CN105561339A - Application of miRNA (micro-ribonucleic acid) composition to preparing non-small cell lung cancer resisting medicines - Google Patents
Application of miRNA (micro-ribonucleic acid) composition to preparing non-small cell lung cancer resisting medicines Download PDFInfo
- Publication number
- CN105561339A CN105561339A CN201510964586.8A CN201510964586A CN105561339A CN 105561339 A CN105561339 A CN 105561339A CN 201510964586 A CN201510964586 A CN 201510964586A CN 105561339 A CN105561339 A CN 105561339A
- Authority
- CN
- China
- Prior art keywords
- mir
- cell
- tumor
- mirna
- lung cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention belongs to the field of genetic engineering, and particularly relates to application of a novel miRNA (micro-ribonucleic acid) composition to preparing non-small cell lung cancer resisting medicines. Transformation of lung tumor-associated fibroblasts of non-small cell lung cancer to normal fibroblasts can be promoted by means of changing expression level of the miRNA composition; the novel miRNA composition includes miR-1, miR-206 and miR-31. The application has the advantages that the miR-1/miR-206 are simultaneously over expressed in the lung tumor-associated fibroblasts of the non-small cell lung cancer, the miR-31 is expressed at low level in the lung tumor-associated fibroblasts of the non-small cell lung cancer, accordingly, transformation of the lung tumor-associated fibroblasts to the normal fibroblasts can be promoted, anti-tumor effects can be realized at cell and animal level, and the miRNA composition has potential anti-tumor application value.
Description
Technical field
The invention belongs to genetic engineering field, particularly non-small cell lung tumor associated fibroblast cell is to the structure of normal fibroblast method for transformation and the application in antineoplaston
Background technology
Fibroblast is the tissue of people and the key cellular constituents of tumor, can be divided into the fibroblast of tranquillization and activation.Such as, described fibroblast can by the activation of height at wound healing position.The fibroblast of activation invades diseased region and produces extracellular matrix (Extracellularmatrixc, ECM), serves as the support of other cells.Once wound repair, the fibroblast of activation returns to the phenotype of tranquillization, and this is called as normal fibroblast (NormalFibroblasts, NFs).Think at present: the development of tumor is not only determined by malignant tumor cells, also need the tumor fibroblast by activation or the participation of tumor associated fibroblast cell (Carci-noma-associated-fibroblast, CAFs).Normal fibroblast (NormalFibroblasts, NFs) with tumor associated fibroblast cell (Carci-noma-associated-fibroblast, CAFs) in morphology, difference is little, but functionally really difference is totally different, tumor associated fibroblast cell (CAFs) can by secretion cytokine profiles, and chemotactic factor and extracellular matrix promote tumor cell proliferation and progress.Somatomedin, such as, VEGF (VEGF), transforming growth factor (TGF) and FGF2 (FGF2), all there is the function promoting that tumor cell is long-living, and normal fibroblast (NormalFibroblastsNFs) really do not have above function.If a kind of method that tumor associated fibroblast cell (CAFs) transforms to normal fibroblast (NormalFibroblastsNFs) that promotes therefore can be found, tumor cell then can be made to lose the support of the various types of cells factor of growth needs, thus play antineoplastic action from another approach.The method being at present no matter antitumor drug or antineoplaston is most for tumor cell itself, and is blank substantially for the medicine of tumor associated fibroblast cell (CAFs) and method.The present invention is by from being promoted by a kind of new method tumor associated fibroblast cell (CAFs) to transform to normal fibroblast (NormalFibroblastsNFs) thus play antineoplastic action in nonsmall-cell lung cancer.
MicroRNA (miRNA) is the non-coding RNA that a class is little, in various physiology and pathological process, play important regulating action.Increasing evidence shows not only playing a role in process in cancerous cell is formed of miRNA, and plays regulating action in fibroblastic conversion and activation.Such as, miR-31, miR-214 and miR-155 reprogrammed can promote the conversion of NF to CAF of ovarian cancer.The expression raising miR-106b in the CAF of gastric cancer can promote stomach cancer cell migration and invasion.The CAF that miR-21 is found in colorectal cancer significantly raises and the latter helps lend some impetus to growth and the invasion and attack of colorectal cancer.But in pulmonary carcinoma, it is still unclear to the conversion of tumor associated fibroblast cell (CAFs) how miRNA participates in normal fibroblast (NFs).
