermal amplification technique is owing to not needing the time course of variations in temperature and having broken away from the dependence to superior instrument and equipment, can make state-of-the-art diagnostic techniques obtain and realize in more extensive Countryside, we are able to fast and high-throughout realization the detection diagnosis of pathogen.
Summary of the invention
The object of the invention is for Clinical detection pulmonary tuberculosis provides that a kind of detection sensitivity is high, high specificity, detection time is short, cost is low reagent kit product.
Object of the present invention can realize by following technical measures: a kind of Much's bacillus quick detection kit, it is characterized in that, described Mycobacterium tuberculosis detection kit comprises two pairs of primers that design as target gene, based on loop-mediated isothermal amplification technique taking the repetitive sequence of Much's bacillus: inner primer FIP/BIP and outer primer F3/B3 and ring primers F LP/BLP, and two pairs of described primers are:
F3(SEQIDN01)：TCGGACCACCAGCACC
B3(SEQIDN02)：GCGGGTCCAGATGGCTTG
FIP(SEQIDN03)：CACGTAGGCGAACCCTGCCCTTTTTAACCGGCTGTGGGTAGC
BIP(SEQIDN04)：CTTTGTCACCGACGCCTACGTCTTTTTCGCGTCGAGGACCATG
In specific implementation process, in the middle of inner primer, 4 link T bases can be removed, and become following four primers:
F3(SEQIDN01)：TCGGACCACCAGCACC
B3(SEQIDN02)：GCGGGTCCAGATGGCTTG
FIP(SEQIDN05)：CACGTAGGCGAACCCTGCCCTAACCGGCTGTGGGTAGC
BIP(SEQIDN06)：CTTTGTCACCGACGCCTACGTCTCGCGTCGAGGACCATG
Described BstDNA polymerase concentration is 5-15U/ μ L, and described reactant liquor contains: 0.1～2mmol/LdNTP, 15～30mmol/LTris-HCL, 10～15mmol/LKCL, 8mmol/L (NH 4 )2SO4、4～10mmol/LMgSO4, 0～0.5 volume %TritonX-100, 0.8～1.5mol/L betaine, described sample pretreatment liquid contains: 10～25mmol/LpH8.0Tris-HCL, 1～3mmol/LEDTA and 1～1.5 volume %TritonX-100, described nitrite ion is SYBRGreenI or visual indicator 1-(1-hydroxyl-2-naphthylazo)-6-nitro-beta naphthal-4-sodium sulfonate or derivatives thereof or 4-(2-pyridylazo) resorcinol sodium salt or derivatives thereof, described inner primer FIP/BIP concentration is respectively 0.2～2 μ mol/L, outer primer F3/B3 concentration is respectively 0.1～1 μ mol/L.
The method comprises the steps:
(1) testing sample is liquefied with sodium hydroxide solution, then the centrifugal supernatant that goes, is precipitated;
(2) precipitation of step (1) is added to 50～100 μ L sample pretreatment liquid, mix, process about 10 minutes in boiling water bath, high speed centrifugation after cooled on ice, draws supernatant and is DNA sample to be detected;
(3) according to detection kit formula, each reactive component is added to reacting hole successively, then add yin and yang attribute quality-control product and DNA sample to be measured, 60～65 DEG C of isothermal reactions, reaction time is 20-40min, the Constant Temperature Detection equipment that uses can be both constant temperature quantitative real time PCR Instrument (supporting the use with SYBRGreenI indicator), can be also water bath with thermostatic control (supporting the use with visual indicator 1-(1-hydroxyl-2-naphthylazo)-6-nitro-beta naphthal-4-sodium sulfonate or derivatives thereof or 4-(2-pyridylazo) resorcinol sodium salt or derivatives thereof).
Compared with prior art, the present invention has following beneficial effect:
1. the tuberculosis the present invention relates to is propped up bacillus quick detection kit high specificity, and it has three pairs of primers, increase, and concretion mycobacterium nucleic acid amplification (PCR) fluorescence detection reagent kit only has pair of primers for eight fragments of specific target target;
2. it is highly sensitive that the tuberculosis the present invention relates to is propped up bacillus quick detection kit, 1-10 bacterium/mL can be detected, consistent with phlegm cultivation and clinical data result, do not depositing false positive problem;
3. it is fast that the tuberculosis the present invention relates to is propped up the detection speed of bacillus quick detection kit, and after gene extracts, the augmentation detection time was less than 1 hour. Cost is low, also can judge amplification by change color, need to be by expensive Real-timePCR instrument.