The data display of announcing according to World Health Organization (WHO) (WHO), pulmonary carcinoma is one of modal malignant tumor, first of row male common cancer, the 2nd, 3 of row women common cancer.Nonsmall-cell lung cancer accounts for 80% of all pulmonary carcinoma, the patients with lung cancer of more than 2/3rds shifts when diagnosing, often lose surgical engine meeting, and it is not also good enough for the chemotherapeutics effect of pulmonary carcinoma, patient easily produces drug resistance, five year survival rate, lower than 5%, is needed badly and is found method that is new, effective treatment pulmonary carcinoma.Studied in the past and often concentrate on antitumor cell itself, and more and more studied discovery, it is also play an important role that tumor microenvironment is formed in tumor.Inventor finds that the expression by changing miR-1, miR-206 and miR-31 can promote that the tumor associated fibroblast cell of lung nonsmall-cell lung cancer is to the conversion of normal fibroblast, can play antineoplastic action equally.The treatment nonsmall-cell lung cancer aspect that is prepared in of this new method has good application prospect.
Summary of the invention
Goal of the invention
The object of this invention is to provide brand-new non-small cell lung tumor associated fibroblast cell is applied to antineoplaston from nonsmall-cell lung cancer to the construction method that normal fibroblast transforms
A compositions of miRNA, is characterized in that described compositions comprises pre-miR-1, pre-miR-206 and anti-miR-31.
The compositions of described a kind of miRNA, is characterized in that described being combined in is prepared to promote that the tumor associated fibroblast cell of lung nonsmall-cell lung cancer is to the application in the conversion medicine of normal fibroblast.
The compositions of described a kind of miRNA, is characterized in that the application of described compositions in preparation treatment antitumor drug.
Tumor of the present invention can be pulmonary carcinoma (comprising nonsmall-cell lung cancer and small cell lung cancer), hepatocarcinoma, intestinal cancer, gastric cancer, leukemia, breast carcinoma, glioma, the cancers such as lymphatic cancer.Especially effective to nonsmall-cell lung cancer.
The sequence of pre-miR-1:
UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAA GAAGUAUGUAUCUCA, is shown in SEQNO:1.
The sequence of pre-miR-206:
UGCUUCCCGAGGCCACAUGCUUCUUUAUAUCCCCAUAUGGAUUACUUUGCUAUGGA AUGUAAGGAAGUGUGUGGUUUCGGCAAGUG, is shown in SEQNO:2.
The sequence of anti-miR-31: GCTATGCCAGCATCTTGCC, is shown in SEQNO:3.
Specifically:
1, apply miRNA chip technology and detect miRNA expression discovery in the normal fibroblast (NFs) of Patients with Non-small-cell Lung tumor associated fibroblast cell (CAFs) and pairing: compared with NFs, in CAFs, the downward of miR-1/miR-206 is the most obvious; The rise of miR-31 is the most obvious.Utilize lipofecmine-2000 (purchased from invitrogen company) cotransfection pre-miR-1, pre-miR-206 and anti-miR-31 is in tumor associated fibroblast cell (CAFs), can promote that it is to the conversion of normal fibroblast (NFs): the cell namely after transfection by with lung carcinoma cell Dual culture after can suppress lung carcinoma cell invasion and clonality significantly, and play antitumor action on animal model.
2, the present invention adopts pre-miR-1, and pre-miR-206, anti-miR-31, as miR-1, miR-206 targeting sequencing and miR-31 interference sequence, produce Expected Results.In fact, other, about miR-1, miR-206 targeting sequencing and miR-31 interference sequence compositions, can realize effect of the present invention too.The present invention protection domain are also not limited to above-mentioned composition scope, and also protection has about other corresponding sequences of miR-1, miR-206 and miR-31 compositions simultaneously.
Beneficial effect
1. the conversion of tumor associated fibroblast cell to normal fibroblast of lung nonsmall-cell lung cancer is promoted by the expression of change one group of miRNA.The combination that this group miRNA is brand-new is: miR-1, miR-206 and miR-31.By simultaneously process LAN miR-1/miR-206 in the tumor associated fibroblast cell of lung nonsmall-cell lung cancer, low expression miR-31 can promote that it is to the conversion of normal fibroblast, thus play antineoplastic action at cell and animal level, there is the using value of potential anti-nonsmall-cell lung cancer
2. antineoplaston comparatively conventional at present is all directed to tumor cell itself, and the present invention, by promoting that the fibroblastic normalization of tumor plays antineoplastic action, is the new method for the treatment of tumor.