In a word, Much's bacillus quick detection kit high specificity, highly sensitive, detection speed is fast, cost is low, can dwindle greatly the gap of town and country detection level, has promotion prospect.
Detailed description of the invention
For the present invention is easier to understand, will further set forth specific embodiment of the invention scheme below:
Primer is synthetic by Invitrogen company or Sheng Gong biotech firm; BstDNAPolymerase (largefragment) is purchased from NEB company or MCLAB company; DNTP is purchased from Invitrogen company or biotinylated biomolecule company; SYBRGreen I is that quantitative fluorescent PCR is used; MgSO4Deng chemical reagent be analyze pure; It is pure that 1-(1-hydroxyl-2-naphthylazo)-6-nitro-beta naphthal-4-sodium sulfonate or derivatives thereof or 4-(2-pyridylazo) resorcinol sodium salt or derivatives thereof are analysis; Much's bacillus PCR National reference for detection kit (authentication code: No. 0042, (2010) state raw ginseng word) is purchased from National Institute for Food and Drugs Control.
Ring mediation primer is:
F3(SEQIDN01)：TCGGACCACCAGCACC
B3(SEQIDN02)：GCGGGTCCAGATGGCTTG
FIP(SEQIDN03)：CACGTAGGCGAACCCTGCCCTTTTTAACCGGCTGTGGGTAGC
BIP(SEQIDN04)：CTTTGTCACCGACGCCTACGTCTTTTTCGCGTCGAGGACCATG
BstDNA polymerase concentration is 8U/ μ L;
Described reactant liquor contains: 0.16mmol/LdNTP, 20mmol/LTris-HCL, 10mmol/LKCL, 10mmol/L (NH4)2SO4、6mmol/LMgSO4, 0.1 volume %TritonX-100,1mol/L betaine;
Described sample pretreatment liquid contains: 20mmol/LpH8.0Tris-HCL, 1mmol/ and 1 volume %TritonX-100;
Described nitrite ion is SYBRGreenI or visual indicator 1-(1-hydroxyl-2-naphthylazo)-6-nitro-beta naphthal-4-sodium sulfonate or derivatives thereof or 4-(2-pyridylazo) resorcinol sodium salt or derivatives thereof
Described inner primer FIP/BIP concentration is respectively 1.6 μ mol/L, and outer primer F3/B3 concentration is respectively 0.2 μ mol/L.
The method comprises the steps:
(1) testing sample is liquefied with sodium hydroxide solution, then the centrifugal supernatant that goes, is precipitated;
(2) precipitation of step (1) is added to 50～100 μ L sample pretreatment liquid, mix, process about 10 minutes in boiling water bath, high speed centrifugation after cooled on ice, draws supernatant and is DNA sample to be detected;
(3) according to detection kit formula, each reactive component is added to reacting hole successively, then add yin and yang attribute quality-control product and DNA sample to be measured, 65 DEG C of isothermal reactions, reaction time is 40min, the Constant Temperature Detection equipment that uses can be both constant temperature quantitative real time PCR Instrument (supporting the use with SYBRGreenI indicator), can be also water bath with thermostatic control (supporting the use with visual indicator).
Test 1 sensitivity experiment
In sterile working environment, add successively each reacted constituent by above-mentioned system, wherein detected sample is 4 parts of limit of identification reference materials in National reference, the unicellular bacterial suspension being prepared from by Much's bacillus (CMCC93009), is respectively S1 (103Individual bacterium/mL), S2 (102Individual bacterium/mL), S3 (101Individual bacterium/mL), S4 (100Individual bacterium/mL); Negative quality-control product. In nucleic acid isothermal amplification instrument 65 DEG C, reaction 40min. Detect amplification curve as Fig. 1. All there is amplified reaction in National reference S1, S2, S3, amplified reaction does not occur S4, so 40 minutes limits of identification of the method amplification are between 100-101(1-10) individual bacterium/mL.