Accompanying drawing explanation
Fig. 1: miRNA expression in the normal fibroblast (NF) of gene microarray analysis 3 routine Patients with Non-small-cell Lung tumor associated fibroblast cell (CAF) and pairing, redness expresses up-regulated, and blue expression expresses decline.
The expression of miR-1, miR-206 and miR-31 in the normal fibroblast (NF) of Fig. 2: 15 pairs of Patients with Non-small-cell Lung tumor associated fibroblasts cell (CAF) and pairing, U6 is set to internal reference.
Fig. 3: Transwell method detects transfection pre-miR-1, to A549 and H460 cell Infiltration and metastasis capacity in pre-miR-206 and anti-miR-31 to tumor associated fibroblast cell (CAF).*p<0.05
Fig. 4: colony formation detects transfection pre-miR-1, the impact on A549 and H460 cell clonality in pre-miR-206 and anti-miR-31 to tumor associated fibroblast cell (CAF).*p<0.05
Fig. 5: 4-5 week age nude mice divide 5 groups to plant respectively at random: A549, A549+CAFs or A549+CAFs-TM, the weight of transplanted tumor in nude mice after 21 days.CAFs-TM represents: pre-miR-1, pre-miR-206 and anti-miR-31 are to tumor associated fibroblast cell (CAF).*p<0.05，**p<0.01
Fig. 6: 4-5 week age nude mice divide 5 groups to plant respectively at random: A549, A549+CAFs or A549+CAFs-TM, pulmonary metastases HE dyeing.CAFs-TM represents: cotransfection pre-miR-1, pre-miR-206 and anti-miR-31 are to tumor associated fibroblast cell (CAF).*p<0.05，**p<0.01
Fig. 7: 4-5 week age nude mice divide 3 groups to plant respectively at random: the change of Lung metastases index after A549, A549+CAFs or A549+CAFs-TM.CAFs-TM represents: pre-miR-1, pre-miR-206 and anti-miR-31 are to tumor associated fibroblast cell (CAF).The weight of the quantity/subcutaneous primary tumors of Lung metastases index=Pulmonary metastases.
Detailed description of the invention
The invention will be further elaborated by the following examples, but do not limit the present invention.
General explanation:
In embodiment end indicate actual conditions experimental technique, substantially all according to " Molecular Cloning: A Laboratory guide (the 3rd edition) " (MolecularCloning:ALaboratoryManual, 3 that the people such as Sambrook, J write
rded. yellow training hall etc. are translated, Science Press .2002.8) described in condition and method or the condition of advising according to material supplier and method carry out, other technology do not described in detail is the standard method known corresponding to those skilled in the art.
Material of the present invention: the cell strain mentioned in the application, liposome and culture medium all have supply of commodities or can for public's gained with other approach, they are only for example, not unique to the present invention, can replace with other instrument be applicable to and biomaterial respectively.
The preparation method of pre-miR-1: 1.pre-miR-1 sequence (pUC57-Simple-pre-miR-1) is synthesized by Nanjing KaiJi Biology Science Development Co., Ltd.Object carrier pYr-mir30-shRNA-2 is purchased from Changsha Yingrun Biological Technology Co., Ltd.; 2. pre-miR-1 fragment is cloned on pYr-mir30-shRNA-2 carrier; 3. clone is carried out order-checking to confirm; 4. plasmid extraction.
The same pre-miR-1 of preparation method of pre-miR-206.
Anti-miR-31 is the miR-31 repressor by synthetic, play the effect suppressing the ripe miR-31 of endogenous to express), utilize lipofecmine-2000 (purchased from invitrogen company) by pre-miR-1, pre-miR-206 and anti-miR-31 is transfected in A549 and H460 cell jointly, play and raise miR-1 simultaneously, the effect that miR-206 and downward miR31 expresses.