Test 2 specific tests
In sterile working environment, add successively each reacted constituent by above-mentioned system, wherein detected sample is 15 parts of negative reference materials in National reference (is respectively mycobacterium avium, soil mycobacterium, Amur mycobacterium, mycobacterium kansasii, Asia mycobacterium, Mycobacterium scrofulaceum, mycobacterium gordonae, tortoise purulence mycobacterium, mycobacterium fortuitum, Mycobacterium graminis, Brazilian Nocard's bacillus, Beijing corynebacterium, pneumococcus, legionella pneumophilia, pertussis and wins special Salmonella). Specification is: 104Individual bacterium/mL, is numbered N1-N15; Positive quality control product; Negative quality-control product; In nucleic acid isothermal amplification instrument 65 DEG C, reaction 40min. Detect amplification curve as Fig. 2. Except positive quality control product generation amplified reaction, all there is not amplified reaction in other 15 parts negative reference material testing results, and testing result is negative, the method high specificity is described, no cross reaction.
Test 3 repeatability (or accuracy)
In sterile working environment, add successively each reacted constituent by above-mentioned system, wherein detected sample is 10 parts of repeatability (or accuracy) reference material in National reference, the unicellular bacterial suspension being prepared from by Much's bacillus (CMCC93009), specification is 102Individual bacterium/mL, is numbered: J1-J10; Negative quality-control product; In nucleic acid isothermal amplification instrument 65 DEG C, reaction 40min. Detect amplification curve as Fig. 3. Detect 10 parts of precision samples in National reference normal amplified reaction all occurs, illustrate that this method repeatability is good.
Test 4 clinical tuberculosis case pattern detection
In sterile working environment, add successively each reacted constituent by above-mentioned system, wherein detected sample is 48 parts of the samples such as sputum, ascites, heart liquid, brain liquid, joint fluid, urine of communicable-disease center of Heilongjiang Province Clinical detection, wherein known 46 parts of the each paratuberculosis positive samples (wherein secondary pulmonary tuberculosis 30 examples) of making a definite diagnosis; 2 parts of tuberculosis ' negative ' specimens; Positive quality control product; Negative quality-control product. In nucleic acid isothermal amplification instrument 65 DEG C, reaction 40min.
Control test reagent: there is the concretion mycobacterium nucleic acid detection kit (fluorescence quantitative PCR method) of national production approval number, lowest detection sensitivity 101Individual bacterium/mL.
The comparison of ring mediated method and fluorescence PCR detection reagent kit testing result
Last institute should be noted that; above embodiment is only in order to illustrate technical scheme of the present invention but not limiting the scope of the invention; although the present invention is described in detail with reference to better embodiment; those of ordinary skill in the art is to be understood that; can modify or be equal to replacement technical scheme of the present invention, and not depart from essence and the scope of technical solution of the present invention.
Brief description of the drawings
Fig. 1. sensitivity detects amplification curve, wherein: 1-103Individual bacterium/mL amplification curve; 2-102Individual bacterium/mL amplification curve; 3-101Individual bacterium/mL amplification curve; 4-100Individual bacterium/mL amplification curve; The negative Quality Control amplification curve of 5-;
Fig. 2. specific detection amplification curve, wherein: 1-positive quality control amplification curve; The negative Quality Control amplification curve of 2-; N1-N15 is 15 parts of negative reference material amplification curves;
Fig. 3. precision detects SDAMP amplification curve, wherein: the negative character control of 1-amplification curve; J1-J10 is 10 parts of precision sample amplification curves.