Embodiment 1
One. the differential expression of miRNA in non-small cell lung tumor associated fibroblast cell and normal fibroblast
(1): miRNA expression in the normal fibroblast (NF) of genechip detection 3 routine Patients with Non-small-cell Lung tumor associated fibroblast cell (CAF) and pairing;
1. chip preparation and analysis: prepare lung carcinoma cell specimen according to the requirement of the LCSciences company of the U.S., transfer to LCSciences company to carry out chip preparation, SangermiRBaseV10.0 version completes chip analysis.
2. chip results: experimental data is from LCSciences company, and result as shown in Figure 1.
3. interpretation of result: compared with NF, in CAF, the downward of miR-1/miR-206 is the most obvious; The rise of miR-31 is the most obvious.
(2) qRT-PCR analyzes the expression of miR-1, miR-206 and miR-31 in the normal fibroblast (NF) of 15 pairs of Patients with Non-small-cell Lung tumor associated fibroblasts cell (CAF) and pairing
1. method: Trizol reagent extracts cell total rna, qRT-PCR uses Ambion company SuperTaq polymerase system and mirVana to detect box, and people U6 is as internal reference.
2.qRT-PCR result: as shown in Figure 2.
3. interpretation of result: compared with NF, in CAF, the downward ratio of miR-1/miR-206 reaches 86.7%; The rise ratio of miR-31 reaches 93.3%; Consistent with gene chip results.
Two .pre-miR-1, pre-miR-206 and anti-miR-31 cotransfection enters A549, H460
The cotransfection of miRNA plasmid and inhibitor: pre-miR-1, pre-miR-206 (purchased from invitrogen company) and anti-miR-31 (purchased from invitrogen company) is each separately transfected into A549, in H460 cell strain (purchased from institute of oncology of the Chinese Academy of Sciences).Concrete transfection method is as follows: day before transfection, every hole inoculation 3 × 10
5individual cell, in six porocyte culture plates, adds in every hole not containing antibiotic 1640 culture medium (purchased from invitrogen company), makes cell density during transfection reach 30%-50%;
1) pre-miR-1 is prepared, pre-miR-206-lipofecmine2000 mixed liquor, anti-miR-31-lipofecmine2000 mixed liquor:
A. for each transfection sample, prepare according to the following steps: the pre-miR-1 diluting 100pmol by 250ul1640 culture medium respectively, pre-miR-206, anti-miR-31, mix gently, incubated at room 5min;
B. lipo2000 is diluted: by 245ul1640 culture medium dilution 5ullipofecmine2000 (purchased from invitrogen company), mix gently, and incubated at room 5min;
C. a and b is mixed gently, incubated at room 20min, obtain pre-miR-1, pre-miR-206-lipofecmine2000 mixed liquor, anti-miR-31-lipofecmine2000 mixed liquor.
2) pre-miR-1, pre-miR-206-lipofecmine2000 mixed liquor, anti-miR-31-lipofecmine2000 mixed liquor are added in the culture hole of the 1500ul containing cell, mix gently;
3), after cultivating 6h, 1640 culture medium of Kong Zhonghan pre-miR-1, pre-miR-206-lipo2000 mixed liquor, anti-miR-31-lipo2000 mixed liquor are removed, changes fresh 1640 culture medium;
4) CO2 incubator culture plate being placed in 37 DEG C is cultivated, and obtains transfection cell strain.
Three. analyze cotransfection pre-miR-1, to A549 and H460 cell Infiltration and metastasis capacity in pre-miR-206 and anti-miR-31 to tumor associated fibroblast cell (CAF)
(1) method: Transwell tests the change of transfer ability after detection of lung cancer cell and CAF or CAF+pre-miR-1, pre-miR-206, anti-miR-31 co-culture of cells
A serum-free medium and Matrigel glue mix with 4:1 ratio by ();
B () is got the above-mentioned mixed liquor of 25 μ l and is added room on cell, operation is soft.C () 37 DEG C hatches 2 hours;
D () takes out cell, add 100 μ l serum-free RPMI-1640 culture fluid, 37 DEG C of aquations 30 minutes
E the cell dissociation after () transfection is resuspended in culture fluid
F () adds RPMI-1640 culture fluid and the 1x10 that 200 μ l contain 2% hyclone in ready Transwell cell
5individual cell, adds 600 μ l complete culture solutions in 24 corresponding orifice plates;
G () cultivates 48 hours;
H () washs twice with PBS after being taken out by cell, 95% ethanol fixes 15 minutes;
(i) violet staining 30 minutes;
J () PBS washs 2 times, softly wipe Transwell chamber cell with cotton swab;
K () microscope random counter 5 different visuals field cell number, take the mean.