SEQUENCELISTING
<110>Harbin De Ge bio tech ltd
<120>a kind of Mycobacterium tuberculosis quick detection kit and using method thereof
<160>6
<210>1
<211>16
<212>DNA
<213>manually synthetic
<400>1
TCGGACCACCAGCACC16
<210>2
<211>18
<212>DNA
<213>manually synthetic
<400>2
GCGGGTCCAGATGGCTTG18
<210>3
<211>42
<212>DNA
<213>manually synthetic
<400>3
CACGTAGGCGAACCCTGCCCTTTTTAACCGGCTGTGGGTAGC42
<210>4
<211>43
<212>DNA
<213>manually synthetic
<400>4
CTTTGTCACCGACGCCTACGTCTTTTTCGCGTCGAGGACCATG43
<210>5
<211>38
<212>DNA
<213>manually synthetic
<400>5
CACGTAGGCGAACCCTGCCCTAACCGGCTGTGGGTAGC38
<210>6
<211>39
<212>DNA
<213>manually synthetic
<400>6
CTTTGTCACCGACGCCTACGTCTCGCGTCGAGGACCATG39
Claims (6)
1. a Much's bacillus quick detection kit, it is characterized in that, described Mycobacterium tuberculosis detection kit comprises two pairs of primers that design as target gene, based on loop-mediated isothermal amplification technique taking the repetitive sequence of Much's bacillus: inner primer FIP/BIP and outer primer F3/B3, and described primer is:
F3：TCGGACCACCAGCACC
B3：GCGGGTCCAGATGGCTTG
FIP：CACGTAGGCGAACCCTGCCCTTTTTAACCGGCTGTGGGTAGC
BIP：CTTTGTCACCGACGCCTACGTCTTTTTCGCGTCGAGGACCATG。
2. Mycobacterium tuberculosis detection kit according to claim 1, is characterized in that, can 4 in the middle of described inner primer FIP/BIP T base link or link by other bases, include but not limited to become following four primers:
F3：TCGGACCACCAGCACC
B3：GCGGGTCCAGATGGCTTG
FIP：CACGTAGGCGAACCCTGCCCTAACCGGCTGTGGGTAGC
BIP：CTTTGTCACCGACGCCTACGTCTCGCGTCGAGGACCATG。
3. Mycobacterium tuberculosis detection kit according to claim 1, is characterized in that, described Mycobacterium tuberculosis detection kit also comprises the compositions such as BstDNA polymerase, reactant liquor, sample pretreatment liquid, colored indicator.
4. according to the Mycobacterium tuberculosis detection kit described in claim 1,2 and 3, it is characterized in that, described BstDNA polymerase concentration is 5-15U/ μ L, and described reactant liquor contains: 0.1～2mmol/LdNTP, 15～30mmol/LTris-HCL, 10～15mmol/LKCL, 5～15mmol/L (NH4)2SO4、4～10mmol/LMgSO4, 0～0.5 volume %TritonX-100,0.8～1.5mol/L betaine, described sample pretreatment liquid contains: 10～25mmol/LpH8.0Tris-HCL, 1～3mmol/LEDTA and 1～1.5 volume %TritonX-100, described nitrite ion is SYBRGreenI or visual indicator 1-(1-hydroxyl-2-naphthylazo)-6-nitro-beta naphthal-4-sodium sulfonate or derivatives thereof or 4-(2-pyridylazo) resorcinol sodium salt or derivatives thereof (number of patent application: 2012103800936)
Described inner primer FIP/BIP concentration is respectively 0.2～2 μ mol/L, and outer primer F3/B3 concentration is respectively 0.1～1 μ mol/L.
5. according to the Mycobacterium tuberculosis detection kit described in claim 1,2,3 and 4, it is characterized in that, the method comprises the steps:
(1) testing sample is first liquefied (sputum needs liquefaction, and hydrothorax can liquefy) with sodium hydroxide solution, then the centrifugal supernatant that goes, is precipitated;
(2) precipitation of step (1) is added to 50～100 μ L sample pretreatment liquid, mix, process about 10 minutes in boiling water bath, high speed centrifugation after cooled on ice, draws supernatant and is DNA sample to be detected;
(3) according to detection kit formula, each reactive component is added to reacting hole successively, then add yin and yang attribute quality-control product and DNA sample to be measured, 60～65 DEG C of isothermal reactions, observation reaction result.
6. Mycobacterium tuberculosis detection kit according to claim 5, it is characterized in that, isothermal reaction condition is 60～65 DEG C, reaction time is 20-40min, the Constant Temperature Detection equipment that uses can be both constant temperature quantitative real time PCR Instrument (supporting the use with SYBRGreenI indicator), can be also water bath with thermostatic control (supporting the use with visual indicator 1-(1-hydroxyl-2-naphthylazo)-6-nitro-beta naphthal-4-sodium sulfonate or derivatives thereof or 4-(2-pyridylazo) resorcinol sodium salt or derivatives thereof).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410639698.1A CN105586393A (en) | 2014-11-13 | 2014-11-13 | Rapid detection kit for mycobacterium tuberculosis and use method of rapid detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410639698.1A CN105586393A (en) | 2014-11-13 | 2014-11-13 | Rapid detection kit for mycobacterium tuberculosis and use method of rapid detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105586393A true CN105586393A (en) | 2016-05-18 |
Family
ID=55926294
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410639698.1A Pending CN105586393A (en) | 2014-11-13 | 2014-11-13 | Rapid detection kit for mycobacterium tuberculosis and use method of rapid detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105586393A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110295165A (en) * | 2018-03-21 | 2019-10-01 | 北京智德医学检验所有限公司 | One group for detecting the LAMP primer and application of mycobacterium tuberculosis in intraocular liquid |
| CN110527734A (en) * | 2018-05-25 | 2019-12-03 | 上海奥奈特生物科技有限责任公司 | The primer and kit of one group of Visual retrieval mycobacterium tuberculosis |
-
2014
- 2014-11-13 CN CN201410639698.1A patent/CN105586393A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110295165A (en) * | 2018-03-21 | 2019-10-01 | 北京智德医学检验所有限公司 | One group for detecting the LAMP primer and application of mycobacterium tuberculosis in intraocular liquid |
| CN110527734A (en) * | 2018-05-25 | 2019-12-03 | 上海奥奈特生物科技有限责任公司 | The primer and kit of one group of Visual retrieval mycobacterium tuberculosis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112458210B (en) | Gene conserved sequence, primer probe combination, kit and application for detecting new coronavirus | |
| CN101570795B (en) | Mycobacterium tuberculosis gene rapid diagnostic primer based on loop-mediated isothermal amplification technology and use in preparing rapid diagnostic kit | |
| CN104120184B (en) | A kind of method utilizing amplification of DNA fragments length polymorphism to measure Short interfering RNA | |
| AU2020102244A4 (en) | Primer group, kit and detection method for rapidly detecting carbapenemases genes | |
| CN105586393A (en) | Rapid detection kit for mycobacterium tuberculosis and use method of rapid detection kit | |
| CN107287320A (en) | The LAMP detections of GAPDH genes are combined and kit with primer | |
| CN105176995B (en) | Thalassemia α can be detected simultaneously based on hydrolysis probes method21.9The kit that deletion form and α 2 make a variation | |
| CN106916903A (en) | The real-time fluorescence RT PCR detection methods and kit of mycobacterium tuberculosis 85B mRNA | |
| CN103993090A (en) | Specific nucleotides for providencia O31, O41, O42, O43 and O50 and application of specific nucleotides | |
| CN103525936A (en) | Specific identification for transgenic rice kefeng No.6 strain via adoption of RPA (Recombinase Ploymerase Amplification) technology | |
| CN102994650A (en) | Multi-gene detection method of encephalitis viruses based on capillary electrophoresis | |
| CN107385048B (en) | Nucleic acid composition, kit and method for detecting dendrobium officinale | |
| CN107058517B (en) | Kit for detecting mycobacterium tuberculosis infection and detection method | |
| CN102146467A (en) | Reagent for detecting Yersinia pestis and method for carrying out fluorescence quantitative PCR (Polymerase Chain Reaction) detection on Yersinia pestis | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| CN105936943B (en) | A kind of Marburg virus RT-LAMP detection method of rapid sensitive | |
| CN105238878B (en) | Sugarcane streak mosaic virus RT-LAMP primer sets, detection method and its application | |
| CN105567831B (en) | A kind of detection method of food microorganisms qualitative and quantitative | |
| CN105063193A (en) | HDA kit and detecting method for detecting xanthomonas oryzae of rice | |
| CN112553350A (en) | Method for rapidly detecting multiple mycobacteria | |
| CN104673933A (en) | Novel bunyavirus reverse transcription loop-mediated isothermal amplification detection method and kit | |
| CN101168779B (en) | Kit for detecting bacillus tubercle and special-purpose probe and primer for the same | |
| CN111676300A (en) | Fluorescent quantitative PCR method for detecting toxigenic chlamydia pneumoniae and corresponding kit | |
| CN110195128B (en) | Nucleotide sequence of skin type HPV typing detection primer based on constant temperature nucleic acid amplification technology and application | |
| CN105420353B (en) | DPO primers, method and the kit of real-time fluorescence PCR detection enterococcus faecium based on DPO primers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160518 |