(2) result measures: see Fig. 3, wherein in figure, Scr is negative control group, pre-miR-1 (in figure per-1), after pre-miR-206 (figure per-206) and anti-miR-31 (in figure anti-31) cotransfection to CAF, after A549 cell and H460 co-culture of cells, reduce its invasion and attack and transfer ability significantly.
(3) interpretation of result: cotransfection pre-miR-1, pre-miR-206 and anti-miR-31, in tumor associated fibroblast cell (CAF), can promote that it is to the conversion of normal fibroblast (NF): the cell namely after transfection by with lung carcinoma cell Dual culture after can suppress lung carcinoma cell invasion and transfer ability significantly.
Four. analyze cotransfection pre-miR-1, the impact on A549 and H460 Cell clonality in pre-miR-206 and anti-miR-31 to tumor associated fibroblast cell (CAF)
(1) method:
A () is taken the logarithm trophophase cell, blow and beat gently, make it to become unicellular, make viable count, with DMEM culture fluid adjustment cell density to 1 × 10 containing 10% hyclone with 0.25% trypsinization
6cell/mL.Then experimentally require to make gradient multiple dilutions;
B () prepares the LMP agar sugar liquid of 1% and 0.5% two concentration respectively with distilled water, after autoclaving, maintain in 40 DEG C and can not solidify.In 1:1 ratio make 1% agarose and 2 × DMEM culture medium (containing 2 × antibiotic and 20% calf serum) mixing after, get 3mL mixed liquor and inject diameter 6cm plate (10cm plate adds 7 ~ 10mL), cooled and solidified, can put CO as bottom-layer agar
2for subsequent use in incubator;
C () allows the agarose of 0.5% and 2 × DMEM culture medium mix mutually in sterile test tube in 1:1 ratio after, then in pipe, add the cell suspension of 0.2mL, fully mix, inject and be covered with 1% agarose bottom plate, then form two agar layer;
D (), after top-layer agar solidifies, inserts 37 DEG C of 5%CO
2cultivate 10 ~ 14 days in incubator.Under plate is placed on inverted microscope, observation of cell clone number.Calculate formation rate.
(2) result measures: Fig. 4.Wherein in figure, Scr is negative control group, pre-miR-1 (in figure per-1), after pre-miR-206 (figure per-206) and anti-miR-31 (in figure anti-31) cotransfection to CAF, after A549 cell and H460 co-culture of cells, reduce its cancerous cell clone significantly.
(3) interpretation of result: cotransfection pre-miR-1, pre-miR-206 and anti-miR-31, in tumor associated fibroblast cell (CAF), can promote that it is to the conversion of normal fibroblast (NF): the cell namely after transfection by with lung carcinoma cell Dual culture after can suppress lung carcinoma cell clonality significantly.
Five. the growth change of transplanted tumor in nude mice after lung carcinoma cell and CAF or CAF+pre-miR-1, pre-miR-206, anti-miR-31 co-culture of cells is compared in zoopery
(1) method: (1) 4-5 nude mice in age in week divides 3 groups to plant respectively at random: A549, A549+CAFs and A549+CAFs-TM (CAFs-TM represents: cotransfection pre-miR-1, pre-miR-206 and anti-miR-31 are to tumor associated fibroblast cell (CAFs)).(2) digest above cell and count, by 3 × 10
6individual cell serum-free RPMIDMEM culture medium is diluted to 150 μ l, is expelled to subcutaneous back place, nude mice both sides.(3) gross tumor volume is measured: nude mice by subcutaneous tumor starts to measure gross tumor volume as seen, within every two days, measures once, gross tumor volume computing formula: volume=0.5 × length × wide
2.After 28 days, tumor peeled off from nude mice health and weigh, frozen in liquid nitrogen pipe for extracting albumen or RNA does coherent detection.(4) lung that nude mice is put to death detected and carries out HE dyeing, calculating various shift indexs.Shift index=Lung metastases quantity/primary tumor weight;
(2) result measures: Fig. 5, Fig. 6, Fig. 7; With plant separately compared with A549 cell, growth and the transfer ability of planting the cell after CAFs and A549 co-culture of cells all can improve significantly.In CAFs, cotransfection pre-miR-1, pre-miR-206 and anti-miR-31 (in figure CAFs-TM) then can the growth of Tumor suppression and transfers.
(3) interpretation of result: cotransfection pre-miR-1, pre-miR-206 and anti-miR-31 is in tumor associated fibroblast cell (CAF), can promote that it is to the conversion of normal fibroblast (NF), thus growth and the transfer of pulmonary carcinoma can be suppressed in animal level.
Sequence table
SEQUENCELISTING
<110> Jiangsu Prov. People's Hospital
The application in anti-antitumor drug is prepared in the combination of a <120> miRNA
<130>
<160>3
<170>PatentInversion3.3
<210>1
<211>71
<212>DNA
<213> artificial sequence
<400>1
ugggaaacauacuucuuuauaugcccauauggaccugcuaagcuauggaauguaaagaag60
uauguaucuca71
<210>2
<211>86
<212>DNA
<213> artificial sequence
<400>2
ugcuucccgaggccacaugcuucuuuauauccccauauggauuacuuugcuauggaaugu60
aaggaagugugugguuucggcaagug86
<210>3
<211>19
<212>DNA
<213> artificial sequence
<400>3
gctatgccagcatcttgcc19
Claims (4)
1. a compositions of miRNA, is characterized in that described compositions comprises miR-1, the interference sequence of miR-206 targeting sequencing and miR-31.
2. the compositions of a kind of miRNA according to claim 1, is characterized in that described compositions comprises pre-miR-1, pre-miR-206 and anti-miR-31; The nucleotides sequence of wherein said pre-miR-1 is classified as SEQNO:1; The nucleotides sequence of pre-miR-206 is classified as SEQNO:2; The nucleotides sequence of anti-miR-31 is classified as SEQNO:3.
3. the compositions of a kind of miRNA according to claim 1 and 2, is characterized in that the application of described compositions in preparation treatment antitumor drug.
4. the compositions of a kind of miRNA according to claim 3, is characterized in that described being combined in is prepared to promote that the tumor associated fibroblast cell of lung nonsmall-cell lung cancer is to the application in the conversion medicine of normal fibroblast.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510964586.8A CN105561339B (en) | 2015-12-21 | 2015-12-21 | A kind of combination of miRNA prepares the application in anti-non-small cell lung cancer drug |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510964586.8A CN105561339B (en) | 2015-12-21 | 2015-12-21 | A kind of combination of miRNA prepares the application in anti-non-small cell lung cancer drug |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105561339A true CN105561339A (en) | 2016-05-11 |
| CN105561339B CN105561339B (en) | 2019-02-22 |
Family
ID=55872329
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510964586.8A Expired - Fee Related CN105561339B (en) | 2015-12-21 | 2015-12-21 | A kind of combination of miRNA prepares the application in anti-non-small cell lung cancer drug |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105561339B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111961645A (en) * | 2020-09-01 | 2020-11-20 | 杭州优渡生物科技有限公司 | Culture medium for efficiently amplifying human epidermal fibroblasts |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101400361A (en) * | 2006-01-05 | 2009-04-01 | 俄亥俄州立大学研究基金会 | Microrna-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer |
| WO2011109440A1 (en) * | 2010-03-01 | 2011-09-09 | Caris Life Sciences Luxembourg Holdings | Biomarkers for theranostics |
| WO2011127219A1 (en) * | 2010-04-06 | 2011-10-13 | Caris Life Sciences Luxembourg Holdings | Circulating biomarkers for disease |
| CN102725632A (en) * | 2009-08-28 | 2012-10-10 | 奥斯瑞根公司 | MiRNA biomarkers of lung disease |
-
2015
- 2015-12-21 CN CN201510964586.8A patent/CN105561339B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101400361A (en) * | 2006-01-05 | 2009-04-01 | 俄亥俄州立大学研究基金会 | Microrna-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer |
| CN102725632A (en) * | 2009-08-28 | 2012-10-10 | 奥斯瑞根公司 | MiRNA biomarkers of lung disease |
| WO2011109440A1 (en) * | 2010-03-01 | 2011-09-09 | Caris Life Sciences Luxembourg Holdings | Biomarkers for theranostics |
| WO2011127219A1 (en) * | 2010-04-06 | 2011-10-13 | Caris Life Sciences Luxembourg Holdings | Circulating biomarkers for disease |
Non-Patent Citations (8)
| Title |
|---|
| JI QI, ET AL.1: "MicroRNAs and lung cancers: from pathogenesis to clinical implications", 《FRONT. MED.》 * |
| KOZOMARA, A., ET AL.: "Genbank accession number:LM608178.1", 《GENBANK》 * |
| KOZOMARA, A., ET AL.: "Genbank accession number:LM608529.1", 《GENBANK》 * |
| KOZOMARA, A., ET AL.: "Genbank accession number:LM608609.1", 《GENBANK》 * |
| MABGORZATA GUZ, ET AL.: "MicroRNAs-Role in Lung Cancer", 《DISEASE MARKERS》 * |
| SOMESH BARANWAL, ET AL.: "miRNA control of tumor cell invasion and metastasis", 《INTERNATIONAL JOURNAL OF CANCER》 * |
| 关雅萍 等: "MicroRNA: 一种新型的肺癌诊断、预测和治疗的生物标志物", 《中国肿瘤生物治疗杂志》 * |
| 章颖: "miRNAs 在非小细胞肺癌应用中的研究进展", 《中国医药生物技术》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111961645A (en) * | 2020-09-01 | 2020-11-20 | 杭州优渡生物科技有限公司 | Culture medium for efficiently amplifying human epidermal fibroblasts |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105561339B (en) | 2019-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Loss of exosomal miR-320a from cancer-associated fibroblasts contributes to HCC proliferation and metastasis | |
| Zhang et al. | microRNA-150 inhibits human CD133-positive liver cancer stem cells through negative regulation of the transcription factor c-Myb | |
| Wu et al. | miR-362-5p inhibits proliferation and migration of neuroblastoma cells by targeting phosphatidylinositol 3-kinase-C2β | |
| CN103648505B (en) | The material relevant to microRNA-21, mispairing reparation and colorectal carcinoma and method | |
| Wang et al. | MicroRNA-195 inhibits human gastric cancer by directly targeting basic fibroblast growth factor | |
| Tian et al. | lncRNA SNHG8 promotes aggressive behaviors of nasopharyngeal carcinoma via regulating miR-656-3p/SATB1 axis | |
| CN104208723B (en) | MiR-638 application in anti-acute myeloid leukemia | |
| CN101804208A (en) | Application of miR-451 in preparing medicine for treating non-small cell lung cancer | |
| CN104774929A (en) | Applications of miR-455-3p in diagnosis, treatment and prognosis of esophageal squamous cancer | |
| CN110251529A (en) | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament | |
| CN110229901A (en) | Gene hsa_circ_0027089 relevant to triple negative breast cancer diagnosis and treatment and its application | |
| CN104140968A (en) | Radiotherapy-targeted sensitizer and application thereof | |
| CN105886507B (en) | Application of the long-chain non-coding RNA FAM83H-AS1 in preparation treatment non-small cell lung cancer drug | |
| CN105412944A (en) | Effect of miR-451a cells in non-small cell lung cancer | |
| CN105561339A (en) | Application of miRNA (micro-ribonucleic acid) composition to preparing non-small cell lung cancer resisting medicines | |
| CN106244679A (en) | MiR 100 inhibitor purposes in reducing cancer metastasis | |
| CN101240261A (en) | Human breast cancer cell line SK-3rd and construction method thereof | |
| CN108384757B (en) | Method for preparing oxaliplatin-resistant cell line of human gallbladder cancer | |
| CN109745335A (en) | MiR-218 is preparing the application in mammary cancer chemotherapy drug sensitizer | |
| CN109966496A (en) | MiRNA-5571 is preparing the application in resistive connection rectal neoplasm drug | |
| CN109224076B (en) | Gene miR-140-3P related to lung cancer diagnosis and treatment, and mimics and application thereof | |
| Ma et al. | Developing an effective therapeutic by delivery of synthetic microRNA-520e in lung cancer treatment | |
| CN105833274A (en) | Application of miR-200c-3p in preparation of CXCR6 inhibitor | |
| CN109172593A (en) | Application of the miR-516a as the target for the treatment of bladder cancer | |
| CN110257522A (en) | Gene hsa_circ_0045881 relevant to breast cancer diagnosis and treatment and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190222 Termination date: 20201221 |